CN113744800B

CN113744800B - Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker

Info

Publication number: CN113744800B
Application number: CN202110644560.0A
Authority: CN
Inventors: 潘庆华; 柴瑞鹏; 陈心仪; 华丽霞; 王玲
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2021-06-09
Filing date: 2021-06-09
Publication date: 2022-06-24
Anticipated expiration: 2041-06-09
Also published as: CN113744800A

Abstract

The invention discloses a technical system which has the advantages of compatibility and accurate identification and excavation of rice blast Pik disease-resistant allele families. The technical system sets a three-level detection marker according to the clear three-level differentiation of 'haplotype-sub-haplotype-allele' and the like of the gene family. The technical system can be used for identifying and excavating the disease-resistant genes of the rice blast Pik disease-resistant allele family, and has systematic and strict inclusion and comparability. But also is suitable for the identification and excavation of disease-resistant genes of other various plant disease systems in the ubiquitous disease-resistant allele family situation, and has remarkable openness and universality. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.

Description

Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a technical system which has inclusiveness and can accurately identify and mine a rice blast Pik disease-resistant allele family.

Background

Rice is one of the most important food crops in the world, and more than half of the population takes rice as staple food. The rice blast caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious diseases affecting rice production, and causes a large amount of grain loss every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance relies on direct identification of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, the identification result is easy to cause errors, and the selection efficiency of target genes, especially the aggregation of the same type of target genes, is very low or even impossible. With the development of molecular marker identification technology, the application value and the prospect of the technology are more and more concerned due to the advantages of convenience, reliability, no environmental influence and the like. In plant breeding, by developing molecular markers closely linked to target genes, particularly developing functional specific molecular markers in genes, the reliability of selection of target genes is high, thereby greatly accelerating the breeding process.

Generally, in the course of 'mungbean competition' in which the disease-resistant genes of host plants and the avirulence genes of pathogenic bacteria are long, the disease-resistant genes generate new disease-resistant specificity in the form of 'gene family' or 'multi-allele family' with the lowest evolution cost, so that the disease-resistant specificity can keep pace with the rapid variation of the avirulence genes. That is, under long-term and strong selection pressure of pathogenic bacteria, the above-mentioned 'gene family' generally produces functional/non-functional haplotype (haplotype) differentiation; if it is a broad spectrum persistent resistance 'gene family' used for a long time in breeding programs, it will further differentiate into different sub-haplotypes (sub-haplotypes) in the functional haplotypes; while in the sub-haplotype, it further differentiated into resistance genes (resistance genes) with different resistance specificities (Zhai et al 2011, New Phytologist 189: 321-334).

There are obvious and clear nucleotide polymorphisms including Single Nucleotide Polymorphisms (SNPs) and polynucleotide polymorphisms (i.e., insertions/deletions, indels) in the three-stage evolutionary processes of "haplotype-subunit-resistance genes", and the like. Herein, the SNP and InDel within a functional gene are collectively referred to as a functional nucleotide polymorphism. Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene cluster, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene clusters at the same time. Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly aggregate in gene clusters of rice chromosomes 1(Pi37 cluster), 2(Pib cluster), 6(Pi2/Pi9 cluster), 8(Pi36 cluster), 9(Pii cluster), 11(Pik cluster) and 12(Pita cluster), wherein the gene clusters of

chromosomes

6,11 and 12 are the main sources of broad-spectrum persistent resistance genes (Sharma et al 2012, Agricultural Research 1: 37-52; Liu and Wang 2016, National Science Review 3: 295-.

As described above, the Pik gene family located at the long-arm end of chromosome 11 is the most widely used broad-spectrum persistent resistance source in the global rice breeding program for disease resistance (Wang et al 2009, Phytopathology 99: 900-. Besides the traditional 5 alleles (Pik, Pik-m, Pik-s, Pik-p, Pik-h), under the long-term and strong selection pressure of rice blast germs, the gene family generates a plurality of alleles with more specific and broad spectrum resistance, such as Pi1 and the like (Ashikawa et al 2008, Genetics 180: 2267. sup. 2276; Wang et al 2009, Phytopathology 99: 900. sup. 905; Yuan et al 2011, the or Appl Genet 122: 1017. sup. 1028; Zhai et al 2011, New Phytology 189: 321. sup. 334; Hua et al 2012, the app I Genet 125: 1047. sup. 1055; Zhai et al 2014, Plos One 9: e 98067). Early studies showed that (1) the gene family forms functional (K-type)/non-functional (N-type) haplotype differentiation due to the presence of a large InDel (127/70kb) near the centromere orientation (Yuan et al 2011, Theor Appl Genet 122: 1017-; (2) the differentiation of KM (Pik-m and the like) and KH (Pik-h and the like) sub-haplotypes further exists in K haplotype (Dian Chun, 2012, the doctrine of university of agriculture, south China); (3) the rice blast resistance of all Pik alleles must be co-mediated by 2 adjacent NBS-LRR (nucleotide binding site-rich repeat) type disease-resistant genes (abbreviated as #1 and #2 genes herein) (Ashikawa et al 2008, Genetics 180: 2267. sup. 2276; Wang et al 2009, Phytopathology 99: 900. sup. 905; Yuan et al 2011, Theor Appl Genet 122: 1017. sup. 1028; ZHai et al 2011, New Phytolist 189: 321. sup. 334; Hua et al 2012, Theor Appl Genet 125: 1047. sup. 1055; ZHai et al 2014, Plos 9: e 98067). Thus, in combination with the genotypes of the paired genes #1 and #2, functional haplotypes are only one type (varieties in which both paired genes #1 and #2 are functional genotypes; K1/K2), while non-functional haplotypes exist in multiple types (varieties in which one or none of the paired genes #1 and #2 lacks a functional genotype, including but not limited to N1, N2, K1, K2, N1/N2, N1/K2, K1/N2, etc.); there are 4 types of functional subunits (KM1/KM2, KH1/KH2, KM1/KH2, KH1/KM2) (Dianzhu, 2012, the university of southern China, doctor's academic thesis; Zhai et al 2011, New Phytologist 189: 321-.

As the Pik gene family is the most important broad-spectrum source of resistance in rice breeding programs for resisting diseases and is widely used for a long time, under the continuous and strong selection pressure of rice blast germs, complex and diverse variation is generated in the three-level evolution layers of 'haplotype-subunit-allele' and the like. However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the current research results of disease-resistant gene molecular markers are almost developed aiming at specific sites of specific genes; including the previous Pik-s function specific molecular marker patent of the applicant (Chinese patent ZL 201210118460.5); the SNP molecular marker of Pik locus and the application thereof in Huazhi biotechnology limited company application (Chinese patent 2020115661479); and the article of Pik-related Molecular markers (Tian et al 2021, Journal of Integrated Agriculture 20: 1554-. For a complex gene family, the 2 problems that arise are: (1) the problem of false positive caused by the technical limitation of molecular markers is difficult to avoid by the molecular markers of any specific gene (the same specific fragments/sites do not represent the test varieties and contain the genes completely consistent with the target genes); (2) the molecular markers of any specific gene are difficult to form a technical system with compatibility and comparability, so that novel alleles are continuously mined and identified in a complex gene family, and the problems of ' synonym, homonym and heterogene ', true and false target genes ' and the like which are easily generated in the complex gene family are identified.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pik disease-resistant allele families. The technical system has clear 'haplotype-subunit-allele' and other three grades according to the gene familySetting three-stage detection marks; the optimal haplotype-specific molecular marker combination detected by functional haplotype (# K1/K2 with both paired genes of #1 and #2 being functional genotypes)/non-functional haplotype (#1 and #2 with one or no functional genotypes in the paired genes, including but not limited to N1/N2, N1/K2, K1/N2 and the like) is Pik-K1^{P/A(1-6230～6419)}/Pik-N1^{P/A(1-6230～6419)}And Pik-K2^{P/A(2-930～1110)}/Pik-N2^{P/A(2-930～1110)}(ii) a The optimal molecular marker combination of the sub-haplotype (KM1/KM2, KH1/KH2, KM1/KH2 and KH1/KM2) of the K1/K2 functional haplotype was KM1/KH1^G1-357A//KM2/KH2^G2-1559C(ii) a The optimal target gene specific molecular marker combination for detecting broad spectrum persistent resistance gene Pik of KM1/KM2 sub-haplotype of K1/K2 functional haplotype is Pik^T1-2793CAnd Pik^T1-5932G(ii) a The optimal target gene specific molecular marker for detecting broad spectrum persistent resistance gene Pik-m of KM1/KM2 sub-haplotype of K1/K2 functional haplotype is Pikm^C1-851G/A(ii) a The optimal target gene specific molecular marker combination for the detection of the resistance gene Pik-s of the KM1/KM2 sub-haplotype of the K1/K2 functional haplotype is KM2/KH2^G2-1559CAnd Piks^C1-957T(ii) a The optimal target gene specific molecular marker combination detected by the broad spectrum persistent resistance gene Pi1 of the KM1/KM2 sub-haplotype of the K1/K2 functional haplotype is Pi1^T1-853GAnd Pi1^T2-2519A(ii) a The optimal target gene specific molecular marker combination detected by the novel resistance gene Pik-IR8 of the KM1/KH2 mixed subunit type of the K1/K2 functional haplotype is Pik-IR8^A1-149GAnd Pik-IR8^A1-927G(ii) a The optimal target gene specific molecular marker combination detected by broad spectrum persistent resistance gene Pik-p/Pi7 of K1/K2 functional haplotype KH1/KH2 subunit is Pikp/7/KH^A2-2137GAnd Pikp/7^T1-961A/G/C(ii) a The optimal target gene specific molecular marker combination for detecting broad spectrum persistent resistance gene Pik-h of K1/K2 functional haplotype KH1/KH2 subunit type is Pikp/7/KH^A2-2137GAnd Pikh^A1-961T/G/C(ii) a The optimal target gene detected by a novel resistance gene Pik-IR64 of a KH1/KH2 sub-haplotype which is a K1/K2 functional haplotypeThe specific molecular marker combination is Pik-IR64^T1-3013CAnd Pik-IR64^T1-5468C(ii) a The identification result of any detection marker which does not conform to the technical system is not the corresponding target gene, so that the detection marker is inferred to be a possible novel allele of the gene family.

The second purpose of the invention is to provide a method for comparing the rice blast Pik disease-resistant allele family sequence and identifying the specific sequence thereof.

The third objective of the invention is to provide a functional (K1/K2)/non-functional haplotype specific molecular marker of a rice blast Pik disease-resistant allele family and an identification method thereof.

The fourth purpose of the invention is to provide a sub-haplotype (KM1/KM2, KH1/KH2, KM1/KH2 and KH1/KM2) specific molecular marker of the K1/K2 functional haplotype of the Pik disease-resistant allele family and an identification method thereof.

The fifth purpose of the invention is to provide a specific molecular marker of the broad-spectrum durable resistance gene Pik of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family and an identification method thereof.

The sixth purpose of the present invention is to provide the specific molecular markers of the broad-spectrum durable resistance gene Pik-m of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family and the identification method thereof.

The seventh purpose of the invention is to provide a specific molecular marker of the disease-resistant gene Pik-s of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family and an identification method thereof.

The eighth purpose of the present invention is to provide the specific molecular markers of the broad-spectrum persistent resistance gene Pi1 of KM1/KM2 sub-haplotype of the K1/K2 functional haplotype of the Pik disease-resistant allele family of rice blast and the identification method thereof.

The ninth purpose of the invention is to provide a specific molecular marker of the novel allele Pik-IR8 of KM1/KH2 mixed subunit type of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family and an identification method thereof.

The tenth objective of the invention is to provide a specific molecular marker of broad-spectrum durable resistance gene Pik-p/Pi7 of KH1/KH2 subunit type of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family and an identification method thereof.

The eleventh object of the present invention is to provide specific molecular markers for broad-spectrum persistent resistance gene Pik-h of KH1/KH2 subunit type, which is a K1/K2 functional haplotype of the above-mentioned blast disease Pik disease-resistant allele family, and methods for identifying the same.

The twelfth object of the present invention is to provide specific molecular markers for the novel allele Pik-IR64 of the K1/K2 functional haplotype, KH1/KH2 haplotype, of the Pik disease-resistant allele family mentioned above, and a method for identifying the same.

The thirteenth purpose of the invention is to provide the application and examples for identifying and mining Pik disease-resistant alleles from unknown rice seed resource groups by using the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pik disease-resistant allele families.

The fourteenth purpose of the invention is to provide an application and an example for screening the heteronymous genes and homonymous heterogenous genes existing in the allele family from rice seed resources by using the technical system which has the advantages of inclusion and accurate identification and mining of the rice blast Pik disease-resistant allele family.

The fifteenth purpose of the invention is to provide the application and the example for screening true and false target genes existing in the allele family from rice seed resources by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pik disease-resistant allele family.

The purpose of the invention is realized by the following technical scheme (a technical route chart is shown in figure 1):

the invention provides a method for comparing sequences of rice blast Pik disease-resistant allele families and identifying specific sequences (figures 2-12). Wherein the content of the first and second substances,

the sequences of the rice blast Pik disease-resistant allele family of 11 sequencing reference varieties were retrieved and downloaded from public databases such as the national center of biotechnology information (NCBI; http:// www.ncbi.nlm.nih.gov), wherein the genomic sequences of 7 rice blast Pik allele families that had been isolated and cloned were (except for Pik-m, the remaining 6 genes were cloned and provided by the applicant):

NCBI accession number for Pik: HM 048900.1;

the NCBI accession number for Pik-m is: AB 462256.1;

the NCBI accession number for Pik-s is: HQ 662329.1;

the NCBI accession number of Pi1 is: HQ 606329.1;

the NCBI accession number for Pik-p is: HM 035360.1;

the NCBI accession number of Pi7 is: HQ 660231.1;

the NCBI accession number for Pik-h is: HQ 662330.1.

