CN108977568A - A kind of rice blast resistance gene Pik-p specific Function molecular labeling and its application - Google Patents
A kind of rice blast resistance gene Pik-p specific Function molecular labeling and its application Download PDFInfo
- Publication number
- CN108977568A CN108977568A CN201810961795.0A CN201810961795A CN108977568A CN 108977568 A CN108977568 A CN 108977568A CN 201810961795 A CN201810961795 A CN 201810961795A CN 108977568 A CN108977568 A CN 108977568A
- Authority
- CN
- China
- Prior art keywords
- pik
- rice blast
- gene
- blast resistance
- molecular labeling
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of rice blast resistance genesPik‑pSpecific Function molecular labeling and its application, are amplified from oryza sativa genomic dna and rice blast resistance gene by primer pair SEQ ID NO.1 and SEQ ID NO.2Pik‑pIn the molecular labeling of specific banding pattern.Rice blast resistance gene provided by the present inventionPik‑pSpecific Function molecular labeling has important application value, and the efficiency that the gene utilizes in Screening of Germplasm, molecular marker assisted selection breeding, gene pyramiding breeding and transgenic breeding can be improved using this label.
Description
Technical field
The invention belongs to agricultural biological technical fields, are related to a kind of rice blast resistance genePik-pSpecific Function molecular labeling
And its application.
Background technique
By rice stable yields is endangered most serious Pyricularia oryzae (Magnapothe oryzae) caused by rice blast disease, it is several
Serious grain loss (Qu 1985, Ma et al. 2015) is all caused to whole world rice main producing region.Long-term production is real
It tramples and shows breeding and be prevention and treatment rice blast the most safely and effectively method using disease-resistant variety.Moreover since rice blast physiological pathology is small
Kind pathogenicity variation is frequent, causes the resistance of single resistant variety that can gradually lose in 35 years after planting (abundant to obtain
Institute etc., 2011)；Therefore, excavate and rationally using broad-spectrum resistance gene be obtain persistently, the important channel of broad-spectrum disease resistance kind.
Conventional Resistance genes method is inoculated identification, but since different resistant genes have certain intercrossing in anti-spectrum,
That traditional vaccination identification method is not enough to is accurate, veritably reflects genotype.In recent decades, with paddy disease-resistant molecular genetic
Development, many resistant genes are able to by finely positioning or clone (Su et al. 2015), and the development of molecular labeling
And the identification of resistant gene genetic background and the development (Hittalmani of more disease-resistant gene pyramiding breedings is greatly facilitated in application
et al. 2000；Jena and Mackill, 2008).In the resistant gene cloned, some disease-resistant genes are located at same
Site, between these multiple alleles, sequence very high homology between functional form sequence nand function type, general linked marker
Still it is difficult to accurately screen function disease-resistant gene (the Qu et al. 2006 of a variety of materials; Zhou et al. 2006;
Ashikawa et al. 2008; Takahashi et al. 2010; Yuan et al. 2011; Zhai et al.
2011; Yuan et al. 2011; Hua et al. 2012;Ma et al.2015; Tian et al. 2016).Cause
This, the sequence of direct analytic function allele itself and the molecular labeling for developing its specific Function to carry out target gene
Selection, not only selects high reliablity, can also greatly accelerate breeding paces.
In recent years, aboutPikThe research of the resistant gene of loci has remarkable progress, at present on the resistance locus
So far resistant gene (the Ashikawa et al. 2008 for there are 5 anti-spectrums of difference has at least been found; Yuan et al. 2011;
Zhai et al. 2011;Hua et al. 2012)；Wherein, derived from Oryza glaberrima Steud LAC23'sPik-pShow wide spectrum
Characteristic (the Yuan et al 2011 of highly resistance;Wang et al. 2009), it is small to the rice blast of the multiple rice main producing regions in China
Kind all has very high resistance (Hittalmani et al. 2000; Fuentes et al. 2008; Yang et
al.2008; Tacconi et al. 2010；Hua et al. 2012).Pan Qinghua etc. (2012) is although developPik-pFunction
Energy specific molecular marker, but since the SNP marker is using preceding needing to identify K/N type genotype, in fact the genotype exists
Certain incomparability, and qualification process needs the cumbersome work (Zhai et al. 2010) such as digestion identification, is not suitable for
Extensive Resistance Identification and molecular marker assisted selection breeding (MAS) work.Therefore, in order to more acurrate effectively by rice blast
Broad-spectrum resistance genePik-pIt is applied in rice resistance breeding work, it is necessary to the true reflection target gene of exploitation, easy-to-use
'sPik-pSpecial molecular labeling.
