CN108977568B - Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof - Google Patents

Abstract

The invention providesSeed rice blast resistance genePik‑pFunctional specific molecular marker and application thereof, and rice blast resistance gene is amplified from rice genome DNA through primer pair SEQ ID NO.1 and SEQ ID NO.2Pik‑pAnd (3) molecular markers in specific band patterns. The rice blast resistance gene provided by the inventionPik‑pThe functional specificity molecular marker has important application value, and the utilization efficiency of the gene in germplasm resource screening, molecular marker-assisted selective breeding, gene pyramiding breeding and transgenic breeding can be improved by utilizing the marker.

Description

Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and relates to a rice blast resistance genePik-pFunctional specific molecular markers and applications thereof.

Background

The rice blast fungus causing the most serious harm to the stable yield of rice (Magnapothe oryzae) The resulting blast disease causes severe grain loss in rice primary producing areas all over the world (Qu 1985, Ma et al 2015). Long-term production practice shows that breeding and utilizing disease-resistant variety is the most safe and effective method for preventing and treating rice blast. Moreover, due to frequent pathogenic variation of physiological races of rice blast, the resistance of a single resistant variety is gradually lost within 3-5 years after planting (Yide et al, 2011); therefore, the excavation and reasonable utilization of broad-spectrum resistance genes are important ways for obtaining durable and broad-spectrum disease-resistant varieties. The conventional identification method of the resistance gene is inoculation identification, but the conventional identification method of the inoculation is not enough to accurately and truly identify the resistance gene due to certain cross property of different resistance genes on the resistance spectrumReflecting the genotype. In recent decades, with the development of rice disease-resistant molecular genetics, many resistance genes have been finely located or cloned (Su et al 2015), and the development and application of molecular markers have greatly promoted the identification of resistance gene genetic backgrounds and the development of poly-resistance gene pyramiding breeding (Hittalmani et al 2000; Jena and Mackill, 2008). Among the cloned resistance genes, some disease-resistant genes are located at the same site, the sequences between the multiple alleles and between the functional sequence and the non-functional sequence are highly homologous, and the general linkage markers still have difficulty in accurately screening the functional disease-resistant genes of various materials (Qu et al 2006; Zhou et al 2006; Ashikawa et al 2008; Takahashi et al 2010; Yuan et al 2011; Zhoai et al 2011; Yuan et al 2011; Hua et al 2012; Ma et al 2015; Tian et al 2016). Therefore, the sequence of the functional allele is directly analyzed and the functional specific molecular marker is developed to select the target gene, so that the selection reliability is high, and the breeding pace is greatly accelerated.

In recent years, there are concerns aboutPikThe research of resistance genes of allelic sites has been greatly advanced, and at present, at least 5 resistance genes with different resistance spectrums are found on the resistance sites (Ashikawa et al 2008; Yuan et al 2011; ZHai et al 2011; Hua et al 2012); wherein the plant is derived from oryza glaberrima LAC23Pik-pThe rice blast resistance gene has the characteristics of wide spectrum and high resistance (Yuan et al 2011; Wang et al 2009), and has very high resistance to rice blast microspecies in a plurality of rice main producing areas in China (Hittalmani et al 2000; Fuentes et al 2008; Yang et al 2008; Talconi et al 2010; Hua et al 2012). Panqinghua et al (2012) although developedPik-pThe SNP marker needs to identify a K/N type genotype before use, and actually, the genotype has certain incompatibility, and the identification process needs complicated work such as enzyme digestion identification (ZHai et al 2010), so the SNP marker is not suitable for large-scale resistance identification and molecular marker-assisted selective breeding (MAS) work. Therefore, to more accurately and efficiently introduce a broad-spectrum resistance gene to rice blastPik-pWhen applied to rice resistance breeding work, the development of a convenient and easy-to-use real reflection target gene is necessaryIs/are as followsPik-pSpecific molecular markers.