In order to facilitate sequence comparison and analysis, 2 genome sequences corresponding to sequencing reference susceptible varieties Nipponbare (NPB) and Suijing 18 (SJ 18) are added;

in order to verify the inclusion and openness of the technical system, 2 genome sequences corresponding to sequencing reference anti-disease varieties IR8 and IR64 are added.

Sequence comparison analysis was performed by bioinformatics methods. The results show that the method has the advantages of high efficiency,

(1) the sequences of the #1 and #2 genes of the Pik disease-resistant allele family both have obvious functional haplotypes (Pik, Pik-m, Pik-s, Pi1, Pik-IR8, Pik-p, Pi7, Pik-h, Pik-IR64) and non-functional haplotypes (Pik-NPB, Pik-SJ18) (typical positions are shown as the markers #1 and # 2);

(2) sequence of Pik disease resistance allele family in the functional haplotype, there was further a distinct differentiation of KM sub-haplotype (Pik-m, Pik, Pik-s, Pi1, Pik-IR8) and KH sub-haplotype (Pik-h, Pik-p, Pi7, Pik-IR64, Pik-IR8) (typical positions are shown as markers #3 and # 4; wherein Pik-IR8 belongs to KM/KH mixed sub-haplotype);

(3) functional specific SNPs (typical positions are shown as markers #5 to # 17) exist in 9 functional family members of the Pik disease-resistant allele family.

The present invention provides specific molecular markers for functional/non-functional haplotypes of the Pik disease-resistant allele family and methods for their identification (FIG. 3). Wherein the content of the first and second substances,

(1) design of haplotype-specific molecular markers: based on the alignment results of the Pik disease-resistant allele family sequences, haplotype-specific 2 sets of P/A markers were developed for the clearly differentiated genomic regions of functional/non-functional haplotypes. That is, #1 Gene: Pik-K1^{P/A(1-6230～6419)}/Pik-N1^{P/A(1-6230～6419)}(ii) a The #2 gene: Pik-K2^{P/A(2-930～1110)}/Pik-N2^{P/A(2-930～1110)}；

Description of the labeling: k1 and K2, which represent the functional haplotypes of the #1 and #2 genes, respectively; correspondingly, N1 and N2, respectively, represent non-functional haplotypes for the #1 and #2 genes; P/A, presence (presence; target genotype)/absence (absence; non-target genotype); 1-6230-6419, meaning the # 6230-6419 genome segment of the #1 gene, and so on (the same below);

(2) 18 different types of test varieties were examined, and thus they were classified into the following 2 types of genotypes (haplotypes):

functional haplotype varieties (#1 and #2 varieties with both paired genes functional genotypes; K1/K2): CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep; CK9, IR 8; CK10, K60; CK11, IRBLkp-K60; CK12, IRBL 7-M; CK13, IRBLkh-K3; CK14, IR 64;

non-functional haplotype varieties (# varieties lacking one or completely lacking functional genotypes in paired genes #1 and # 2): CK15, Nipponbare (N1/N2); CK16, Achi Asahi (N1/N2); CK17, Maowangu (N1/K2); CK18,93-11 (N2);

in particular, since functional/non-functional haplotype specific markers for Pik alleles are markers that are 'presence/absence' of each other, generally only one pair of functional haplotype specific markers will be detected; furthermore, all haplotype varieties (N1N2, K1N2, N1K2, K1, K2, N1, N2, etc.) other than the functional haplotype variety (K1K2) can be judged as non-functional haplotype varieties and can be excluded from the subsequent tests.

The present invention provides specific molecular markers for the functional haplotype sub-haplotype of the Pik disease resistance allele family and methods for their identification (figure 4). Wherein, the first and the second end of the pipe are connected with each other,

(1) design of subunit-specific molecular markers: based on the alignment of the above-mentioned Pik disease-resistant allele family sequences, it was found that more than 10 SNPs (#1 genes: G1-357A, T1-424C, T1-489C, etc.; #2 genes: A2-696T, G2-1559C, etc.) could further classify functional haplotypes into KM sub-haplotypes (similar to Pik-m) and KH sub-haplotypes (similar to Pik-h). 4 of these (G1-357A, T1-424C; A2-696T, G2-1559C) were designed as subunit-specific molecular markers and 2 of the best combinations of subunit-specific molecular markers, namely the #1 gene: KM1/KH1^G1 ^-357A(upper belt, KM 1; lower belt, KH 1); the #2 gene: KM2/KH2^G2-1559C(upper belt, KM 2; lower belt, KH 2);

description of the labeling: KM1/KH1^G1-357AThe KM/KH subunit-specific SNP located at #357 in the #1 gene, and so on;

(2) the 14 functional haplotype test varieties were examined and thus classified into the following 3 types of genotypes (sub-haplotypes):

KM1/KM2 sub-haplotype variety: CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep;

KH1/KH2 haplotype variety: CK10, K60; CK11, IRBLkp-K60; CK12, IRBL 7-M; CK13, IRBLkh-K3; CK14, IR 64;

KM1/KH2 mixed subunit type variety: CK9, IR 8.

The invention provides specific molecular markers of broad-spectrum persistent resistance gene Pik of K1/K2 functional haplotype KM1/KM2 sub-haplotype of Pik disease-resistant allele family and an identification method thereof (figure 5). Wherein the content of the first and second substances,

(1) design of Pik-specific molecular markers: according to the alignment result of the Pik disease-resistant allele family sequence, 4 target gene Pik specific SNPs are found (A1-1380T, G1-2588T, T1-2793C, T1-5932G); among them, A1-1380T and G1-2588T were excluded as SNPs generated due to sequencing errors. 2 real SNPs were designed as Pik functional specific scoresSub-marker Pik^T1-2793C(upper band, non-target gene; lower band, target gene) and Pik^T1-5932G(upper band, target gene; lower band, non-target gene); .

(2) The 14 functional haplotype test varieties are detected, and the result shows that the 2 Pik-specific molecular markers can distinguish Pik from all alleles of the gene family:

the target gene carries the variety: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik);

non-target gene carrying varieties: CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64).

The invention provides specific molecular markers of broad-spectrum persistent resistance gene Pik-m of K1/K2 functional haplotype KM1/KM2 sub-haplotype of Pik disease-resistant allele family and an identification method thereof (figure 7). Wherein the content of the first and second substances,

(1) design of Pik-m specific molecular markers: according to the alignment result of the Pik disease-resistant allele family sequences, a unique specific SNP (C1-851G/A) of the target gene Pik-m is found; it is designed as a specific molecular marker Pikm of Pik-m^C1-851G/A(upper and lower bands, non-target gene; middle band, target gene);

(2) the 14 functional haplotype test varieties are detected, and the result shows that the 1 Pik-m specific molecular marker can distinguish Pik-m from all alleles of the gene family:

the target gene carries the variety: CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64).

The invention provides a specific molecular marker of disease-resistant gene Pik-s of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family and an identification method thereof (figure 8). Wherein the content of the first and second substances,

(1) design of Pik-s specific molecular markers: according to the alignment results of the above Pik disease resistance allele family sequences, no SNP specific to the target gene Pik-s was found, but an optimal combination [ C1-957T + G2-1559C (#4KM2/KH2)]But can distinguish the target gene Pik-s from all alleles of the gene family; the two are combined into a specific molecular marker of Pik-s: piks^C1-957T(upper band, non-target gene; lower band, target gene); KM2/KH2^G2-1559C(upper band, target gene; lower band, non-target gene);

(2) the 14 functional haplotype test varieties are detected, and the result shows that the combination of the 2 Pik-s specific molecular markers can distinguish Pik-s from all alleles of the gene family:

the target gene carries the variety: CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64).

The invention provides a specific molecular marker of a broad spectrum persistent resistance gene Pi1 of a KM1/KM2 sub-haplotype of a K1/K2 functional haplotype of a Pik disease-resistant allele family and an identification method thereof (figure 9). Wherein the content of the first and second substances,

(1) design of Pi 1-specific molecular markers: according to the alignment result of the Pik disease-resistant allele family sequences, 4 target gene Pi1 specific SNPs (T1-853G, C1-3273G, T1-3783G, T2-2519A) are found; wherein C1-3273G, T1-3783G were excluded by verifying SNPs generated due to sequencing errors. The 2 real SNPs were designed as Pi 1-specific molecular marker Pi1^T1-853G(upper and lower bands, non-target gene; middle band, target gene) and Pi1^T2-2519A(upper band, non-target gene; lower band, target gene);

(2) the 14 functional haplotype test varieties were tested, and the results showed that the 2 Pi1 specific molecular markers could differentiate Pik from all alleles of the gene family:

the target gene carries the variety: CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64).

The invention provides a specific molecular marker of a novel resistance gene Pik-IR8 of a KM1/KH2 mixed subunit type of a K1/K2 functional haplotype of a Pik disease-resistant allele family and an identification method thereof (figure 10). Wherein the content of the first and second substances,

(1) design of Pik-IR8 specific molecular markers: according to the alignment result of the Pik disease-resistant allele family sequences, 2 SNPs (A1-149G, A1-927G) specific to the target gene Pik-IR8 are found; it is designed as a Pik-IR8 specific molecular marker Pik-IR8^A1-149G(upper band, non-target gene; lower band, target gene) and Pik-IR8^A1-927G(upper band, non-target gene; lower band, target gene);

(2) the 14 functional haplotype test varieties are detected, and the results show that the 2 Pik-IR8 specific molecular markers can distinguish Pik from all alleles of the gene family:

the target gene carries the variety: CK9, IR8(Pik-IR 8);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64).

The present invention provides specific molecular markers of broad spectrum persistent resistance gene Pik-p/Pi7/Pik-h of KH1/KH2 subunit type of K1/K2 functional haplotype of Pik disease-resistant allele family and its identification method (FIG. 11). Wherein the content of the first and second substances,

(1) design of Pik-p/Pi7/Pik-h specific molecular marker: according to the alignment result of the Pik disease-resistant allele family sequence, 1 SNP (T1-1229C) specific to the target gene Pik-p is found and is eliminated as being generated by sequencing error; no specific SNPs were found for Pi7 and Pik-h, but an optimal combination [ A2-2137G + T1-961A/C/G + A1-961T/C/G ]]But can distinguish 3 target genes from all alleles of the gene family; the three are combined into a Pik-p/Pi7/Pik-h specific molecular marker: pikp/7/kh^A2-2137G(upper band, target gene; lower band, non-target gene), Pikp/7^T1-961A/G/C(upper band, non-target gene; lower band, target gene), Pikh^A1-961T/G/C(upper band, non-target gene; lower band, target gene);

(2) the 14 functional haplotype test varieties are detected, and the result shows that the group of 3 Pik-p/Pi7/Pik-h specific molecular markers can distinguish 3 target genes from all alleles of the gene family:

the target gene Pik-p is the same as Pi7, and carries the varieties: CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7);

the target gene Pik-h carries a variety: CK13, IRBLkh-K3 (Pik-h);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK14, IR64(Pik-IR 64).

In particular, there were 2 sequencing errors verified by the above molecular markers:

(a) pik-p has the same sequence as Pi7, with no SNPs: pi7 with #961C being # 961T;

(b) pik-h #961G is actually #961A (see reference #15b of FIG. 11 for details).

The present invention provides specific molecular markers of a novel resistance gene Pik-IR64 of KH1/KH2 haplotype, which is a K1/K2 functional haplotype of the Pik disease-resistant allele family, and a method for identifying the same (FIG. 12). Wherein the content of the first and second substances,

(1) design of Pik-IR64 specific molecular markers: based on the alignment results of the Pik disease resistance allele family sequences, 17 SNPs specific to the target gene Pik-IR64 were found (T1-3013C, G1-4705A, T1-5468C, etc.); 3 of them (T1-3013C, G1-4705A, T1-5468C) were designed as Pik-IR64 specific molecular markers, and 2 of them were selected as the most optimal Pik-IR64 specific molecular marker combination: Pik-IR64^T1-3013C(upper band, non-target gene; lower band, target gene) and Pik-IR64^T1-5468C(upper band, non-target gene; lower band, target gene);

(2) the 14 functional haplotype test varieties are detected, and the results show that the 2 Pik-IR64 specific molecular markers can distinguish Pik-IR64 from all alleles of the gene family:

the target gene carries the variety: CK14, IR64(Pik-IR 64);

non-target gene carrying varieties: CK1, kusabue (pik); CK2, IRBLk-Ka (Pik); CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h).