Summary of the invention
For overcome the deficiencies in the prior art with disadvantage, the primary purpose of the present invention is that providing a kind of rice blast resistance genePik-pSpecific Function molecular labeling Pik-p-InDel.
Another goal of the invention of the invention is to provide the rice blast resistance genePik-pGene specific molecule mark
Remember the detection method of Pik-p-InDel.
Another goal of the invention of the invention is to provide the rice blast resistance genePik-pGene function specificity point
The application of son label Pik-p-InDel.
To achieve the above object, the present invention adopts the following technical scheme:
A kind of rice blast resistance genePik-pSpecific Function molecular labeling Pik-p-InDel is by primer pair SEQ ID
NO.1 and SEQ ID NO.2 is amplified from oryza sativa genomic dna and rice blast resistance genePik-pIn point of specific banding pattern
Son label；
SEQ ID NO.1:5 '-TGGTTAAATAGGACTCCCTC-3 '；
SEQ ID NO.2:5 '-CATTCGCAGACTCGTTGA-3 '；
The rice varieties for obtaining oryza sativa genomic dna are IRBLKP-K60(Pik-pDonor parents)；
The rice blast resistance genePik-pGenetic fragment I including encoding NBS-LRR albuminoid
SEQ ID NO.3: sequence I:
TGGTTAAATAGGACTCCCTCTATTCCATAATATAAGGCACAACCACTTTTCTTAGATGTTTCATAATATAAGG
CATGCATGCATATAGGCAATTAACTATGACCTCTTTTTTATTAAATTATTATTCATGCTCTCTGATTCTATTGGATG
CATGCATTGTATTTATTAGGATGTTCTAAACTACAAGATAATAATAATTATTTTCTTGGTGTTTGGGTTAGGGGTGG
TTATGACTTATATTTTATAATGGAGGGAGTAGTACAAGTATAATATTAAAGACTTTAATATTATATTAAAGGACGGA
GGAAATATTAGGGAGAAACGGCATGACCACGAGTCAGTCAACGAGTCTGCGAATG
The rice blast resistance genePik-pSpecific Function molecular labeling Pik-p-InDel detection method, comprising with
Lower step:
(1) multiple resistance gene of rice blast are comparedPik-pAllelic sequences, by being downloaded from public database
It obtainsPik-pAnd its it is homologousPik, Pik-m,Pi1WithPik-hGenome sequence and sequencing kind OryzasativaLcv.Nipponbare are corresponding
The genome sequence in region, forPik-pSite carries out sequence alignment, screeningPik-pIt is special, the site can be different from other
Site insertion/deletion (insertion-deletion, InDel) of rice blast resistance allele；
(2) the InDel information obtained using step (1), according to the design principle that InDel is marked, in the InDel site upstream
Gene-specific primer is designed at 233 bp of 126 bp and downstream, primer pair base sequence is as follows:
Fl:5 '-TGGTTAAATAGGACTCCCTC-3 '；
Rl:5 '-CATTCGCAGACTCGTTGA-3 '；
(3) to carry rice blast resistance genePik-pRice blast resistance kind IRBLkp-K60 total DNA be template, into
Row PCR amplification, PCR product obtained are rice blast resistance genePik-pSpecific molecular marker Pik-p-InDel；
The rice blast resistance genePik-pSpecific molecular marker Pik-p-InDel is anti-in identification Rice Blast
Property gene application, particularly suitable for identifyPikThe different Rice Blast resistant gene in gene cluster region；It preferably comprises
Following steps:
(1) it expands: carrying out PCR using genome of the primers F l and Rl to rice varieties to be detected；
(2) it detects；It is detected using polyacrylamide gel electrophoresis, if detecting, molecular size range is the nucleotide piece of 359bp
Section, then carry rice blast resistance genePik-p；If detecting, molecular size range is the nucleotide fragments of 378bp, to be detected
Rice varieties carry the non-rice blast resistance gene in the sitePik-pOther functional genes；If the nucleosides not detected
Acid fragment, then rice varieties to be detected do not carryPikThe functional gene in site.