Disclosure of Invention

In order to overcome the disadvantages and shortcomings of the prior art, the primary object of the present invention is to provide a rice blast resistance genePik-pThe function specific molecular marker Pik-p-InDel.

Another object of the present invention is to provide the rice blast resistance genePik-pA detection method of a gene specific molecular marker Pik-p-InDel.

Another object of the present invention is to provide the rice blast resistance genePik-pApplication of a gene function specific molecular marker Pik-p-InDel.

In order to achieve the purpose, the invention adopts the following technical scheme:

rice blast resistance genePik-pThe functional specific molecular marker Pik-p-InDel is a rice blast resistance gene amplified from rice genome DNA by using primer pair SEQ ID NO.1 and SEQ ID NO.2Pik-pA molecular marker in a specific band pattern;

SEQ ID NO.1：5’-TGGTTAAATAGGACTCCCTC-3’ ；

SEQ ID NO.2：5’-CATTCGCAGACTCGTTGA-3’ ；

the rice variety for obtaining the rice genome DNA is IRBLKP-K60 (Pik-pThe donor parent);

the rice blast resistance genePik-pComprises a gene segment I for coding NBS-LRR type protein

SEQ ID NO. 3: sequence I:

TGGTTAAATAGGACTCCCTCTATTCCATAATATAAGGCACAACCACTTTTCTTAGATGTTTCATAATATAAGGCATGCATGCATATAGGCAATTAACTATGACCTCTTTTTTATTAAATTATTATTCATGCTCTCTGATTCTATTGGATGCATGCATTGTATTTATTAGGATGTTCTAAACTACAAGATAATAATAATTATTTTCTTGGTGTTTGGGTTAGGGGTGGTTATGACTTATATTTTATAATGGAGGGAGTAGTACAAGTATAATATTAAAGACTTTAATATTATATTAAAGGACGGAGGAAATATTAGGGAGAAACGGCATGACCACGAGTCAGTCAACGAGTCTGCGAATG

the rice blast resistance genePik-pThe detection method of the functional specific molecular marker Pik-p-InDel comprises the following steps:

(1) alignment of multiple Rice blast resistance genesPik-pBy downloading from a public databasePik-pAnd their homologousPik, Pik-m,Pi1AndPik-hgenome sequence and genome sequence of corresponding region of sequencing variety Nipponbare, forPik-pThe sites are subjected to sequence alignment and screeningPik-pSpecific insertion-deletion (InDel) sites which can be distinguished from other rice blast allelic resistance genes at the sites;

(2) designing gene specific primers at the upstream 126 bp and the downstream 233 bp of the InDel locus by using the InDel information obtained in the step (1) according to the design principle of an InDel marker, wherein the base sequences of the primer pairs are as follows:

Fl：5’-TGGTTAAATAGGACTCCCTC-3’；

Rl：5’-CATTCGCAGACTCGTTGA-3’；

(3) to carry a rice blast resistance genePik-pThe total DNA of the rice blast resistant variety IRBLkp-K60 is used as a template to carry out PCR amplification, and the obtained PCR product is the rice blast resistant genePik-pSpecific molecular marker Pik-p-InDel;

the rice blast resistance genePik-pApplication of specific molecular marker Pik-p-InDel in identifying rice blast resistance genes of rice varieties, and is particularly suitable for identifying rice blast resistance genes of rice varietiesPikRice blast resistance genes of rice varieties with different gene cluster regions; preferably comprising the steps of:

(1) amplification: carrying out PCR on the genome of the rice variety to be detected by using primers Fl and Rl;

(2) detecting; detecting by polyacrylamide gel electrophoresis, and carrying the rice blast resistance gene if a nucleotide fragment with the molecular weight of 359bp is detectedPik-p(ii) a If the nucleotide fragment with the molecular weight of 378bp is detected, the rice variety to be detected carries the non-rice blast resistance gene of the sitePik-pOther functional genes of (3); if no nucleotide fragment is detected, the rice variety to be detected does not carryPikA functional gene of the locus.