The present invention provides an example of identifying and mining Pik alleles from an unknown population of rice seed resources using the above-described set of techniques that are inclusive and accurate for identifying and mining families of disease-resistant alleles of rice blast Pik (fig. 13). Wherein, the first and the second end of the pipe are connected with each other,

(1) the test varieties comprise: 8 Pik allele carriers were used as control varieties (CK 1-8); CK1, kusabue (pik); CK2, Tsuyuake (Pik-m); CK3, Shin 2 (Pik-s); CK4, C101LAC (Pi 1); CK5, IR8(Pik-IR 8); CK6, K60(Pik-p — Pi 7); CK7, IRBLkh-K3 (Pik-h); CK8, IR64(Pik-IR 64); CV1-15 is an ancient indica rice variety; CV16-30 is a modern indica variety; CV31-45 is an ancient japonica rice variety; CV46-60 is a modern japonica rice variety;

(2) identification of functional/non-functional haplotypes for the Pik alleles (fig. 13 a): among the 60 varieties to be tested,

21K 1/K2 functional haplotype varieties: CV1, CV2, CV4, CV10, CV14, CV18, CV19, CV27, CV32, CV36, CV37, CV45, CV46, CV48, CV49, CV50, CV51, CV54, CV56, CV57, CV 58;

in particular, since functional/non-functional haplotype-specific markers for the Pik allele are not so 'presence/absence' markers, it is generally only necessary to detect a pair of functional haplotype-specific markers; and the other varieties except the functional haplotype variety can be judged as non-functional haplotype varieties and excluded from the subsequent detection;

(3) identification of the sub-haplotype of the Pik allele (fig. 13 b): among the 21K 1/K2 functional haplotype test varieties,

11 of the KM1/KM2 subunit varieties: CV10, CV36, CV37, CV46, CV48, CV49, CV50, CV54, CV56, CV57, CV 58;

7 were KH1/KH2 subunit varieties: CV1, CV4, CV14, CV18, CV19, CV27, CV 45;

1 hybrid sub-haplotype variety KM1/KH 2: CV 2;

2 were KH1/KM2 mixed subunit varieties: CV32, CV 51;

(4) identification of Pik alleles: among 21K 1/K2 functional haplotype test varieties,

the target gene Pik carries the variety (fig. 13 c): CV54, CV56, CV57, CV 58;

the target gene Pik-m carries the variety (fig. 13 d): none;

the target gene Pik-s carries the variety (FIG. 13 e): CV36, CV37, CV46, CV48, CV49, CV 50;

the target gene Pi1 carries a variety (fig. 13 f): none;

the target gene Pik-IR8 carries the variety (fig. 13 g): CV 2;

the target gene Pik-p carries a variety (fig. 13 h): CV 27;

the target gene Pik-h carries the variety (fig. 13 h): none;

the target gene Pik-IR64 carries the variety (fig. 13 i): CV1, CV4, CV14, CV18, CV19, CV 45;

novel Pik allele bearing varieties (fig. 13 c-i): CV10, CV32, CV 51.

Since the genotypes of the newly-mined 3 novel alleles are different from those of the known 8 alleles and are different from each other, they are named as Pik-CKN (Chikenuo, CV 10; GenBank MZ358906), Pik-GDD (Gaoyang diandaodahongmeng, CV 32; GenBank MZ358907), Pik-SRC (Saricetik, CV 51; the gene sequence has been disclosed in Diagnchu, 2012, doctor university of south China agricultural university).

This example demonstrates the compatibility and comparability of the present system, since the 2 new genes (Pik-IR8, Pik-IR64) were found and added.

The invention provides a technical system for identifying and mining the rice blast Pik disease-resistant allele family with the inclusion property and the accuracy, and the positive and negative examples of the 'synonymy gene' and the 'homonymy heterogenous gene' generated among 3 disease-resistant genes Pik-p/Pi7/Pik-h of the Pik disease-resistant allele family are screened (figures 3,4 and 11). Wherein the content of the first and second substances,

in the normal example 1: as mentioned above, the carrier of the target gene Pik-p should belong to the K1/K2 functional haplotype (class I markers; FIG. 3), KH1/KH2 functional haplotype (class II markers; FIG. 4) of the Pik gene family and 2 function-specific molecular markers (class III markers; FIG. 11) (Pikp/7/KH)^A2-2137G,Pikp/7^T1-961A/G/C) All positive (containing the target gene, the same below). Therefore, 2 varieties (CK10, CK11) are deduced to carry the target gene Pik-p;

counter example 1-1, variety CK12 was originally identified as a carrier of Pi7 (Tsunematsu et al.2000, Breed Sci,50: 229-. However, in the technical system, the result of the three-stage molecular marker detection is completely the same as that of Pik-p. It was concluded that Pi7 was a "synonym" for Pik-p, i.e., the original specific SNP (C1-961T/A/G) of the gene was a sequencing error and was identical to Pik-p (T1-961A/G/C) (FIG. 11).

Counterexamples 1-2, variety CK13 was identified as a carrier of Pik-h (Tsunematsu et al 2000, Breed Sci,50: 229-. In this discrimination system, CK13(Pik-h) was labeled at level I (FIG. I)3) Class II molecular markers (FIG. 4), and class III molecular markers Pikp/7/kh^A2-2137GThe results were identical to those of CK10, CK11(Pik-p), and CK12(Pi7 ═ Pik-p), and Pikp/7^T1-961A/G/CThe results of the detection were not identical to that of Pik-p/Pi7 (FIG. 11), and thus it seems to be inferred that the Pik-h specific SNP is (G1-961T/A/C) as the sequencing result. However, there was no difference between cultivars CK10-14 when this SNP (G1-961T/A/C) was designed as a molecular marker (reference marker in FIG. 10), and cultivar CK13 was different from the whole CK cultivars when this SNP (A1-961T/G/C) was designed as a molecular marker. This indicates that "homonymous heterogene", i.e.Pikh, was generated by sequencing errors^G1-961T/A/CAnd Pikh^A1 ^-961T/G/CIs a different Pik allele, whereas the latter is true Pik-h (fig. 11).

The invention provides a technical system for identifying and mining the rice blast Pik disease-resistant allele family with compatibility and precision for screening true and false disease-resistant genes Pik of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the Pik disease-resistant allele family (figures 3,4,5 and 13). Wherein the content of the first and second substances,

in the normal example 2: as mentioned above, the carrier of the target gene Pik should belong to the K1/K2 functional haplotype (class I markers; FIG. 3), the KM1/KM2 functional sub-haplotype (class II markers; FIG. 4) and 2 function-specific molecular markers (Pik) of the Pik gene family^T1-2793C,Pik^T1-5932G) Varieties that were all positive (CK1, CK 2; marking in grade III; fig. 5). It was concluded that 4 varieties (CV54, CV56, CV57, CV58) carried the target gene Pik (fig. 13);

counter example 2 haplotype of variety CV32 was K1/K2, but sub-haplotype was KH1/KM2, and only Pik among 2 Pik function-specific molecular markers^T1-2793CWas positive (FIG. 13). If only haplotype-specific and Pik function-specific molecular markers are used for Pik^T1-2793CFor this determination, CV32 should be determined as a carrier of the target gene Pik. However, if the systematic and rigorous Pik allele family discrimination system constructed by the present invention is used for judgment, the variety is not the carrier of the target gene Pik, but the newly discovered Pik allele Pik-GDD because of its submenusThe primitive type is not KM1/KM2, and only Pik is selected from 2 Pik function-specific molecular markers^T1-2793CWas positive (FIG. 13).

The invention provides a positive and negative example of the true and false disease-resistant gene Pik-s of KM1/KM2 subunit type which is characterized in that the technical system which is compatible and can accurately identify and excavate the rice blast Pik disease-resistant allele family is used for screening the K1/K2 functional haplotype of the Pik disease-resistant allele family (figures 3,4,8 and 13). Wherein the content of the first and second substances,

in the normal example 3: as mentioned above, the carriers of the target gene Pik-s should belong to the K1/K2 functional haplotype (class I markers; FIG. 3), the KM1/KM2 functional sub-haplotype (class II markers; FIG. 4) and 2 function-specific molecular markers (KM2/KH 2) of the Pik gene family^G2-1559C,Piks^C1-957T) Varieties that were all positive (CK5, CK 6; marking in grade III; fig. 8). It was concluded that 6 varieties (CV36, CV37, CV46, CV48, CV49, CV50) carry the target gene Pik-s (FIG. 13);

counter example 3-1. although the haplotype of variety CV10 was K1/K2 and the sub-haplotype was KM1/KM2, only KM2/KH2 was found among 2 Pik-s functional specific molecular markers^G2-1559CIt was positive. It was concluded that this variety is not a carrier of the target gene Pik-s, but a newly mined Pik allele Pik-CKN.

Counter example 3-2. although the haplotype of variety CV51 was K1/K2, the sub-haplotype was KH1/KM2, and only KM2/KH2 out of 2 Pik-s function-specific molecular markers^G2-1559CIt was positive. It was concluded that this variety is not a carrier of the target gene Pik-s, but a newly discovered Pik allele Pik-SRC.

The above examples demonstrate from different perspectives that the technical system of the present invention has strong compatibility of mining new genes and comparability of removing false positives.

The technical system which has the advantages of compatibility and can accurately identify and mine the rice blast Pik disease-resistant allele family has important application value: by utilizing the technical system, the precise identification of the Pik disease-resistant allele family can be realized on a large number of gramineous plants including but not limited to germplasm resources (sorghum, brachypodium distachyon and the like contain Pik homologous genes; Zhai et al 2011, New Phytolist 189: 321-. Therefore, the method plays an irreplaceable role in the application aspects of improving the purpose and the efficiency of the utilization of plant germplasm resources, improving the purpose and the efficiency of disease-resistant breeding work, improving the reasonable layout of disease-resistant varieties, prolonging the service life of the disease-resistant varieties and the like.

Compared with the prior art, the invention has the following outstanding innovations and beneficial effects:

(1) the technical system of the invention is composed of three-level detection markers such as haplotype-subunit-allele, and the like, and constructs a precise identification system for 7 known Pik alleles (Pik, Pik-m, Pik-s, Pi1, Pik-p, Pi7 and Pik-h). Therefore, the complete coverage of the compatibility of the Pik allele family is realized, and the mining and identification of unknown target genes of more sequenced varieties are realized under the conditions of genome sequence, no resistance identification information and no genetic transformation. In the individual cases described in the examples of the present invention, 2 novel functional Pik alleles were deduced and identified from 11 sequenced varieties (Pik-IR8, Pik-IR 64). Therefore, the technology system of the present invention has direct compatibility and expansibility under the condition of having genome sequence information.

(2) Different from the general molecular marker patent technology, the technical system of the invention is only aimed at the detection of the known target genes, consists of three-level detection markers such as 'haplotype-subunit-allele', and the like, and constructs a precise identification system for 7 known Pik alleles (Pik, Pik-m, Pik-s, Pi1, Pik-p, Pi7, Pik-h) and 2 novel Pik alleles (Pik-IR8, Pik-IR 64). Therefore, the open full coverage of the Pik allele family is realized, and the Pik allele of an unknown germplasm resource group is mined and utilized under the conditions of no genome sequence information, no resistance identification information and no genetic transformation. In the case described in the examples of the present invention, 21 varieties containing functional target genes were selected from only 60 randomly selected rice germplasm resources, and 2 of them were further developed novel Pik alleles (Pik-CKN, Pik-GDD). Therefore, the technical system of the invention has definite openness and inclusiveness under the condition of no genome sequence information.

(3) Different from the general molecular marker patent technology, the technical system of the invention only aims at the detection of one or a few SNPs of a specific gene, and consists of three-level detection markers of 'haplotype-subunit-allele'. The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. This enables accurate screening of "homonymous genes" or "homonymous foreign genes" due to the sequencing errors described above. Therefore, the technical system of the invention has strict identification capability.

(4) Unlike the general molecular marker patent technology, which only aims at the detection of the DNA polymorphism of a specific genome region of a target gene, the technical system of the invention consists of three detection markers, namely haplotype-subunit-allele and the like. The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. This enables the screening of true and false genes (known genes or novel genes) resulting from the "false positive labeling" described above. Thus, the technical system of the present invention has the capability of system authentication.

(5) Because the complex disease-resistant allele family is the result of the ubiquitous host plant and pathogen coevolution in various plant disease systems for a long time, the idea and the technical means of the invention which are composed of three-level detection markers of 'haplotype-sub-haplotype-allele' and the like are also suitable for the excavation and identification of disease-resistant genes of other plant disease systems, have obvious openness and universality, and are even in the metagenome era of massive information. In other words, even if the genome has huge amount of genome information, any ordinary molecular marker patent technology has no capability of identifying and mining complex disease-resistant allele families in an inclusive and precise manner without the idea and technical means of the technical system of the present invention.

Drawings

FIG. 1 is a set of comprehensive and precise identification and mining roadmaps for the development and application of the rice blast Pik disease-resistant allele family technology system.

FIG. 2 sequence comparison of Pik disease resistance allele families and identification of their specific sequences. Wherein the content of the first and second substances,

FIG. 2 a-Gene accession numbers for cloned Pik, Pik-m, Pik-s, Pi1, Pik-p, Pi7, Pik-h at NCBI are: HM048900.1, AB462256.1, HQ662329.1, HQ606329.1, HM035360.1, HQ660231.1, HQ 662330.1; and Pik-IR8 and Pik-IR64 are new alleles which are not cloned and verified; Pik-NPB, Pik-SJ18 are non-functional alleles;

all validated haplotype, sub-haplotype and allele specific genomic regions or SNPs have been numbered and labeled in green (detailed FIGS. 2-12).

In particular, since 11 reference sequences have been published, this figure shows only the first one thereof in order to fully understand the specific sequences of the Pik disease resistance allele family and their marker information in conjunction with fig. 3-12.