The principle of the present invention: InDel refers to the same site of genome between sibling species or same species Different Individual
The insertion or missing of different size nucleotide fragments has occurred in sequence, i.e. another homologous is compared in a certain site in a sequence
One or more bases (Weber et al, 2002) is inserted into or has been lacked to sequence.InDel marks based on PCR amplification technique, this
Belong to length polymorphism label (Hyten et al, 2010) in matter.InDel label stability is good, polymorphism is high, classification system
Simply (Jander et al, 2002)；Compared with the SNP marker of classification system complexity, InDel detection is simpler convenient, right
Instrument and equipment and technical requirements are lower, can carry out on electrophoretic techniques platform.Start to be applied to animals and plants group something lost at present
Pass the fields such as analysis, marker assisted selection and mankind's medicolegal genetics, medical diagnosis.The side that the present invention passes through Multiple Sequence Alignment
Method is foundPik-pThe InDel occurred in gene order, since this InDel existsPik-pWithPikOther functional genes have
The difference of 19bp, in OryzasativaLcv.Nipponbare do not contain the site, therefore be easy to byPik-pTherefrom distinguish.The present invention is set accordingly
Primer pair F1/R1 is counted, by standard PCR amplification, in polyacrylamide gel electrophoresis detection, segment in different sizes is able to
It presents.
The present invention has the following advantages and effects with respect to the prior art:
(1) molecular labeling specificity provided by the invention is high:Pik-pThere is include for the genome area at placePik-pInside
5 resistant gene expression characteristics candidate gene, they are each, and there are two locus to form, these candidate genes are high in sequence
Spend homologous (Zhai et al. 2010)；In addition,Pik-p1With the rice blast resistance gene for having cloned acquisition on the sitePikm-1, Pik-1WithPik-s-1, Pik-p-2WithPikm-2, Pik-2WithPik-s-2In sequence on amino acid levels
There is very high consistency (Hua et al. 2012).Molecular labeling provided by the invention is inventor by continuous
Progress sequence polymorphism seeking and obtained by experimental verification, can significantly byPik-pBe present in the genome area
It is interior withPik-pThe paralog gene of very high homology distinguishes；Also it can successfully distinguishPik-m, Pik, Pik-hWithPik-s
With other non-functional homologous genes.
(2) in practical applications, low cost, high throughput: being to utilize electrophoresis mostly at present to molecular labeling provided by the invention
Platform carries out parting, and the parting platform is fast economical, does not need complicated experimental facilities, strong operability.Electropherotyping platform
There are agarose gel electrophoresis, denaturation or native polyacrylamide gel electrophoresis and Capillary Electrophoresis.Provided by the invention point
Son label only needs PCR combination agarose gel electrophoresis or native polyacrylamide gel electrophoresis, at low cost, flux is high, adds
Specific high (i.e. accuracy is high), especially suitable in production practices.
(3) present invention is first and is directed toPik-pGene internal sequence is developedPik-pGene specific InDel mark
Note.The present invention can successfully will by the method for electrophoresis detectionPik-pWith the other rice blast resistance bases being located on the site
Because (Pikm, Pik,PikhWithPiks) distinguish, up to the present, there are no the reports in relation to this kind of label.The present invention is mentioned
It suppliesPik-pSpecific molecular marker Pik-p-InDel is a codominant marker, in actual application its reliability and
Accuracy is better than dominant marker.Present invention can apply toPik-pScreening of Germplasm, transgenosis identification and gene pyramiding and
In rice resistance breeding work based on MAS technology.The label is present inPik-pGene internal, thus it is rightPik-pScreening energy
Power theoretical value up to 100%, comprehensive performance better than it is reported withPik-pChain molecular labeling and functional label.