The principle of the invention is as follows: InDel means that they are different in a related species or the same speciesSequences at the same site in the genome between individuals have been inserted or deleted with nucleotide fragments of different sizes, i.e., one or more bases are inserted or deleted at a site in one sequence compared to the homologous sequence (Weber et al, 2002). The InDel marker is based on PCR amplification technology and essentially belongs to a length polymorphism marker (Hyten et al, 2010). The InDel marker has good stability, high polymorphism and simple typing system (Jander et al, 2002); compared with SNP markers with complex typing systems, InDel detection is simpler and more convenient, has lower requirements on instruments and equipment and technology, and can be carried out on an electrophoresis technology platform. The method is applied to the fields of animal and plant population genetic analysis, molecular assisted breeding, human forensic genetics, medical diagnosis and the like. The invention searches through a method of multi-sequence comparisonPik-pInDel present in the gene sequence, since this InDel is inPik-pAndPikhas a 19bp difference in other functional genes, does not contain the site in Nipponbare, so that the functional genes are easy to be combinedPik-pFrom which a distinction is made. The invention designs a primer pair F1/R1 according to the invention, and fragments with different sizes are displayed during polyacrylamide gel electrophoresis detection through conventional PCR amplification.

Compared with the prior art, the invention has the following advantages and effects:

(1) the molecular marker provided by the invention has high specificity:Pik-pthe existence of the genomic region includesPik-p The 5 inner candidate genes with resistance gene characteristics, each of them consisting of two loci, which are highly homologous in sequence (Zhai et al 2010); in addition to this, the present invention is,Pik-p1and the rice blast resistance gene cloned on the sitePikm-1, Pik-1AndPik-s-1，Pik-p-2andPikm-2, Pik-2andPik-s-2there is a high identity in the sequence at the amino acid level (Hua et al, 2012). The molecular marker provided by the invention is obtained by the inventor through continuous sequence polymorphism search and experimental verification, and can be obviously obtainedPik-pAnd exist in the genomic regionPik-pDistinguishing highly homologous paralogous genes; can also successfully distinguishPik-m, Pik, Pik-hAndPik- sand itIt is not a functionally homologous gene.

(2) In practical application, the molecular marker provided by the invention has low cost and high flux: at present, most electrophoresis platforms are used for typing, the typing platforms are fast and economical, complex experimental equipment is not needed, and operability is high. The electrophoresis typing platform includes agarose gel electrophoresis, denaturing or non-denaturing polyacrylamide gel electrophoresis and capillary electrophoresis. The molecular marker provided by the invention only needs PCR combined with agarose gel electrophoresis or non-denaturing polyacrylamide gel electrophoresis, has low cost, high flux and high specificity (namely high accuracy), and is particularly suitable for production practice.

(3) The invention is directed toPik-pDeveloped by internal sequence of genePik-pGene-specific InDel markers. The invention can successfully detect by electrophoresisPik-pWith other rice blast resistance genes located at the site: (Pikm, Pik，PikhAndPiks) In distinction, to date, no such markers have been reported. The invention providesPik-pThe specific molecular marker Pik-p-InDel is a codominant marker, and the reliability and accuracy of the marker are superior to those of the codominant marker in the practical application process. The invention can be applied toPik-pThe genetic resource screening, the transgene identification and the gene polymerization, and the rice resistance breeding work based on the MAS technology. The mark is present inPik-pInternal to the gene, therefore, arePik-pThe theoretical value of the screening capacity of the composite material can reach 100 percent, and the comprehensive performance of the composite material is superior to that of the reported composite materialPik-pLinked molecular markers and functional markers.