FIG. 3 development and identification of functional/non-functional haplotype-specific molecular markers for the Pik allele family

FIG. 3a haplotype-specific optimal genomic regions of the #1 gene;

FIG. 3b haplotype-specific optimal genomic regions of the #2 gene;

FIG. 3c panel is functional haplotype specific markers: Pik-K1^{P/A(1-6230～6419)}/Pik-K2^{P/A(2-930～1110)}(ii) a The other group is non-functional haplotype specific markers: Pik-N1^{P/A(1-6230～6419)}/Pik-N2^{P/A(2-930～1110)}(ii) a Examples of the identification of 18 reference varieties (presence, band, containing corresponding genotype; absence, band-free, not containing corresponding genotype) were performed separately, wherein,

K1/K2 functional haplotype variety (containing both K1 and K2 genotypes): CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep; CK9, IR 8; CK10, K60; CK11, IRBLkp-K60; CK12, IRBL 7-M; CK13, IRBLkh-K3; CK14, IR 64;

non-functional haplotype varieties (lacking one or not containing the K1 or K2 genotype at all): CK15, Nipponbare (N1/N2); CK16, Achi Asahi (N1/N2); CK17, Maowangu (N1/K2); CK18,93-11 (N2); m, DL-500;

in particular, since functional/non-functional haplotype specific markers for the Pik alleles are markers that are 'presence/absence' of each other, typically only one pair of functional haplotype specific markers will be detected; furthermore, all haplotype varieties (N1N2, K1N2, N1K2, K1, K2, N1, N2, etc.) other than the functional haplotype variety (K1K2) can be judged as non-functional haplotype varieties and can be excluded from the subsequent tests.

FIG. 4 development and characterization of the sub-haplotype specific molecular markers for the K1/K2 functional haplotype of the Pik disease resistance allele family

FIG. 4a subunit-specific optima SNP of the #1 gene;

FIG. 4b shows the optimal SNP for the subunit specificity of the #2 gene;

FIG. 4c a set of subunit type-specific markers (KM1/KH 1)^G1-357A/KM2/KH2^G2-1559C) Identification of 14 functional haplotype reference varieties (top band, KM; lower band, KH), wherein,

KM1/KM2 subunit type variety: CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep;

KM1/KH2 mixed subunit type variety: CK9, IR 8;

KM, Pik-m type; KH, Pik-h type; m, DL-500.

FIG. 5 development and characterization of broad-spectrum durable resistance gene Pik-specific molecular markers for KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family

FIG. 5a 2 optimal SNPs for Pik functional specificity;

FIG. 5b 2 Pik function-specific markers Pik^T1-2793C(upper band, non-target gene; lower band, target gene) and Pik^T1-5932G(upper band, target gene; lower band, non-target gene) 14 examples of functional haplotype reference varieties were identified, wherein,

the target gene carries the variety: CK1, Kusabue (Pik) and CK2, IRBLk-Ka (Pik);

non-target gene carrying varieties: CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR 64); m, DL-500.

FIG. 6. three levels of labeling:

FIG. 6a haplotype identification (first order marker)

FIG. 6b subunit type identification (secondary marker)

FIG. 6c identification of the target gene (tertiary marker).

FIG. 7 development and characterization of broad-spectrum durable resistance gene Pik-m specific molecular markers for KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family

FIG. 7a optimal SNP for Pik-m functional specificity

FIG. 7b Pik-m function-specific marker Pikm^C1-851G/A(upper and lower bands, non-target genes; middle band, target gene) for 14 examples of functional reference varieties, wherein,

FIG. 8 development and characterization of disease resistance gene Pik-s specific molecular markers for the KM1/KM2 sub-haplotype of the K1/K2 functional haplotype of the Pik disease resistance allele family

FIG. 8a functional specific SNP of Pik-s in the #1 gene;

FIG. 8b functional specific SNP (shared with sub-haplotype specific SNP) of Pik-s in the #2 gene;

FIG. 8c 2 Pik-s function-specific markers Pik^T1-5932G(upper band, non-target gene; lower band, target gene), and KM2/KH2^G2-1559C(upper band, target gene; lower band, non-target gene) 14 examples of functional reference varieties were identified, wherein,

FIG. 9 development and characterization of broad-spectrum persistent resistance gene Pi1 specific molecular marker for K1/K2 functional haplotype of the Pik disease-resistant allele family, KM1/KM2 sub-haplotype

FIG. 9a functional specific SNP of Pi1 in the #1 gene;

FIG. 9b functional specific SNP of Pi1 in the #2 gene;

FIG. 9c 2 Pi1 function-specific markers [ Pi1 ]^T1-853G: upper and lower bands, non-target genes; middle band, target gene; pi1^T2-2519A: upper band, non-target gene; lower band, target genes ] identification examples of 14 functional reference varieties, wherein,

the target gene carries the variety: CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1);

FIG. 10 development and characterization of molecular markers specific for the novel resistance gene Pik-IR8 of KM1/KH2 mixed haplotype of the K1/K2 functional haplotype of the Pik disease resistance allele family

FIG. 10a 2 optimal SNPs that are Pik-IR8 function specific;

FIG. 10b 2 Pik-IR8 function specific markers [ Pik-IR8 ]^A1-149G: upper band, non-target gene; lower band, target gene; Pik-IR8^A1-927G: upper band, non-target gene; lower band, target genes ] identification examples of 14 functional reference varieties, wherein,

the target gene carries the variety: CK9, IR8(Pik-IR 8);

FIG. 11 development and characterization of broad-spectrum persistent resistance gene Pik-p/Pi7/Pik-h specific molecular markers for KH1/KH2 haplotype of the K1/K2 functional haplotype of the Pik disease-resistant allele family

FIG. 11a functional specific shared SNP of Pik-p/Pi7/Pik-h at the #2 gene;

FIG. 11b functional specific shared SNP of Pik-p/Pi7/Pik-h in the #1 gene;

in particular, PCR-based SNP validation showed that the original sequence was incorrect and that Pik-p/Pi7/Pik-IR64 were all T (marker Pikp/7)^T1-961A/C/G) (ii) a Pik-h is A (mark Pikh)^A1-961T/C/G) (see example 9, FIG. 11 for details);

FIG. 11c A set of 3 Pik-p/Pi7/Pik-h function specific markers [ Pikp/7/kh^A2-2137G: upper band, target gene; lower band, non-target gene; pikp/7^T1-961A/C/G: upper band, non-target gene; lower band, target gene; pikh^A1-961T/C/G: upper band, non-target gene; below, target genes ] are examples of the identification of 14 functional reference varieties, wherein,

the target gene Pik-p is the same as Pi7, and the carrying varieties are as follows: CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7);

the target gene Pik-h carries a variety: CK13, IRBLkh-K3 (Pik-h);

FIG. 12 development and characterization of molecular markers specific for the novel resistance gene Pik-IR64 of the KH1/KH2 haplotype of the K1/K2 functional haplotype of the Pik disease-resistant allele family

FIG. 12a 2 optimal SNPs that are Pik-IR64 function specific;

FIG. 12b 2 Pik-IR64 function specific markers [ Pik-IR64 ]^T1-3013C: upper band, target gene; lower band, non-target gene; Pik-IR64^T1-5468C: upper band, non-target gene; lower band, target genes ] identification examples of 14 functional reference varieties, wherein,

the target gene carries the variety: CK14, IR64(Pik-IR 64);

FIG. 13 is an example of mining and identifying Pik alleles from an unknown population of rice seed resources using a set of the present invention's inclusive and precise identification and mining of families of rice blast Pik disease resistance alleles

FIG. 13a identification of functional/non-functional haplotypes for the Pik allele family;

FIG. 13b identification of a sub-haplotype of the functional haplotypes of the Pik allele family;

FIG. 13c-i identification of 8 Pik alleles (of which Pik-p ═ Pi7) of a functional haplotype of the Pik allele family.

Detailed Description

The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

All rice varieties used in the examples: CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep; CK9, IR 8; CK10, K60; CK11, IRBLkp-K60; CK12, IRBL 7-M; CK13, IRBLkh-K3; CK14, IR 64; CK15, nipponbare (npb); CK16, Achi Asahi; CK17, Maowangu; CK18, 93-11; and CV1-60 were collected, stored, and used routinely in the research field for the applicant's laboratory and have been disclosed in, including but not limited to, the above references [ Wang et al 2009, Phytopathology 99: 900-); zhai et al 2011, New Phytologist 189:321-334, https:// nph.onlineibrary. wireless. com; hua et al.2012, the or Appl Genet 125: 1047-; chai et al 2021, Rice, https:// thericejournal. springopen. com (published); annex charts are available at the respective magazine web sites ].

The technical route diagram developed and applied by the patent is shown in figure 1.

Example 1 sequence comparison of the blast disease Pik disease-resistant allele family and identification of its specific sequence (FIGS. 2-12)

First, experiment method

The genome sequences of 7 cloned rice blast Pik disease-resistant allele families are retrieved and downloaded from the public databases of the national center for biotechnology information and the like,

NCBI accession number for Pik: HM 048900.1;

the NCBI accession number for Pik-m is: AB462256.1

The NCBI accession number for Pik-s is: HQ662329.1

The NCBI accession number of Pi1 is: HQ606329.1

The NCBI accession number for Pik-p is: HM035360.1

The NCBI accession number of Pi7 is: HQ660231.1

The NCBI accession number for Pik-h is: HQ 662330.1.

In order to facilitate the sequence alignment analysis, 2 genome sequences corresponding to sequencing reference susceptible varieties Nipponbare (NPB) and Suijing 18 (SJ 18) are added. In order to verify the inclusion and openness of the technical system, 2 genome sequences corresponding to sequencing reference anti-disease varieties IR8 and IR64 are added.

The ranges of the individual fragments ATG-TAG (#1 gene), and ATG-TGA (#2 gene) are annotated with reference to NCBI.

Sequence comparison analysis was performed by conventional bioinformatics methods.

Second, experimental results

The results of the sequence comparisons are shown in FIGS. 2-12 and indicate that:

(1) the sequence of both genes #1 and #2 of the Pik disease-resistant allele family exhibited significant genomic differentiation (typical locations are shown in FIG. 3 as markers #1 and # 2) of functional haplotypes (Pik, Pik-m, Pik-s, Pi1, Pik-IR8, Pik-p, Pi7, Pik-h, Pik-IR64) and non-functional haplotypes (Pik-NPB, Pik-SJ 18);

(2) sequences of the Pik disease-resistant allele family in the functional haplotype further showed the differentiation of the distinct KM1/KM2 sub-haplotype (Pik, Pik-m, Pik-s, Pi1, Pik-IR8) and KH1/KH2 sub-haplotype (Pik-p, Pi7, Pik-h, Pik-IR64, Pik-IR8) (typical positions are shown in FIG. 3 as #3 and # 4; wherein Pik-IR8 belongs to KM/KH mixed sub-haplotype);

(3) the above 9 members of the Pik disease-resistant allele family all have function-specific SNPs and combinations thereof (typical positions are shown as markers #5 to #17 in the marker maps 5-12).

Example 2: development and characterization of functional/non-functional haplotype-specific molecular markers for the Pik disease-resistant allele family (FIG. 3)

First, experiment method

The experimental procedures of this example are mainly referred to papers published by the Applicant (Yuan et al 2011, the or Appl Genet 122: 1017-.

The following references are the same as those described above and need not be repeated. Briefly described, the following steps:

(1) design of haplotype-specific molecular markers: according to the comparison result of the Pik allele family sequences, aiming at the genome region with clear functional/non-functional haplotypes, a Primer design software Primer 5.0 is utilized to design a P/A (presence/absence) mark. The primer sequences are as follows:

for #1K marker:

SEQ ID NO.1(Pik-K1^{P/A(1-6230～6419)}-F；5’-3’)：

CGGGCAGCAGTGGGATCGATACTGAG；

SEQ ID NO.2(Pik-K1^{P/A(1-6230～6419)}-R；5’-3’)：

TTTCTGTTTGAATTTCAATATCTGCTACTC。

for #1N marker:

SEQ ID NO.3(Pik-N1^{P/A(1-6230～6419)}-F；5’-3’)：

TCGTTGTCCACGCTGCTCCTGACGA；

SEQ ID NO.4(Pik-N1^{P/A(1-6230～6419)}-R；5’-3’)：

AGTACAGGTAAAATTAGAATACAATAGCA。

for #2K labeling:

SEQ ID NO.5(Pik-K2^{P/A(2-930～1110)}-F；5’-3’)：

ATGTCAGCCAGAAAATGATGGAAACC；

SEQ ID NO.6(Pik-K2^{P/A(2-930～1110)}-R；5’-3’)：

TAGATTTAGAGTGGGATGAGTAAGTTAAT。

for #2N labeling:

SEQ ID NO.7(Pik-N2^{P/A(2-930～1110)}-F；5’-3’)：

ACCACTGTCACTACTCGGAGGGAA；

SEQ ID NO.8(Pik-N2^{P/A(2-930～1110)}-R；5’-3’)：

ATGGATTTACAATTAAGTTAATTGGCAT。

description of the labeling: k1 and K2, representing #1 and #2 functional haplotypes, respectively; correspondingly, N1 and N2, represent #1 and #2 non-functional haplotypes, respectively; P/A, presence (presence; target genotype)/absence (absence; non-target genotype); 1-6230-6419, meaning the # 6230-6419 genome segment of the #1 gene, and so on (the same below);

(2) detection of haplotype-specific molecular markers: the 4 groups of primers are used for carrying out PCR amplification on 18 rice control varieties. The PCR amplification system (20.0. mu.L) was as follows:

[ the following PCR amplification System is the same as that described above, and is not repeated therein ]

The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then carrying out 35 cycles of PCR amplification [ denaturation at 94 ℃ for 30sec, annealing for 30sec (K1/60 ℃, N1/62-64 ℃, K2/63 ℃, N2/61-63 ℃) and extension at 72 ℃ for 30sec) ], finally extending at 72 ℃ for 5min, and storing the PCR product in a refrigerator at 4 ℃ for later use.