(4) molecular labeling provided by the invention can easily be applied in the different group of genetic background.It is existing withPik-pThe most of sequence polymorphism both for 2 different parents of the same group of chain molecular labeling is developed, this
Applicability of a little labels in other groups is limited.The functional label of the exploitations such as Pan et al (2012), due to qualification process ratio
It is cumbersome, it is not suitable in large-scale germplasm identification and MAS breeding.The present invention is suitable for turning under any genetic background
Gene breeding, gene pyramiding and the resistance breeding based on MAS technology, without repeating the screening of parent's polymorphism, significantly
Improve breeding efficiency.
Therefore, rice blast resistance gene provided by the present inventionPik-pGene specific molecular labeling has important answer
With value, the gene can be improved using this label and educated in Screening of Germplasm, molecular marker assisted selection breeding, gene pyramiding
The efficiency utilized in kind and transgenic breeding.
Detailed description of the invention
Fig. 1 isPik-pGene specific molecular labeling Pik-p-InDel existsPikGene cluster region difference rice blast resistance
The verification result figure of gene and OryzasativaLcv.Nipponbare, in which: swimming lane M is DNA Marker, and the DNA profiling of swimming lane 16 is followed successively by resistance product
Kind IRBLkp-K60 (Pik-p), susceptible variety OryzasativaLcv.Nipponbare (Nip), resistant variety IRBLk-Ka (Pik), resistant variety
IRBLkm-Ts (Pik-m), resistant variety IRBLkh-K3 (Pik-h) and resistant variety IRBLks-S (Pik-s)。
Fig. 2 isPik-pVerification result figure of the gene specific molecular labeling Pik-p-InDel in other rice varieties,
Wherein: M:DNA Marker；1 72 DNA profiling be followed successively by resistant gene donor kind IRBLkp-K60 (Pik-p), Hunan it is early
Xian 45, middle morning 23,618B, preferably perfume 1B, fragrance of a flower B, II-32B, the rich B of 629B, 2155, five, the rich B of luxuriant growth, the rich B of peace, Long Tepu B, gold
Anti- 1B, safe rich B, soft rice paddy, IR88988B, spend wide anti-13B, Zhenshan 97B, R527, perfume B, D702B, Bobai B, depth 95B,
The rich B in Guangdong, good fortune her B, 710S, SE21S, Fujian 2B, southern exposure No.1 B, dawn B, Jin Nante 43B, excellent 1B, high mountain 4B, D62B, ridge 46B,
Feng Yuan B, D702B, bright extensive 86, R1128, no loadtransformer, Hunan morning Xian 7, in extensive 8015, silver account for, extensively surpass 128, it is small account for, Huang Huazhan,
Fujian is extensive 3301, Guanglu ai 4, special number of south, osmanthus towards in No. 2, platform carry out 1, ten thousand benefit Xian, short son accounts for, 29 No. 1 southern, extensive 29, short-foot
Nan Te, it is bright extensive 63, IR661-1, high temperature resistant R-1, Gui 630, short a small bay in a river paddy 151, Hunan evening Xian 1, Dongting Lake evening Xian, raise rice No. 2, middle peasant
No. 4, it is wide extensive 128, special green choosing, survey 64 and evening 3.
Fig. 3 difference rice varieties Multiple Sequence Alignment result figure: the Rice Resistance To Rice Blast with gene specific InDel
Gene kind,Pik-p: resistant variety IRBLkp-K60；Pik: resistant variety IRBLk-Ka；Pik-m: resistant variety IRBLkm-
Ts；Pik-h: resistant variety IRBLkh-K3；Pik-s: resistant variety IRBLks-S.
Specific embodiment
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited
In this.
Embodiment 1: rice blast resistance genePik-pThe design of specific Function molecular marker and primer thereof and detection
(1) Pik-pThe analysis in the site insertion/deletion (insertion-deletion, InDel):
Downloading obtains rice Representative Cultivars from public databasePik-pGene and its homologousPik, Pik-m,Pi1WithPik-hGenome sequence and the genome sequence that kind OryzasativaLcv.Nipponbare and 9311 corresponding regions is sequenced, forPik-pSite into
Row sequence alignment, screeningPik-pIt is special, the site can be different from, the specificity insertions of other rice blast resistance alleles/
Lack (InDel) difference site.Kind OryzasativaLcv.Nipponbare (Nipponbare) and 9311 genome sequences without corresponding region are sequenced,
With gene specific InDel resistance gene of rice blast kind IRBLkp-K60 (Pik-p) and resistant variety IRBLk-
Ka (Pik), resistant variety IRBLkm-Ts (Pik-m), resistant variety IRBLkh-K3 (Pik-h) and resistant variety IRBLks-
S (Pik-s) Multiple Sequence Alignment result figure 3 shown in: where multiple "-" are to identifyPik-pGene specific missing
Sequence；
(2) design primer:
According to the design principle that InDel is marked, designs at the site InDel and draw at 233 bp of 126 bp of upstream and downstream
Object, primer pair base sequence are as follows:
Fl:5 '-TGGTTAAATAGGACTCCCTC-3 '；
Rl:5 '-CATTCGCAGACTCGTTGA-3 '.