(4) The molecular marker provided by the invention can be simply applied to populations with different genetic backgrounds. Existing andPik-pmost of the linked molecular markers are developed by aiming at sequence polymorphisms of 2 different parents in the same population, and the applicability of the markers in other populations is limited. The functional markers developed by Pan et al (2012) are not suitable for large-scale germplasm resource identification and MAS breeding because the identification process is complicated. The invention is suitable for transgenic breeding, gene polymerization and MAS technology-based resistance breeding under any genetic background without repeated parent polymorphismScreening greatly improves the breeding efficiency.

Thus, the rice blast resistance gene provided by the present inventionPik-pThe gene specific molecular marker has important application value, and the utilization efficiency of the gene in germplasm resource screening, molecular marker-assisted selective breeding, gene pyramiding breeding and transgenic breeding can be improved by utilizing the marker.

Drawings

FIG. 1 isPik-pGene specific molecular marker Pik-p-InDelPikThe verification result chart of different rice blast resistance genes and Nipponbare in a gene cluster region is shown, wherein: lane M is DNA Marker, and the DNA templates in lanes 1-6 are resistance variety IRBLkp-K60 (Pik-p) Susceptible Nipponbare (Nip) variety, resistant IRBLk-Ka (a)Pik) Resistant variety IRBLkm-Ts: (Pik-m) Resistant variety IRBLkh-K3 (Pik-h) And resistant variety IRBLks-S: (Pik-s)。

FIG. 2 isPik-pThe verification result chart of the gene specific molecular marker Pik-p-InDel in other rice varieties is shown, wherein: m: DNA Marker; 1-72 DNA templates are sequentially a resistance gene donor variety IRBLkp-K60 (Pik-p) Xiangzaixiao No. 45, Zhongzao No. 23, 618B, Yixiang No. 1B, Huaxiang B, II-32B, 629B, 2155, Wufeng B, Huifeng B, Anfeng B, Longtepu B, Jinkang 1B, Taifeng B, Rumigu, IR88988B, Huaguangdong 13B, Zhenshan 97B, R527, Di Xiang B, D702B, Bobai B, Shen 95B, Yuofeng Fengfeng B, Fuyi B710S, SE21 3921 21S, Fuminmin 2B, Kogyang No. B, Li Ming B, Jinnan No. 43B, you 1B, Yue 4B, D62B, gang 46B, Fengyuan B, D702B, Minhui 86, R8, sky Yangyun No. 131, Xian Zangyun No. 7, Zhongzai 8015, Yingguan, Ulva 128, Xiaozhan, Huangzhan, Huanghui No. 3301, Luohui No. 630, Kuaihui No. 630, Kuai No.1, Taihao, Kuai, Xiaohui Min-kuai, Xiaohui Kangzai No.1, Shihui Kanghua 1, Shihui Kao, Shihui No. R1, Shihui Kai Kanghua Yuanzai, Shihui Kao, Shihui No.1, Shihui Kao, Shi Shihui, Shi kou Shihui, Shi-7, Shihui, Shi kui, Shi-kui Kai, Shi-kui, Shi-7, Shi-kui, Shi, Xiang late long-shaped rice No.1, Dongting late long-shaped rice No.2, Yan rice No. 4, Guanghui 128, specially green selection, test 64 and late 3.

FIG. 3 is a diagram showing the results of multiple sequence alignments of different rice varieties: a rice blast resistance gene variety with gene specificity InDel,Pik-p: resistant varietiesIRBLkp-K60；Pik: resistant varieties IRBLk-Ka;Pik-m: resistant varieties IRBLkm-Ts;Pik-h: resistant variety IRBLkh-K3;Pik-s: resistant variety IRBLks-S.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Example 1 Rice blast resistance GenePik-pFunctional specific molecular marker and primer design and detection thereof