[ except for annealing temperature, the following PCR amplification conditions are the same as those described above, and cannot be said for

Take 0.25. mu.L of PCR product, add 0.25. mu.L of ddH₂And mixing O and 5 mu L of 10x loading, performing electrophoresis (250V for 20-120 min) on 8-12% modified polyacrylamide gel by using a microsyringe to obtain 1.5-2 mu L of product, and then performing photographing and recording of molecular markers according to a conventional detection method.

[ the following molecular marker detection procedures are the same as those described above, and their descriptions are omitted ]

Second, experimental results

The sizes of the respective molecular markers are shown in FIG. 3, and the results show that 18 tested varieties exhibit clear and diverse genotypes (haplotypes):

K1/K2 functional haplotype varieties (varieties judged as both K1 and K2 genotypes): CK1, Kusabue; CK2, IRBLk-Ka; CK3, Tsuyuake; CK4, IRBLkm-Ts; CK5, Shin 2; CK6, IRBLks-F5; CK7, C101 LAC; CK8, Tetep; CK9, IR 8; CK10, K60; CK11, IRBLkp-K60; CK12, IRBL 7-M; CK13, IRBLkh-K3; CK14, IR 64;

non-functional haplotype varieties (varieties that contain only one K-type genotype, or none at all): CK15, Nipponbare (N1/N2); CK16, Achi Asahi (N1/N2); CK17, Maowangu (N1/K2); CK18,93-11 (N2).

In the subsequent detection and identification, the non-functional haplotype CK15-18 is eliminated.

Example 3 development and characterization of sub-haplotype specific molecular markers for the K1/K2 functional haplotype of the Pik disease resistance allele family (FIG. 4)

First, experiment method

(1) Design of subunit-specific molecular markers: according to the comparison result of the Pik allele family sequence, aiming at the SNP with clear KM/KH subunit type of functional haplotype, the primer design of dCAPS marker is firstly carried out by utilizing an online software dCAPSFinder 2.0(http:// helix. where is. justil. edu/dCAPS. html. where is. html.) according to the design principle of dCAPS (derived dclearamplimpidumdpolynucleotide sequences; Neff et al 2002, Trends in Genetics 18: 613. sup. 615); the design of the label was then confirmed using Primer design software Primer 5.0.

The following molecular markers and primer design procedures are the same as those described above and are not repeated herein.

The primer sequences are as follows:

for the #3 marker (upper band, KM 1; lower band, KH 1):

SEQ ID NO.9(KM1/KH1^G1-357A-F；5’-3’)：

GTCCTACGACCTGGATGATG；

SEQ ID NO.10(KM1/KH1^G1-357A-R；5’-3’)：

CAGAGAAGCGATTGGAGGCA。

for #4 marking (upper band, KM 2; lower band, KH 2):

SEQ ID NO.11(KM2/KH2^G2-1559C-F；5’-3’)：

AAGATAGCAACAAAGTAGACGAGC；

SEQ ID NO.12(KM2/KH2^G2-1559C-R；5’-3’)：

CACCATCGAGGGTAAGAGGAG。

(2) detection of subunit-specific molecular markers: using the above 2 sets of primers, the PCR amplification system (annealing temperature: KM1/KH 1) was performed as described above^G1-357A/60℃，KM2/KH2^G2-1559C62 ℃), performing PCR amplification on 14 functional haplotype rice test varieties and storing products in a refrigerator at 4 ℃ for later use.

The PCR products were removed and used with restriction enzyme SphI (KM1/KH 1)^G1-357A) And NcoI (KM2/KH 2)^G2-1559C) The enzyme digestion was carried out in the following reaction system (10.0. mu.L):

and (3) after enzyme digestion is carried out for 5 hours at 37 ℃,10 mu L of 10x loading is added into each tube of enzyme digestion product and is mixed uniformly, and electrophoresis detection, photographing and recording are carried out on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedure.

[ PCR amplification products of restriction enzyme System (except Pik-IR8)^A1-927GThe enzyme cutting temperature is not 65 ℃ and the rest is 37 ℃ and is the same as the above description, which is not repeated herein

Second, experimental results

The size of each molecular marker is shown in FIG. 4, and the results show that 14 tested varieties present 3 clear genotypes (sub-haplotypes):

KM1/KH2 mixed subunit type variety: CK9, IR 8.

Example 4: development and characterization of broad-spectrum durable resistance Gene Pik-specific molecular markers for KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family (FIG. 5)

First, experiment method

(1) Design of Pik-specific molecular markers: based on the alignment results of the Pik allele family sequences, 4 target gene Pik-specific SNPs were found (A1-1380T, G1-2588T, T1-2793C, T1-5932G); among them, A1-1380T and G1-2588T were excluded by the SNPs that were verified to be generated due to sequencing errors. 2 real SNPs are designed as Pik function specific molecular marker Pik^T1-2793CAnd Pik^T1-5932GThe primer sequences are as follows:

for the #5 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.13(Pik^T1-2793C-F；5’-3’)：CCTTCCAGTACCTCTCTCGAAGC；

SEQ ID NO.14(Pik^T1-2793C-R；5’-3’)：AATGGCAGGCATAGCTTGTCC。

for the #6 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.15(Pik^T1-5932G-F；5’-3’)：CAAAAGTTCCTCGCCGAGATGC；

SEQ ID NO.16(Pik^T1-5932G-R；5’-3’)：TCTTCATGGAAGGCTATCCTTGGTA。

(2) detection of Pik-specific molecular markers: using the above 2 sets of primers, the PCR amplification system and the amplification conditions (annealing temperature: Pik) were determined as described above^T1-2793C/50～59℃，Pik^T1-5932G56 ℃), performing PCR amplification on 14 functional haplotype rice test varieties and storing products in a refrigerator at 4 ℃ for later use.

Taking out the PCR product, and using restriction enzyme Alu I (Pik) according to the enzyme digestion system^T1-2793C) And KpnI (Pik)^T1-5932G) Carrying out enzyme digestion; and performing electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedures.

Second, experimental results

The size of each molecular marker is shown in fig. 5, and the results show that 2 Pik-specific molecular markers can distinguish the target gene from all known alleles of the gene family:

non-target gene carrying varieties: CK3, Tsuyuake (Pik-m); CK4, IRBLkm-Ts (Pik-m); CK5, Shin 2 (Pik-s); CK6, IRBLks-F5 (Pik-s); CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1); CK9, IR8(Pik-IR 8); CK10, K60 (Pik-p); CK11, IRBLkp-K60 (Pik-p); CK12, IRBL7-M (Pi 7); CK13, IRBLkh-K3 (Pik-h); CK14, IR64(Pik-IR64)

In summary, the three-level labeling is shown in FIG. 6.

Example 5: development and identification of specific molecular markers for broad-spectrum persistent resistance gene Pik-m of KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family (FIG. 7)

First, experiment method

(1) Design of Pik-m specific molecular markers: based on the alignment of the Pik allele family sequences, only 1 target gene Pik-m specific SNP (C1-851G/A) was found, and Pik-m specific molecular marker Pikm was designed according to the above-mentioned program^T1-2793C. The primer sequences are as follows:

for the #7 marker (upper and lower bands, non-target gene; middle band, target gene):

SEQ ID NO.17(Pikm^C1-851G/A-F；5’-3’)：

GCGCTCGTAGGTGATCTAAGAGAT；

SEQ ID NO.18(Pikm^C1-851G/A-R；5’-3’)：

GATTTCACCGGCGCAAGCAT。

(2) detection of Pik-m specific molecular markers: the 1 group of primers are utilized to perform PCR amplification on 14 functional haplotype rice test varieties according to the PCR amplification system and the amplification conditions (the annealing temperature is 59 ℃), and the products are stored in a refrigerator at 4 ℃ for later use.

Taking out the PCR product, and performing enzyme digestion by using restriction enzyme MboI according to the enzyme digestion system; and performing electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedures.

Second, experimental results

The size of each molecular marker is shown in fig. 7, and the results show that the specific molecular marker can distinguish the target gene from all known alleles of the gene family:

Example 6: development and characterization of Pik-s specific molecular markers for the resistance gene Pik-s of the K1/K2 functional haplotype KM1/KM2 sub-haplotype of the Pik disease resistance allele family (FIG. 8)

First, experiment method

(1) Design of Pik-s specific molecular markers: according to the alignment results of the above Pik allele family sequences, no SNP specific to the target gene Pik-s was found, but an optimal combination [ C1-957T + G2-1559C (#4KM2/KH2)]But can distinguish the target gene Pik-s from all alleles of the gene family; design of Pik-s specific molecular marker Piks according to the above procedure^C1-957TAnd KM2/KH2^G2-1559C。

Particularly, 2 forward primers are designed to be matched with 1 reverse primer for PCR detection because the #8 marked target region genome is obviously differentiated. The primer sequences are as follows:

for the #8 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.19(Piks^C1-957T-F1；5’-3’)：

TGCGATGTTTCTGGAGGTCAGGCATG

SEQ ID NO.20(Piks^C1-957T-F2；5’-3’)：

TGCGGAGTTGCTGCAGGTCAGGCATG

SEQ ID NO.21(Piks^C1-957T-R；5’-3’)：

GTCGATGAGATGTTGTTGAAGAGCT；

for the #4 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.11(KM2/KH2^G2-1559C-F；5’-3’)：

AAGATAGCAACAAAGTAGACGAGC；

SEQ ID NO.12(KM2/KH2^G2-1559C-R；5’-3’)：

CACCATCGAGGGTAAGAGGAG；

(2) detection of Pik-s specific molecular markers: using the above 2 sets of primers, the PCR amplification system and the amplification conditions (annealing temperature: Piks) were followed^C1-957T/52℃，KM2/KH2^G2-1559C62 ℃), performing PCR amplification on 14 functional haplotype rice test varieties and storing products in a refrigerator at 4 ℃ for later use.

Taking out the PCR products, and respectively utilizing restriction enzymes SphI (Piks) according to the enzyme digestion system^C1-957T) And NcoI (KM2/KH 2)^G2-1559C) Carrying out enzyme digestion, and carrying out electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedures

Second, experimental results

The size of each molecular marker is shown in fig. 8, and the result shows that the specific molecular marker combination can distinguish the target gene from all known alleles of the gene family:

Example 7: development and characterization of broad-spectrum persistent resistance Gene Pi 1-specific molecular markers for KM1/KM2 sub-haplotype of K1/K2 functional haplotype of Pik disease-resistant allele family (FIG. 9)

First, experiment method

(1) Design of Pi 1-specific molecular markers: according to the comparison result of the Pik allele family sequences, 4 target genes P are foundi1 specific SNPs (T1-853G, C1-3273G, T1-3783G, T2-2519A); wherein C1-3273G, T1-3783G were excluded by the SNP generated due to sequencing errors. 2 real SNPs were designed as Pi 1-specific molecular marker Pi1^T1-853GAnd Pi1^T2-2519A。

Particularly, 2 forward primers and 1 reverse primer are designed to be matched for PCR detection because the #9 marked target region genome is obviously differentiated. The primer sequences are as follows:

the primer sequences are as follows:

for the #9 marker (upper and lower bands, non-target gene; middle band, target gene):

SEQ ID NO.22(Pi1^T1-853G-F1；5’-3’)：

GTTGCAATCGCCGGTGACCTAAGAGACCA；

SEQ ID NO.23(Pi1^T1-853G-F2；5’-3’)：

GTTGCGCTCGTAGGTGATCTAAGAGACCA；

SEQ ID NO.24(Pi1^T1-853G-R；5’-3’)：

TCACATATGGATTTCACCGGCGCAAGC。

for the #10 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.25(Pi1^T2-2519A-F；5’-3’)：

CAAAGAAAGGATTCTTATCCCAAT；

SEQ ID NO.26(Pi1^T2-2519A-R；5’-3’)：

CCACCCTTTGTTATATTGAGCTT。

(2) detection of Pi 1-specific molecular markers: using the above 2 sets of primers, the PCR amplification system and amplification conditions (annealing temperature: Pi1) were adjusted as described above^T1-853G/65℃，Pi1^T2-2519A58 ℃), performing PCR amplification on 14 functional haplotype rice test varieties and storing products in a refrigerator at 4 ℃ for later use.

The PCR products were taken out and the restriction enzymes NlaIII (Pi1) were used according to the above digestion system^T1-853G) And MseI (Pi1)^T2-2519A) Performing enzyme digestion, and performing polyacrylamide-based digestion on the enzyme digestion sample according to the experimental procedureAnd (4) electrophoresis detection, photographing and recording of the gel.