(3) select rice Representative Cultivars: selection carriesPik-pGene andPikThe representative product of gene cluster allele
Kind is as follows:
Rice varieties IRBLkp-K60 isPik-pDonor kind (Fukuta et al. 2004) is positive control；
Rice varieties IRBLk-Ka isPikDonor kind (Fukuta et al. 2004)；
Rice varieties IRBLkm-Ts isPik-mDonor kind (Fukuta et al. 2004)；
Rice varieties IRBLkh-K3 isPik-hDonor kind (Fukuta et al. 2004)；
Rice varieties IRBLks-S isPik-sDonor kind (Fukuta et al. 2004)；
Susceptible check variety: OryzasativaLcv.Nipponbare, OryzasativaLcv.Nipponbare are a kinds of Japanese breeding, national rice data center (http: //
Www.ricedata.cn/variety/varis/602979.htm relevant information can) be obtained.
(4) PCR amplification is containedPik-pThe segment of gene specific InDel
Using above-mentioned primer pair Fl and R1, using the total DNA of above-mentioned rice varieties as template, gathered after carrying out standard PCR amplification
Acrylamide gel electrophoresis detection, obtained result are as shown in Figure 1.
Amplification reaction system is as follows:
2×Mix buffer(Mg2+Plus): 12.5 μ l
Primers F l (10 μ Μ): 1 μ l
Primer Rl (10 μ Μ))；1μl
Taqase (5U/ml): 0.2 μ l
DNA template (20-50ng/ μ l): 1 μ l
ddH2O: 25 μ l are complemented to.
PCR Thermal cycling conditions are as follows: 94 °C 3 minutes；94 °C 30 seconds, 58 °C 30 seconds, 72 °C 30 seconds, 35 are followed
Ring；72 °C 7 minutes；10 °C of preservations.
PCR after reaction, takes appropriate amount of sample to carry out electrophoresis detection on 8% polyacrylamide gel, and deposition condition is
90V, 1 hour.
Wherein, the swimming lane mark 1 of Fig. 1 isPik-pDonor kind rice varieties IRBLkp-K60 genomic DNA is template
The segment of PCR, with rice blast resistance genePik-pIn specific banding pattern, asPik-pGene specific molecular labeling Pik-p-
InDel.Fig. 1's the results show that Pik-p gene specific molecular labeling can distinguish anti-sense allele and distinguishPikPosition
The other resistant genes identified on point.That is, all carryPik-pRice varieties, pcr amplification product
Electrophoresis detection band is presented with 359bp,PikThe other rice blast resistance genes positioned on site are with electrophoresis detection band
378bp is presented, and the functional gene without containing the site without band or other banding patterns to present.
Embodiment 2: resistant genePik-pGene specific molecular labeling is identifyingPikGene cluster region difference rice blast
The application of resistant gene.
It, can be containing target gene according to the PCR product band of polymorphismPik-pWith it is otherPikIt is anti-in gene cluster
Property gene distinguishes.As shown in Figure 1, can be incited somebody to action according to pillar locationPik-pThe other resistance bases identified with the site
Because distinguishing, 359bp expression containsPik-pGene, 378bp are then indicated containing resistant gene site, other banding patterns or without band
Then indicate the functional gene without containing the site.It can be seen that test result matches with what design was analyzed, illustrate resistant genePik-p
Gene specific molecular labeling can identifyPik-pGene withPikGene cluster allele etc. is applied.