(1) Pik-pAnalysis of insertion/deletion (InDel) sites:

downloading and obtaining representative varieties of rice from public databasesPik-pGenes and their homologuesPik, Pik-m,Pi1AndPik-hgenome sequence and genome sequence of the corresponding region of Nipponbare 9311 of the sequenced variety, aiming atPik-pThe sites are subjected to sequence alignment and screeningPik-pSpecific and distinguishable from the site, and specific insertion/deletion (InDel) difference sites of other rice blast allelic resistance genes. Sequencing the genomic sequence of the rice blast resistance Gene variety IRBLkp-K60 with Gene specificity InDel without corresponding region in the varieties Nipponbare and 9311 (Nipponbare)Pik-p) And resistant variety IRBLk-Ka (Pik) Resistant variety IRBLkm-Ts: (Pik-m) Resistant variety IRBLkh-K3 (Pik-h) And resistant variety IRBLks-S: (Pik-s) The results of the multiple sequence alignment are shown in FIG. 3: wherein a plurality of "-" is identifiedPik-pA gene-specific deletion sequence;

(2) designing a primer:

according to the design principle of InDel markers, primers are designed at the upstream 126 bp and the downstream 233 bp of the InDel locus, and the base sequences of the primer pairs are shown as follows:

Fl：5’-TGGTTAAATAGGACTCCCTC-3’；

Rl：5’-CATTCGCAGACTCGTTGA-3’。

(3) selecting a representative rice variety: is selected to carryPik-pGenes andPikrepresentative varieties of genomic alleles are as follows:

the rice variety IRBLkp-K60 isPik-pDonor breed (Fukuta et al, 2004), positive control;

the rice variety IRBLk-Ka isPikDonor variety (Fukuta et al 2004);

the rice variety IRBLkm-Ts isPik-mDonor variety (Fukuta et al 2004);

the rice variety IRBLkh-K3 isPik-hDonor variety (Fukuta et al 2004);

the rice variety IRBLks-S isPik-sDonor variety (Fukuta et al 2004);

infection control varieties: nipponbare, a variety bred in Japan, and relevant information can be obtained in the national rice data center (http:// www.ricedata.cn/variety/varis/602979. htm).

(4) PCR amplification to obtain a DNA fragment containingPik-pFragments of gene-specific InDel

The results of conventional PCR amplification using the primer pairs Fl and R1 and the total DNA of the rice variety as templates and polyacrylamide gel electrophoresis detection are shown in FIG. 1.

The amplification reaction system is as follows:

2×Mix buffer(Mg²⁺Plus)：12.5μl

primer Fl (10 μ Μ): 1 μ l

Primer Rl (10 μm)); 1 μ l

Taqase(5U/ml)：0.2μl

DNA template (20-50 ng/. mu.l): 1 μ l

ddH₂O: make up to 25. mu.l.

The PCR temperature cycling conditions were as follows: 3 minutes at 94 ℃; 30 seconds at 94 ℃, 30 seconds at 58 ℃, 30 seconds at 72 ℃, 35 cycles; 7 minutes at 72 ℃; storing at 10 ℃.

After the PCR reaction is finished, taking a proper amount of sample to carry out electrophoresis detection on 8% polyacrylamide gel under the electrophoresis condition of 90V for 1 hour.

Wherein lane symbol 1 of FIG. 1 isPik-pPCR fragment using donor variety rice variety IRBLkp-K60 genome DNA as template and rice blast resistance genePik-pThe molecular structure is in a specific band type,is thatPik-pThe gene-specific molecular marker Pik-p-InDel. The results in FIG. 1 show that the molecular markers specific to the Pik-p gene can distinguish not only the influenza alleles but also the influenza allelesPikOther resistance genes identified at the locus. That is, where carryingPik-pThe rice variety of (1) shows the electrophoresis detection band of the PCR amplification product at 359bpPikOther rice blast resistance genes located on the site are represented by 378bp of an electrophoresis detection band, and functional genes not containing the site are represented by no band or other band types.

Example 2 resistance genesPik-pIdentification of gene-specific molecular markersPikApplication of rice blast resistance genes in different gene cluster regions.