Second, experimental results

The size of each molecular marker is shown in fig. 9, and the results show that 2 Pi 1-specific molecular markers can distinguish the target gene from all known alleles of the gene family:

the target gene carries the variety: CK7, C101LAC (Pi 1); CK8, Tetep (Pi 1);

Example 8: development and characterization of molecular markers specific to the novel resistance gene Pik-IR8 of KM1/KH2 mixed subunit type of K1/K2 functional haplotype of Pik disease resistance allele family (FIG. 10)

First, experiment method

(1) Design of Pik-IR8 specific molecular markers: based on the alignment of the Pik allele family sequences, 2 SNPs specific to the target gene Pik-IR8 were found (A1-149G, A1-927G); it was designed as a Pik-IR 8-specific molecular marker Pik-IR8 following the procedure described above^TA1-149GAnd Pik-IR8^A1-927G。

In particular, since Pik-IR8^A1-927GThe marker is in a complex genome differentiation region, and in order to ensure the detection of the marker, the #3 key base of the forward primer is designed into a degenerate base and is marked as dF; wherein y is c/t.

The primer sequences are as follows:

for the #11 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.27(Pik-IR8^A1-149G-F1；5’-3’)：

CAGAGTTCATCAGATCCGAGCTT；

SEQ ID NO.28(Pik-IR8^A1-149G-R；5’-3’)：

TCAGAGAAGCGATTGGAGACA。

for the #12 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.29(Pik-IR8^A1-927G-dF；5’-3’)：

TCYGCGCTCCGGAAGAAGGTCG；

SEQ ID NO.30(Pik-IR8^A1-927G-R；5’-3’)：

CCTGGCAATCCAAGGATGCAAA。

(2) detection of Pik-IR 8-specific molecular markers: using the above 2 sets of primers, the PCR amplification system and amplification conditions (annealing temperature: Pik-IR8) were adjusted as described above^A1-149G/60℃，Pik-IR8^A1-927GAt 63 ℃), performing PCR amplification on 14 functional haplotype rice test varieties and storing products in a refrigerator at 4 ℃ for later use.

Taking out the PCR products, and respectively utilizing restriction enzyme AflII (Pik-IR8) according to the enzyme digestion system^A1 ^-149G) And TaqI (Pik-IR8)^A1-927GAnd the enzyme cutting temperature is 65 ℃), and the enzyme cutting sample is subjected to electrophoresis detection, photographing and recording based on polyacrylamide gel according to the experimental procedures.

Second, experimental results

The size of each molecular marker is shown in fig. 10, and the results show that 2 Pik-IR8 specific molecular markers can distinguish the target gene from all known alleles of the gene family:

the target gene carries the variety: CK9, IR8(Pik-IR 8; sequence shown in GenBank MZ 358904);

Example 9: development and characterization of broad-spectrum persistent resistance Gene Pik-p/Pi7/Pik-h specific molecular markers for KH1/KH2 haplotypes that are functional haplotypes of K1/K2 of the Pik disease-resistant allele family (FIG. 11)

First, experiment method

(1) Design of Pik-p/Pi7/Pik-h specific molecular marker: based on the alignment results of the above Pik allele family sequences, 1 SNP (T1-1229C) specific to the target gene Pik-p was found and was confirmed to be excluded due to sequencing errors; no specific SNPs were found for Pi7 and Pik-h, but an optimal combination [ A2-2137G + T1-961A/C/G + A1-961T/C/G ]]But can distinguish 3 target genes from all alleles of the gene family; it was designed as a Pik-p/Pi7/Pik-h specific molecular marker combination following the procedure described above: pikp/7/kh^A2-2137G，Pikp/7^T1-961A/C/GAnd Pikh^A1 ^-961T/C/G。

In particular, due to Pikp/7^T1-961A/C/GAnd Pikh^A1-961T/C/GAnd reference mark Pikh^G1-961T/C/AThe marker is in a complex genome differentiation region, and in order to ensure the detection of the marker, the #5,6,10,14 and 27 key bases of the forward primer are designed into degenerate bases and are marked as dF; wherein, r is a/g, w is a/t, k is g/t, s is c/g, and y is c/t.

The primer sequences are as follows:

for the #13 marker (upper band, target gene; lower band, non-target gene):

SEQ ID NO.31(Pikp/7/kh^A2-2137G-F1；5’-3’)：

GCAAGGGTTAACCCAGGAAAG；

SEQ ID NO.32(Pikp/7/kh^A2-2137G-R；5’-3’)：

TAGTTGAATGAATGGAATGGCC；

for the #14 marker (upper, middle band, non-target gene; lower band, target gene):

SEQ ID NO.33(Pikp/7^T1-961A/C/G-dF；5’-3’)：

TGCGRWGTTKCTGSAGGTCAGCCAAGYAAT；

SEQ ID NO.34(Pikp/7^T1-961A/C/G-R；5’-3’)：

GTCGATGAGATGTTGTTGAAGAGCT；

for the #15a marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.35(Pikh^A1-961T/C/G-dF；5’-3’)：

GTTKCTGSAGGTCAGCCAAGYTTA；

SEQ ID NO.36(Pikh^A1-961T/C/G-R；5’-3’)：

TTGAGCGAAAATGTCTGCAAGAGTCT。

for the #15b marker (reference marker; upper band, target gene; lower band, non-target gene):

SEQ ID NO.37(Pikh^G1-961T/C/A-dF；5’-3’)：

GTTKCTGSAGGTCAGCCAAGCTAA；

SEQ ID NO.38(Pikh^G1-961T/C/A-R；5’-3’)：

TTGAGCGAAAATGTCTGCAAGAGTCT。

(2) detection of Pik-p/Pi7/Pik-h specific molecular markers: the 3 sets of primers were used, and the PCR amplification system and the amplification conditions (annealing temperature: Pikp/7/kh) were adjusted as described above^A2-2137G/58℃,Pikp/7^T1-961A/G/C/60℃,Pikh^A1 ^-961T/G/C/58℃,Pikh ^G1-961T/A/C60 ℃), performing PCR amplification on 14 functional haplotype rice test varieties, and storing products in a refrigerator at 4 ℃ for later use.

The PCR products were taken out and restriction enzymes NcoI (Pikp/7/kh) were used according to the above digestion system^A2 ^-2137G),MseI(Pikp/7^T1-961A/G/C),MseI(Pikh^A1-961T/G/C),DdeI(Pikh^G1-961T/A/C) And carrying out enzyme digestion, and carrying out electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedure.

Second, experimental results

The sizes of the individual molecular markers are shown in FIG. 11, and the results show that the above-mentioned set of 3 Pik-p/Pi7/Pik-h specific molecular markers can distinguish the target gene from all alleles of the gene family:

the target gene Pik-h carries a variety: CK13, IRBLkh-K3 (Pik-h);

In particular, the molecular markers identified there were 2 sequencing errors:

(a) pik-p has the same sequence as Pi7, with no SNPs: pi7 has a #961C real number of #961T,

(b) pik-h #961G is actually #961A (see reference #15b in FIG. 11 for details).

Example 10: development and identification of molecular markers specific for the novel resistance gene Pik-IR64 of KH1/KH2 haplotype, a functional haplotype of K1/K2 of the Pik disease-resistant allele family (FIG. 12)

First, experiment method

(1) Design of Pik-IR64 specific molecular markers: based on the alignment results of the Pik disease resistance allele family sequences, 17 SNPs specific to the target gene Pik-IR64 were found (T1-3013C, G1-4705A, T1-5468C, etc.); 3 of them (T1-3013C, G1-4705A, T1-5468C) were designed as Pik-IR64 specific molecular markers, and 2 of them were selected as the most optimal Pik-IR64 specific molecular marker combination: Pik-IR64^T1-3013CAnd Pik-IR64^T1-5468C. The primer sequences are as follows:

for the #16 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.39(Pik-IR64^T1-3013C-F；5’-3’)：

CAAGCTATGCCTGCCATTGG；

SEQ ID NO.40(Pik-IR64^T1-3013C-R；5’-3’)：

CAAGAAATATATCTCCTTGCAGTCG。

for the #17 marker (upper band, non-target gene; lower band, target gene):

SEQ ID NO.41(Pik-IR64^T1-5468C-F；5’-3’)：

TGGGGAGCTGAATCATCTAAAGC；

SEQ ID NO.42(Pik-IR64^T1-5468C-R；5’-3’)：

ACAAGGGGAGGTCCGAAACG。

(2) detection of Pik-IR 64-specific molecular markers: using the above 2 sets of primers, the PCR amplification system and amplification conditions (annealing temperature: Pik-IR64) were adjusted as described above^T1-3013C/62℃，Pik-IR64^T1-5468C55 ℃), performing PCR amplification on 14 functional haplotype rice test varieties, and storing products in a refrigerator at 4 ℃ for later use.

The PCR product was taken out, and the restriction enzymes SalI (Pik-IR64) were used according to the above-mentioned restriction enzyme system^T1 ^-3013C) And HindIII (Pik-IR64)^T1-5468C) And carrying out enzyme digestion, and carrying out electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedure.

Second, experimental results

The size of each molecular marker is shown in fig. 12, and the results show that 2 Pik-IR64 specific molecular markers can distinguish the target gene from all known alleles of the gene family:

the target gene carries the variety: CK14, IR64(Pik-IR 64; sequence shown in GenBank MZ 358905);

Example 11: example of Pik allele mining and identification from an unknown Rice seed resource population Using a set of the present invention with an inclusive and accurate identification and mining of the family of disease-resistant alleles of the Rice blast Pik (FIG. 13)

As described above, the technical system for Pik disease resistance allele family identification of the present invention consists of 9 sets of specific molecular marker identification systems (FIGS. 3-12). Wherein, the detection of the functional/non-functional haplotype and the KM/KH sub-haplotype of the functional haplotype are carried out sequentially, and the detection of each target gene is not carried out sequentially. The detection procedures and schemes of the whole technical system are as described above, and are not repeated (the same below).

(1) The test control varieties consist of: 8 Pik allele carriers were used as control varieties (CK 1-8); CK1, kusabue (pik); CK2, Tsuyuake (Pik-m); CK3, Shin 2 (Pik-s); CK4, C101LAC (Pi 1); CK5, IR8(Pik-IR 8); CK6, K60 (Pik-p); CK7, IRBLkh-K3 (Pik-h); CK8, IR64(Pik-IR 64);

(2) the resource composition of the tested rice seeds is as follows: in order to improve the diversity of rice seed resources, indica rice and japonica rice varieties are composed of old varieties and modern varieties. Wherein CV1-15 is an old indica variety; CV16-30 is a modern indica rice variety; CV31-45 is an ancient japonica rice variety; CV46-60 is a modern japonica rice variety.

(3) Identification of functional/non-functional haplotypes for the Pik allele (FIG. 13a)

The 68 test varieties were identified using the set of functional haplotype-specific markers. The results show that 21 varieties are deduced to be K1/K2 functional haplotype varieties: CV1, CV2, CV4, CV10, CV14, CV18, CV19, CV27, CV32, CV36, CV37, CV45, CV46, CV48, CV49, CV50, CV51, CV54, CV56, CV57, CV 58;

in particular, since functional/non-functional haplotype-specific markers for the Pik allele are not so 'presence/absence' markers, it is generally only necessary to detect a pair of functional haplotype-specific markers; and the other varieties except the functional haplotype variety can be judged as non-functional haplotype varieties and excluded from the subsequent detection.

(4) Identification of the sub-haplotype of the K1/K2 functional haplotype of the Pik allele (FIG. 13b)

The 21K 1/K2 functional haplotype test varieties were identified using the set of subunit-specific markers. The results show that:

7 were KH1/KH2 subunit varieties: CV1, CV4, CV14, CV18, CV19, CV27, CV 45;

1 hybrid sub-haplotype variety KM1/KH 2: CV 2;

2 mixed sub-haplotype varieties KH1/KM 2: CV32, CV 51.

(5) Identification of 8 Pik disease resistance alleles (FIG. 13c-i)

The test varieties of 4 sub-haplotypes of the 21 functional haplotypes are identified by using the 7 groups of specific markers (Pik-p and Pik-h are combined into one group) of the Pik disease-resistant alleles. The results show that:

the target gene Pik carries the variety (fig. 13 c): CV54, CV56, CV57, CV 58;

the target gene Pik-m carries the variety (fig. 13 d): none;

the target gene Pi1 carries a variety (fig. 13 f): none;

the target gene Pik-IR8 carries the variety (fig. 13 g): CV 2;

the target gene Pik-p carries the variety (fig. 13 h): CV 27;

the target gene Pik-h carries the variety (fig. 13 h): none;

novel Pik allele bearing varieties (fig. 13 c-i): CV10, CV32, CV 51.

In particular, since the genotypes of the 3 novel alleles are different from those of the 8 alleles and from each other, they are named as Pik-CKN (Chikenuo, CV 10; sequence shown in GenBank MZ358906), Pik-GDD (Gaoyang diandaodahongmeng, CV 32; sequence shown in GenBank MZ358907), Pik-SRC (Sariceltik, CV 51; sequence shown in Dianzun, 2012, doctor university of south China agricultural university, academic paper), respectively.

This example demonstrates the inclusion and comparability of the subject system, as 2 new genes with comparability are added to 8 known genes.