Embodiment 3: resistant genePik-pDetection application of the gene specific molecular labeling in other rice varieties
72 representative kinds in 1 corresponding diagram 2 of table
Its genomic DNA is extracted respectively, and as template, according to the method for embodiment 1, carry out PCR amplification and electrophoresis detection.
It, can be resistant gene according to the size of product (band)Pik-pIt is distinguished with other rice blast resistance genes.Such as Fig. 2 institute
Show, is in anti-stave typePik-pThe individual of type (carries rice blast resistance genePik-pDisease-resistant variety IRBLkp-K60, swimming
Pik-p-InDel gene-specific fragment can be detected in the sample in road 11,16 and 62, and the individual of other anti-stave types is then
It cannot detect the molecular labeling.As it can be seen that test result matches with what design was analyzed, illustrate resistant genePik-pSpecificity
Molecular labeling can identifyPik-pGene and other rice blast resistance genes, includingPikGene cluster allele etc. obtains
Using.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Fujian Province Agriculture Science Academy, Institute of Biotechnology
University Of Agriculture and Forestry In Fujian
<120>a kind of rice blast resistance gene Pik-p specific Function molecular labeling and its application
<130> 3
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>artificial sequence
<400> 1
tggttaaata ggactccctc 20
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
cattcgcaga ctcgttga 18
<210> 3
<211> 359
<212> DNA
<213>artificial sequence
<400> 3
tggttaaata ggactccctc tattccataa tataaggcac aaccactttt cttagatgtt 60
tcataatata aggcatgcat gcatataggc aattaactat gacctctttt ttattaaatt 120
attattcatg ctctctgatt ctattggatg catgcattgt atttattagg atgttctaaa 180
ctacaagata ataataatta ttttcttggt gtttgggtta ggggtggtta tgacttatat 240
tttataatgg agggagtagt acaagtataa tattaaagac tttaatatta tattaaagga 300
cggaggaaat attagggaga aacggcatga ccacgagtca gtcaacgagt ctgcgaatg 359
Claims (6)
1. a kind of rice blast resistance genePik-pSpecific Function molecular labeling, it is characterised in that: molecular labeling primer is to sequence
For SEQ ID NO.1:5 '-TGGTTAAATAGGACTCCCTC-3 '；SEQ ID NO.2:5 '-CATTCGCAG
ACTCGTTGA-3’。
2. a kind of rice blast resistance gene according to claim 1Pik-pSpecific Function molecular labeling, feature exist
In: it is to be amplified from oryza sativa genomic dna and rice blast resistance base by primer pair SEQ ID NO.1 and SEQ ID NO.2
CausePik-pIn the molecular labeling of specific banding pattern.
3. a kind of rice blast resistance gene according to claim 1Pik-pSpecific Function molecular labeling, feature exist
In: the rice blast resistance genePik-pGenetic fragment I, I sequence such as SEQ ID including encoding NBS-LRR albuminoid
Shown in NO.3.
4. a kind of rice blast resistance gene as described in claim 1Pik-pThe detection method of specific Function molecular labeling,
It is characterized in that comprising the steps of:
(1) multiple resistance gene of rice blast are comparedPik-pAllelic sequences, by being downloaded from public database
It obtainsPik-pAnd its it is homologousPik, Pik-m,Pi1WithPik-hGenome sequence and sequencing kind OryzasativaLcv.Nipponbare are corresponding
The genome sequence in region, forPik-pSite carries out sequence alignment, screeningPik-pIt is special, the site can be different from other
The site insertion/deletion InDel of rice blast resistance allele；
(2) the InDel information obtained using step (1), according to the design principle that InDel is marked, at the site InDel
Gene-specific primer is designed at 233 bp of 126 bp of upstream and downstream, primer pair base sequence is as follows:
Fl:5 '-TGGTTAAATAGGACTCCCTC -3 '；
Rl:5 '-CATTCGCAGACTCGTTGA -3 '；
(3) to carry rice blast resistance genePik-pRice blast resistance kind IRBLKP-K60 total DNA be template, into
Row PCR amplification, PCR product obtained are rice blast resistance genePik-pSpecific molecular markerPik-p-InDel。
5. rice blast resistance gene as described in claim 1Pik-pSpecific Function molecular labeling is identifying rice varieties rice
Application in seasonal febrile diseases resistant gene.