Based on the PCR product band of the polymorphism, the PCR product can contain the target genePik-pAnd othersPikResistance genes on the gene cluster are distinguished. As shown in FIG. 1, depending on the position of the strap, the strap may be moved from one position to anotherPik-p359bp of the gene expression contains the gene, distinguished from other resistance genes identified at the sitePik-pThe gene 378bp represents that the gene contains a resistance gene site, and other banding patterns or no banding indicates that the gene does not contain a functional gene of the site. The result of the test is matched with the design analysis, which indicates that the resistance genePik-pThe gene specific molecular marker can be used for identificationPik-pGenes andPikthe gene family allele and the like.

Example 3 resistance genesPik-pApplication of gene specific molecular marker in detection of other rice varieties

Table 1 corresponds to 72 representative varieties in FIG. 2

The genomic DNAs were extracted, and PCR amplification and electrophoresis detection were carried out by the method of example 1 using the extracted genomic DNAs as templates. Depending on the size of the product (band), the resistance gene can be selectedPik-pDistinguished from other rice blast resistance genes. As shown in FIG. 2, the phenotype of the resistance spectrum isPik-pType of individual (carrying the Rice blast resistance Gene)Pik-pThe sample of the disease-resistant variety IRBLkp-K60, lanes 11, 16 and 62, detected a Pik-p-InDel gene-specific fragment, whereas other individuals with the resistance profiling phenotype could not detect the molecular marker. As can be seen, the test results are identical with those of the design analysis, indicating that the resistance genePik-pThe specific molecular marker can be used for identificationPik-pGenes and other rice blast resistance genes, includingPikThe gene cluster allele and the like are applied.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> institute of biotechnology of academy of agricultural sciences of Fujian province

Fujian Agriculture and Forestry University

<120> rice blast resistance gene Pik-p functional specific molecular marker and application thereof

<130> 3

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

tggttaaata ggactccctc 20

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<400> 2

cattcgcaga ctcgttga 18

<210> 3

<211> 359

<212> DNA

<213> Artificial sequence

<400> 3

tggttaaata ggactccctc tattccataa tataaggcac aaccactttt cttagatgtt 60

tcataatata aggcatgcat gcatataggc aattaactat gacctctttt ttattaaatt 120

attattcatg ctctctgatt ctattggatg catgcattgt atttattagg atgttctaaa 180

ctacaagata ataataatta ttttcttggt gtttgggtta ggggtggtta tgacttatat 240

tttataatgg agggagtagt acaagtataa tattaaagac tttaatatta tattaaagga 300

cggaggaaat attagggaga aacggcatga ccacgagtca gtcaacgagt ctgcgaatg 359

Claims (5)

1. Rice blast resistance genePik-pA primer pair of functional specific molecular markers is characterized in that: the sequence of the molecular marker primer pair is SEQ ID NO. 1: 5'-TGGTTAAATAGGACTCCCTC-3', respectively; SEQ ID NO. 2: 5'-CATTCGCAGACTCGTTGA-3' are provided.

2. Rice blast resistance genePik-pA function-specific molecular marker characterized by: the rice blast resistance gene is amplified from the rice genome DNA by a primer pair SEQ ID NO.1 and SEQ ID NO.2Pik-pThe rice variety of the rice genome DNA is IRBLKP-K60.

3. The rice blast resistance gene according to claim 2Pik-pA function-specific molecular marker characterized by: the rice blast resistance genePik-pComprises a gene fragment I for coding NBS-LRR type protein, and the sequence of the gene fragment I is shown as SEQ ID NO. 3.

4. The rice blast resistance gene of claim 2Pik-pThe application of the functional specific molecular marker in identifying rice blast resistance genes of rice varieties.

5. The rice blast resistance gene of claim 2Pik-pFunctional specific molecular marker in identificationPikRegion of gene clusterThe application of the rice blast resistance gene of the same rice variety.

Images