Example 12: the positive and negative examples of the gene family 'heteronymous homogene' and 'homonymous heterogene' are screened by using a set of technical system which has the advantages of inclusiveness, accurate identification and excavation of the rice blast Pik disease-resistant allele family (figures 3,4 and 11)

Different from the general molecular marker patent technology, the technical system of the invention only aims at the detection of one or a few SNPs of a specific gene, and consists of three-level detection markers of 'haplotype-subunit-allele'. The gene is fit for the evolution track and the pattern of a target gene family, and openly comprises main functional specific genome regions and SNP, and each marker is independent and has strict logicality. This enables accurate screening of "heteronymous and homogeneous genes" or "homonymous and heterogeneous genes" resulting from the above-described sequencing errors.

In the normal example 1: as mentioned above, the carrier of the target gene Pik-p should belong to the K1/K2 functional haplotype of the Pik allele family (class I markers; FIG. 3), the KH1/KH2 functional haplotype (class II markers; FIG. 4), and 2 function-specific molecular markers (class III markers; FIG. 11) (Pikp/7/KH)^A2-2137G,Pikp/7^T1-961A/C/G) All positive (containing the target gene, the same below). Therefore, 2 varieties (CK10 and CK11) are deduced to carry the target gene Pik-p;

counterexample 1-1, variety CK12 was considered to be a carrier of Pi7 (Tsunematsu et al.2000, Breed Sci,50: 229-. However, in the technical system, the result of the three-stage molecular marker detection is completely the same as that of Pik-p. It was concluded that Pi7 was a "synonym" for Pik-p, i.e., the original specific SNP (C1-961A/G/T) of the gene was a sequencing error and was identical to Pik-p (T1-961A/G/C).

Counterexamples 1-2, variety CK13 was identified as a carrier of Pik-h (Tsunematsu et al 2000, Breed Sci,50: 229-. In this system, CK13(Pik-h) was labeled at level I (FIG. 2), labeled at level II (FIG. 3), and labeled at level III with Pikp/7/kh^A2-2137GThe results were identical to those of CK10, CK11(Pik-p), and CK12(Pi7 ═ Pik-p), and Pikp/7^T1-961A/G/CThe results of the detection were not identical to that of Pik-p/Pi7 (FIG. 10), and thus it seems to be inferred that the Pik-h specific SNP is (G1-961T/A/C) as the sequencing result. However, when the SNP is designed as a molecular marker Pikh^G1-961T/C/AThere was no difference between the varieties CK10-14 (reference marker #15b in FIG. 10), but when SNP (A1-961T/C/G) was designed as the molecular marker Pikh^A1-961T/C/GIn this case, the CK13 variety is different from the whole CK variety (marker #15a in FIG. 10). This indicates that "homonymous heterogene", i.e.Pikh, was generated by sequencing errors^G1-961T/C/AAnd Pikh^A1-961T/C/GIs a different Pik allele, whereas the latter is true Pik-h (fig. 10).

Example 13: the positive and negative examples of true and false disease-resistant genes Pik are screened by using a technical system which has the advantages of inclusion and accurate identification and mining of rice blast Pik disease-resistant allele families (figures 3,4,5 and 13)

Unlike the general molecular marker patent technology, the technology system of the present invention is composed of three detection markers, namely haplotype-sub-haplotype-allele, and the like, and is only used for detecting the DNA polymorphism of the specific genome region of the target gene. The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. This enables the screening of true and false genes (known genes and novel genes) resulting from the "false positive labeling" described above.

In the normal example 2: as mentioned above, the carrier of the target gene Pik should belong to the K1/K2 functional haplotype (class I markers; FIG. 3), the KM1/KM2 functional sub-haplotype (class II markers; FIG. 4) and 2 function-specific molecular markers (Pik) of the Pik gene family^T1-2793C,Pik^T1-5932G) Varieties that were all positive (CK1, CK 2; marking in grade III; fig. 5). It was concluded that 4 varieties (CV54, CV56, CV57, CV58) carry the target gene Pik (fig. 13);

counter example 2 haplotype of variety CV32 was K1/K2, but sub-haplotype was KH1/KM2, and only Pik among 2 Pik function-specific molecular markers^T1-2793CWas positive (FIG. 13). If only haplotype-specific and Pik function-specific molecular markers are used for Pik^T1-2793CFor this determination, CV32 should be determined as a carrier of the target gene Pik. However, if the system constructed according to the invention is stringent, the Pik alleleThe gene family is determined by the technical system, the variety is not the carrier of the target gene Pik, but the newly discovered Pik allele Pik-GDD, because its subunit type is not KM1/KM2, and only Pik is selected from 2 Pik function-specific molecular markers^T1-2793CWas positive (FIG. 13).

Example 14: the positive and negative examples of the true and false disease-resistant genes Pik-s are screened by using a set of technical system which has the advantages of compatibility and accurate identification and excavation of rice blast Pik disease-resistant allele families (figures 3,4,8 and 13)

Similarly, unlike the general molecular marker patent technology, which is only directed to the detection of DNA polymorphism in a specific genomic region of a target gene, the technical system of the present invention is composed of three-level detection markers, i.e., "haplotype-subunit-allele". The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNPs, so that each marker is independent and has strict logicality. This enables the screening of true and false genes (known genes and novel genes) resulting from the "false positive labeling" described above.

In the normal example 3: the carriers of the target gene Pik-s should belong to the K1/K2 functional haplotype (class I markers; FIG. 3), the KM1/KM2 functional sub-haplotype (class II markers; FIG. 4) and 2 function-specific molecular markers (Piks) of the Pik gene family^C1-957T,KM2/KH2^G2-1559C) Varieties that were all positive (CK5, CK 6; marking in grade III; fig. 8). It was concluded that 6 varieties (CV36, CV37, CV46, CV48, CV49, CV50) carry the target gene Pik-s (FIG. 12);

counter example 3-1. although the haplotype of variety CV10 was K1/K2 and the sub-haplotype was KM1/KM2, only KM2/KH2 was found among 2 Pik-s functional specific molecular markers^G2-1559CIt was positive. It was concluded that this variety is not a carrier of the target gene Pik-s, but a newly mined Pik allele Pik-CKN (FIG. 13).

Counter example 3-2. although the haplotype of variety CV51 was K1/K2, the sub-haplotype was KH1/KM2, and only KM2/KH2 out of 2 Pik-s function-specific molecular markers^G2-1559CIs positive. Deducing the variety from the resultNot the carrier of the target gene Pik-s, but a newly discovered Pik allele Pik-SRC (fig. 13).

The above examples demonstrate from different perspectives the remarkable abilities and effects of the technical system of the present invention to identify and exploit the families of disease-resistant alleles of the rice blast Pik with compatibility and precision.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> a set of technical systems with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele families

<130>

<160> 42

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213> Pik-K1P/A (1-6230~6419) -F (#1K marker)

<400> 1

cgggcagcag tgggatcgat actgag 26

<210> 2

<211> 30

<212> DNA

<213> Pik-K1P/A(1-6230~6419)-R

<400> 2

tttctgtttg aatttcaata tctgctactc 30

<210> 3

<211> 25

<212> DNA

<213> Pik-N1P/A (1-6230~6419) -F (#1N marker)

<400> 3

tcgttgtcca cgctgctcct gacga 25

<210> 4

<211> 29

<212> DNA

<213> Pik-N1P/A(1-6230~6419)-R

<400> 4

agtacaggta aaattagaat acaatagca 29

<210> 5

<211> 26

<212> DNA

<213> Pik-K2P/A (2-930~1110) -F (#2K marker)

<400> 5

atgtcagcca gaaaatgatg gaaacc 26

<210> 6

<211> 29

<212> DNA

<213> Pik-K2P/A(2-930~1110)-R

<400> 6

tagatttaga gtgggatgag taagttaat 29

<210> 7

<211> 24

<212> DNA

<213> Pik-N2P/A (2-930~1110) -F (#2N tag)

<400> 7

accactgtca ctactcggag ggaa 24

<210> 8

<211> 28

<212> DNA

<213> Pik-N2P/A(2-930~1110)-R

<400> 8

atggatttac aattaagtta attggcat 28

<210> 9

<211> 20

<212> DNA

<213> KM1/KH1G1-357A-F (#3 marker)

<400> 9

gtcctacgac ctggatgatg 20

<210> 10

<211> 20

<212> DNA

<213> KM1/KH1G1-357A-R

<400> 10

cagagaagcg attggaggca 20

<210> 11

<211> 24

<212> DNA

<213> KM2/KH2G2-1559C-F (#4 marker)

<400> 11

aagatagcaa caaagtagac gagc 24

<210> 12

<211> 21

<212> DNA

<213> KM2/KH2G2-1559C-R

<400> 12

caccatcgag ggtaagagga g 21

<210> 13

<211> 23

<212> DNA

<213> PikT1-2793C-F (#5 marker)

<400> 13

ccttccagta cctctctcga agc 23

<210> 14

<211> 21

<212> DNA

<213> PikT1-2793C-R

<400> 14

aatggcaggc atagcttgtc c 21

<210> 15

<211> 22

<212> DNA

<213> PikT1-5932G-F (#6 marker)

<400> 15

caaaagttcc tcgccgagat gc 22

<210> 16

<211> 25

<212> DNA

<213> PikT1-5932G-R

<400> 16

tcttcatgga aggctatcct tggta 25

<210> 17

<211> 24

<212> DNA

<213> PikmC1-851G/A-F (#7 marker)

<400> 17

gcgctcgtag gtgatctaag agat 24

<210> 18

<211> 20

<212> DNA

<213> PikmC1-851G/A-R

<400> 18

gatttcaccg gcgcaagcat 20

<210> 19

<211> 26

<212> DNA

<213> PiksC1-957T-F1(#8 marker)

<400> 19

tgcgatgttt ctggaggtca ggcatg 26

<210> 20

<211> 26

<212> DNA

<213> PiksC1-957T-F2

<400> 20

tgcggagttg ctgcaggtca ggcatg 26

<210> 21

<211> 25

<212> DNA

<213> PiksC1-957T-R

<400> 21

gtcgatgaga tgttgttgaa gagct 25

<210> 22

<211> 29

<212> DNA

<213> Pi1T1-853G-F1(#9 marker)

<400> 22

gttgcaatcg ccggtgacct aagagacca 29

<210> 23

<211> 29

<212> DNA

<213> Pi1T1-853G-F2

<400> 23

gttgcgctcg taggtgatct aagagacca 29

<210> 24

<211> 27

<212> DNA

<213> Pi1T1-853G-R

<400> 24

tcacatatgg atttcaccgg cgcaagc 27

<210> 25

<211> 24

<212> DNA

<213> Pi1T2-2519A-F (#10 marker)

<400> 25

caaagaaagg attcttatcc caat 24

<210> 26

<211> 23

<212> DNA

<213> Pi1T2-2519A-R

<400> 26

ccaccctttg ttatattgag ctt 23

<210> 27

<211> 23

<212> DNA

<213> Pik-IR8A1-149G-F (#11 marker)

<400> 27

cagagttcat cagatccgag ctt 23

<210> 28

<211> 21

<212> DNA

<213> Pik-IR8A1-149G-R

<400> 28

tcagagaagc gattggagac a 21

<210> 29

<211> 22

<212> DNA

<213> Pik-IR8A1-927G-dF (#12 marker)

<400> 29

tcygcgctcc ggaagaaggt cg 22

<210> 30

<211> 22

<212> DNA

<213> Pik-IR8A1-927G-R

<400> 30

cctggcaatc caaggatgca aa 22

<210> 31

<211> 21

<212> DNA

<213> Pikp/7/khA2-2137G-F (#13 marker)

<400> 31

gcaagggtta acccaggaaa g 21

<210> 32

<211> 22

<212> DNA

<213> Pikp/7/khA2-2137G-R

<400> 32

tagttgaatg aatggaatgg cc 22

<210> 33

<211> 30

<212> DNA

<213> Pikp/7T1-961A/G/C-dF (#14 marker)

<400> 33

tgcgrwgttk ctgsaggtca gccaagyaat 30

<210> 34

<211> 25

<212> DNA

<213> Pikp/7T1-961A/G/C-R

<400> 34

gtcgatgaga tgttgttgaa gagct 25

<210> 35

<211> 24

<212> DNA

<213> molecular marker PikhA1-961T/C/G-dF (#15a marker)

<400> 35

gttkctgsag gtcagccaag ytta 24

<210> 36

<211> 26

<212> DNA

<213> PikhA1-961T/C/G-R

<400> 36

ttgagcgaaa atgtctgcaa gagtct 26

<210> 37

<211> 24

<212> DNA

<213> PikhG1-961T/C/A-dF (#15b marker)

<400> 37

gttkctgsag gtcagccaag ctaa 24

<210> 38

<211> 26

<212> DNA

<213> PikhG1-961T/C/A-R

<400> 38

ttgagcgaaa atgtctgcaa gagtct 26

<210> 39

<211> 20

<212> DNA

<213> Pik-IR64T1-3013C-F (#16 label)

<400> 39

caagctatgc ctgccattgg 20

<210> 40

<211> 25

<212> DNA

<213> Pik-IR64T1-3013C-R

<400> 40

caagaaatat atctccttgc agtcg 25

<210> 41

<211> 23

<212> DNA

<213> Pik-IR64T1-5468C-F (#17 marker)

<400> 41

tggggagctg aatcatctaa agc 23

<210> 42

<211> 20

<212> DNA

<213> Pik-IR64T1-5468C-R

<400> 42

acaaggggag gtccgaaacg 20

Claims

1. A set of compatible technical system for accurately identifying and mining rice blast Pik disease-resistant allele families, which is characterized in that the technical system consists of three-level detection markers of 'haplotype-subunit-allele' and is promoted step by step; whether the variety to be tested carries the target gene or not is determined by the integrated result detected by the technical system;

specifically, the technical system comprises:

(1) functional haplotype/non-functional haplotype detection procedures for this gene family:

defining haplotype clearly differentiated genomic regions by sequence comparison of the alleles within the family; designing 2 groups of haplotype specific molecular markers and carrying out haplotype analysis on known disease-resistant gene reference varieties based on PCR technology to confirm the reliability of the markers; only the varieties judged as K1 and K2 genotypes at the same time are functional haplotype varieties; in subsequent tests, non-functional varieties can be excluded;

(2) the detection procedures for the sub-haplotypes KM1/KM2, KH1/KH2, KM1/KH2, KH1/KM2 of the K1/K2 functional haplotype of the gene family:

defining a sub-haplotype-specific single nucleotide polymorphism site SNP by sequence comparison of alleles within a family; designing 1 group of subunit type specific molecular markers, and analyzing the subunit type of a known disease-resistant gene reference variety based on a PCR technology to confirm the reliability of the molecular markers;

(3) the detection procedure for the broad-spectrum persistent resistance gene Pik of the K1/K2 functional haplotype KM1/KM2 sub-haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; pik gene carriers should belong to the K1/K2 functional haplotypes of the Pik gene family, KM1/KM2 sub-haplotypes, and 2 functional specific molecular markers are all varieties with the same genotype as Pik reference varieties; on the contrary, the detection result of any detection mark which does not accord with the technical system is not the target gene Pik;

(4) the detection procedure for the broad-spectrum persistent resistance gene Pik-m of the KM1/KM2 sub-haplotype of the K1/K2 functional haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; designing a specific molecular marker of the gene, and carrying out specific genotype analysis on a target gene of a known disease-resistant gene reference variety based on a PCR technology to confirm the reliability of the gene; the Pik-m gene carrier should belong to K1/K2 functional haplotypes of Pik gene family, KM1/KM2 sub-haplotypes, and the function specific molecular marker is a variety with the same genotype as the Pik-m reference variety; on the contrary, the detection result of any detection mark which does not accord with the technical system is not the target gene Pik-m;

(5) the procedure for the detection of the resistance gene Pik-s of the K1/K2 functional haplotype of KM1/KM2 sub-haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; pik-s gene carriers should belong to K1/K2 functional haplotypes of the Pik gene family, KM1/KM2 sub-haplotypes, and 2 functional specific molecular markers are all varieties with the same genotype as that of Pik-s reference varieties; on the contrary, the detection result that any detection mark does not accord with the technical system is not the target gene Pik-s;

(6) procedure for the detection of the broad-spectrum persistent resistance gene Pi1 of the KM1/KM2 sub-haplotype of the K1/K2 functional haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; pi1 gene carrier should belong to K1/K2 functional haplotype and KM1/KM2 sub-haplotype of Pik gene family, and 2 functional specificity molecular markers are all varieties with the same genotype as Pi1 reference variety; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pi 1;

(7) the detection procedure for the novel resistance gene Pik-IR8 of the KM1/KH2 mixed haplotype, which is a K1/K2 functional haplotype of this gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; the Pik-IR8 gene carrier should belong to K1/K2 functional haplotype and KM1/KH2 sub-haplotype of Pik gene family, and 2 functional specificity molecular markers are all varieties with the same genotype as Pik-IR8 reference varieties; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pik-IR 8;

(8) procedure for the detection of the broad-spectrum persistent resistance gene Pik-p ═ Pi7 of the KH1/KH2 haplotype, the K1/K2 functional haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; pik-p gene carriers should belong to K1/K2 functional haplotypes of the Pik gene family, KH1/KH2 sub-haplotypes, and 2 functional specific molecular markers are all varieties with the same genotype as the Pik-p reference variety; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pik-p;

(9) detection procedure for broad-spectrum persistent resistance gene Pik-h of KH1/KH2 haplotype, a K1/K2 functional haplotype of the gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; pik-h gene carriers should belong to K1/K2 functional haplotypes of the Pik gene family, KH1/KH2 sub-haplotypes, and 2 functional specific molecular markers are all varieties with the same genotype as the Pik-h reference variety; on the contrary, the detection result that any detection mark does not meet the technical system is not the target gene Pik-h;

(10) detection procedure for the novel resistance gene Pik-IR64 of the KH1/KH2 haplotype, a functional haplotype of K1/K2 of this gene family:

defining a SNP specific for a target gene by sequence comparison of alleles within a family; respectively designing specific molecular markers of the genes, and carrying out specific genotype analysis on target genes of known disease-resistant gene reference varieties based on a PCR technology to confirm the reliability of the genes; the Pik-IR64 gene carrier should belong to K1/K2 functional haplotype and KH1/KH2 sub-haplotype of Pik gene family, and 2 functional specificity molecular markers are all varieties with the same genotype as Pik-IR64 reference varieties; on the contrary, the detection result of any detection mark which does not accord with the technical system is not the target gene Pik-IR 64.

2. The technical system of claim 1, wherein:

(1) the most optimal and simplified haplotype-specific molecular marker combination is Pik-K1^{P/A(1-6230～6419)}/Pik-K2^P ^{/A(2-930～1110)}(ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 5-6;

wherein the reference signs indicate: k1, #1 genotype haplotype is for functional genotype K; p/a, presence/absence, type of marker; 1-6230 to 6419, the genomic position marked, #6230 to 6419 region of the #1 gene; and so on;

(2) the optimal subunit-specific molecular marker combination is KM1/KH1^G1-357AAnd KM2/KH2^G2-1559C(ii) a The sequences are respectively shown in SEQ ID NO. 9-10 and SEQ ID NO. 11-12;

(3) the optimal target gene specific molecular marker combination is Pik^T1-2793CAnd Pik^T1-5932G(ii) a The sequences are respectively shown in SEQ ID NO. 13-14 and SEQ ID NO. 15-16;

(4) the optimal target gene specific molecular marker is Pikm^C1-851G/A(ii) a The sequence is shown in SEQ ID NO. 17-18;

(5) the optimal target gene specific molecular marker combination is Piks^C1-957TAnd KM2/KH2^G2-1559C(ii) a The sequences are respectivelySEQ ID NO. 19-21 and SEQ ID NO. 11-12;

(6) the optimal target gene specific molecular marker combination is Pi1^T1-853GAnd Pi1^T2-2519A(ii) a The sequences are respectively shown in SEQ ID NO. 22-24 and SEQ ID NO. 25-26;

(7) the optimal target gene specific molecular marker combination is Pik-IR8^A1-149GAnd Pik-IR8^A1-927G(ii) a The sequences are respectively shown in SEQ ID NO. 27-28 and SEQ ID NO. 29-30;

(8) the optimal target gene specific molecular marker combination is Pikp/7/kh^A2-2137GAnd Pikp/7^T1-961A/G/C(ii) a The sequences are respectively shown in SEQ ID NO. 31-32 and SEQ ID NO. 33-34;

(9) the optimal target gene specific molecular marker combination is Pikp/7/kh^A2-2137GAnd Pikh^A1-961T/C/G(ii) a The sequences are respectively shown in SEQ ID NO. 31-32 and SEQ ID NO. 35-36;

(10) the optimal target gene specific molecular marker combination is Pik-IR64^T1-3013CAnd Pik-IR64^T1-5468C(ii) a The sequences are respectively shown in SEQ ID NO. 39-40 and SEQ ID NO. 41-42.

3. The use of the technical system of claim 1 or 2 for systematic and accurate inclusive identification and mining of complex rice blast Pik disease-resistant allele families, comprising the following 8 target genes:

the KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family;

a KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family, and a broad-spectrum durable resistance gene Pik-m;

KM1/KM2 sub-haplotype of K1/K2 functional haplotype of the rice blast Pik disease-resistant allele family resistance gene Pik-s;

the rice blast Pik disease resistance allele family K1/K2 functional haplotype KM1/KM2 subelement broad-spectrum persistent resistance gene Pi 1;

a novel resistance gene Pik-IR8 of KM1/KH2 mixed subunit type of K1/K2 functional haplotype of the Pik disease resistance allele family;

the sequence of the novel resistance gene Pik-IR8 is shown in GenBank MZ 358904;

the broad-spectrum persistent resistance gene Pik-p ═ Pi7 of the KH1/KH2 haplotype, which is a K1/K2 functional haplotype of the Pik disease-resistant allele family of rice blast;

the KH1/KH2 subunit type, which is a K1/K2 functional haplotype of the Pik disease-resistant allele family of rice blast, is a broad-spectrum persistent resistance gene Pik-h;

a novel resistance gene Pik-IR64 for the KH1/KH2 haplotype which is a K1/K2 functional haplotype of the Pik disease resistance allele family;

the sequence of the novel resistance gene Pik-IR64 is shown in GenBank MZ 358905.

4. Use of the technical system according to claim 1 or 2 for identifying 2 novel target genes: disease-resistant genes Pik-CKN and Pik-GDD of a rice blast Pik disease-resistant allele family;

the sequence of the disease-resistant gene Pik-CKN is shown in GenBank MZ 358906;

the sequence of the disease-resistant gene Pik-GDD is shown in GenBank MZ 358907.

5. A group of specific molecular markers for identifying and mining rice blast Pik disease-resistant allele families is characterized by comprising the following components:

(1) specific molecular markers for the detection of functional/non-functional haplotypes of this gene family:

is Pik-K1^{P/A(1-6230～6419)}/Pik-K2^{P/A(2-930～1110)}(ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 5-6;

(2) specific molecular markers for the sub-haplotypes KM1/KM2, KH1/KH2, KM1/KH2, KH1/KM2 for the detection of the functional haplotype of K1/K2 of the gene family:

is KM1/KH1^G1-357AAnd KM2/KH2^G2-1559C(ii) a The sequences are respectively SEQ ID NO. 9-10 andSEQ ID NO. 11-12;

(3) specific molecular markers for the broad-spectrum persistent resistance gene Pik of the KM1/KM2 sub-haplotype for detecting the K1/K2 functional haplotype of the gene family:

is Pik^T1-2793CAnd Pik^T1-5932G(ii) a The sequences are respectively shown in SEQ ID NO. 13-14 and SEQ ID NO. 15-16;

(4) specific molecular markers for the broad-spectrum persistent resistance gene Pik-m of the KM1/KM2 sub-haplotype for detecting the K1/K2 functional haplotype of the gene family:

is Pikm^C1-851G/A(ii) a The sequence is shown in SEQ ID NO. 17-18;

(5) specific molecular markers for the resistance gene Pik-s of the KM1/KM2 sub-haplotype for the detection of the K1/K2 functional haplotype of the gene family:

is Piks^C1-957TAnd KM2/KH2^G2-1559C(ii) a The sequences are respectively shown in SEQ ID NO. 19-21 and SEQ ID NO. 11-12;

(6) specific molecular markers for the broad-spectrum persistent resistance gene Pi1 of the KM1/KM2 sub-haplotype for detecting the K1/K2 functional haplotype of the gene family:

is Pi1^T1-853GAnd Pi1^T2-2519A(ii) a The sequences are respectively shown in SEQ ID NO. 22-24 and SEQ ID NO. 25-26;

(7) specific molecular markers for the novel resistance gene Pik-IR8 for the KM1/KH2 mixed sub-haplotype for detecting the K1/K2 functional haplotype of this gene family:

is Pik-IR8^A1-149GAnd Pik-IR8^A1-927G(ii) a The sequences are respectively shown in SEQ ID NO. 27-28 and SEQ ID NO. 29-30;

(8) specific molecular markers for broad-spectrum persistent resistance gene Pik-p ═ Pi7 for the KH1/KH2 haplotype, which is the K1/K2 functional haplotype of the gene family:

is Pikp/7/kh^A2-2137GAnd Pikp/7^T1-961A/G/C(ii) a The sequences are respectively shown in SEQ ID NO. 31-32 and SEQ ID NO. 33-34;

(9) specific molecular markers for the broad-spectrum persistent resistance gene Pik-h for the KH1/KH2 haplotype, which is the K1/K2 functional haplotype of this gene family:

is Pikp/7/kh^A2-2137GAnd Pikh^A1-961T/C/G(ii) a The sequences are respectively shown in SEQ ID NO. 31-32 and SEQ ID NO. 35-36;

(10) specific molecular markers for the novel resistance gene Pik-IR64 for detecting the KH1/KH2 haplotype of the K1/K2 functional haplotype of this gene family:

is Pik-IR64^T1-3013CAnd Pik-IR64^T1-5468C(ii) a The sequences are respectively shown in SEQ ID NO. 39-40 and SEQ ID NO. 41-42.

6. Use of the technical system according to claim 1 or 2 for the precise screening of "heteronyms" which may be present in this allele family.

7. Use of the technical system according to claim 1 or 2 for the precise screening of "homonymous heterogenes" which may be present in the allele family.

8. Use of the technical system according to claim 1 or 2 for the accurate screening of "true and false target genes" that may be present in the allele family.

9. The use of the technical system of claim 1 or 2 in the development of methods for the discovery of disease resistance genes from other plant disease systems.

10. Use of the technical system according to claim 1 or 2 for the development of a method for identifying disease resistance genes of other plant disease systems.