6. rice blast resistance gene according to claim 5Pik-pSpecific Function molecular labeling is identifyingPikGene
Application in the different Rice Blast resistant gene in cluster region.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810961795.0A CN108977568B (en) | 2018-08-22 | 2018-08-22 | Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810961795.0A CN108977568B (en) | 2018-08-22 | 2018-08-22 | Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108977568A true CN108977568A (en) | 2018-12-11 |
| CN108977568B CN108977568B (en) | 2021-11-09 |
Family
ID=64547351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810961795.0A Active CN108977568B (en) | 2018-08-22 | 2018-08-22 | Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108977568B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN116640774A (en) * | 2023-06-14 | 2023-08-25 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102041262A (en) * | 2009-10-22 | 2011-05-04 | 华南农业大学 | Rice blast resistance gene Pik-p and application thereof |
| CN106701749A (en) * | 2017-02-24 | 2017-05-24 | 淮阴师范学院 | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof |
| CN107937600A (en) * | 2018-01-19 | 2018-04-20 | 福建省农业科学院生物技术研究所 | A kind of rice blast resistance gene seat Pik functional genes molecular labeling and its application |
-
2018
- 2018-08-22 CN CN201810961795.0A patent/CN108977568B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102041262A (en) * | 2009-10-22 | 2011-05-04 | 华南农业大学 | Rice blast resistance gene Pik-p and application thereof |
| CN106701749A (en) * | 2017-02-24 | 2017-05-24 | 淮阴师范学院 | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof |
| CN107937600A (en) * | 2018-01-19 | 2018-04-20 | 福建省农业科学院生物技术研究所 | A kind of rice blast resistance gene seat Pik functional genes molecular labeling and its application |
Non-Patent Citations (3)
| Title |
|---|
| BIN YUAN: "The Pik-p resistance to magnaporthe oryzae in rice is mediated by a pair of closely linkedCC-NBS-LRR genes", 《THEORETICAL AND APPLIED GENETICS》 * |
| HAYASHI K等: "development of PCR-based allele-specific and InDel markers sets for nine rice blast resistance genes", 《THEORETICAL AND APPLIED GENETICS》 * |
| 梁廷敏等: "水稻材料IR65482抗稻瘟病基因鉴定与定位", 《分子植物育种》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113744800A (en) * | 2021-06-09 | 2021-12-03 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family |
| CN116640774A (en) * | 2023-06-14 | 2023-08-25 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
| CN116640774B (en) * | 2023-06-14 | 2024-02-09 | 江苏省农业科学院 | Rice blast resistance gene Pik-W25 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108977568B (en) | 2021-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN105950743B (en) | A kind of rice blast resistance gene Pi9 specific Function molecular labeling and its application | |
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN112981001B (en) | Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN105838812B (en) | The SSR molecular marker isolated with cucumber powdery mildew resistance main effect QTL | |
| CN108411028A (en) | Special SNP codominant markers primer and application in Rice Salt gene SKC1 genes | |
| CN106148510B (en) | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application | |
| CN107988419A (en) | A kind of rice blast resistance gene Pigm specific Functions molecular labeling and its application | |
| CN108977568A (en) | A kind of rice blast resistance gene Pik-p specific Function molecular labeling and its application | |
| CN110499389A (en) | With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco | |
| CN108456740B (en) | Rice blast resistance site 'Pi-jx', Indel marker primer and breeding application thereof | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN108913809A (en) | InDel molecular marked compound, detection method and the application of blast resistant gene Pid3-A4 | |
| CN110257546B (en) | New salt-tolerant gene cluster qST12 in rice seedling stage Pokkali And applications | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN104711254B (en) | The low-phosphorous responsive genes ZmARF31 of corn INDEL molecular labelings and its application | |
| CN110499390A (en) | Molecular labeling primer, the method and its application of assisted Selection for the anti-spotted wilt RTSW gene-assisted selection of tobacco | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN107916300A (en) | A kind of rice blast resistance gene seat Pi2/9 functional genes molecular labeling and its application | |
| CN113046464B (en) | Molecular marker for screening soybean material, screening method, breeding method and application | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |