CN106148510B - Resistance gene of rice blast Pi5 specific Function molecular labeling and its application - Google Patents
Resistance gene of rice blast Pi5 specific Function molecular labeling and its application Download PDFInfo
- Publication number
- CN106148510B CN106148510B CN201610431981.4A CN201610431981A CN106148510B CN 106148510 B CN106148510 B CN 106148510B CN 201610431981 A CN201610431981 A CN 201610431981A CN 106148510 B CN106148510 B CN 106148510B
- Authority
- CN
- China
- Prior art keywords
- gene
- rice blast
- rice
- molecular labeling
- resistance gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Resistance gene of rice blast Pi5 specific Function molecular labeling and its application are named as Pi5InDel, and nucleic acid sequence is as shown in SEQ ID NO.1.Rice blast resistance gene Pi5 gene specific molecular labeling specificity provided by the present invention is high；Low cost, high throughput in practical applications；It can be widely used in the different group of genetic background to screen the rice germplasm containing rice blast resistance gene Pi.The efficiency that the gene utilizes in molecular marker assisted selection breeding, gene pyramiding breeding and transgenic breeding can be improved using the molecular labeling.
Description
Technical field
The present invention relates to agricultural biological technical fields, more particularly to rice blast technical field, in particular to a kind of rice blast
Sick resistant gene Pi5 specific Function molecular labeling and its application.
Background technique
Rice is one of most important cereal crops in the world, every year because caused by rice blast economic loss reach billions of beauty
First (Zheng Zhao etc., 2009).China rice main producing region nearly all by the harm of rice blast, year onset area it is public to 330-570 ten thousand
Hectare, lose several hundred million kilograms of paddy.From the perspective of grain security and Genetic and breeding in rice, cultivating disease-resistant variety is prevention and treatment rice blast
One of most economical effective method of disease.But since rice blast biological strain pathogenicity variation is fast, the resistance meeting of single resistant variety
Gradually lose (abundant etc., 2011)；And the features such as traditional resistant breeding strategy is there are heavy workload, and the period is long.Therefore, compel
The strategy of traditional breeding for disease resistance will be changed by being essential.Based on molecular marker assisted selection (Marker-associated
Selection, MAS) the disease-resistant molecular breeding of technology has to the selection of objective trait not by gene expression and environmental condition shadow
Ring, can any stage of plant strain growth carry out, can segregating generation rapidly and accurately identify plant genotype, can also effectively
The advantages that overcoming the Linkage drag of target gene and unfavorable gene, has been used in the resistance breeding field of rice blast.However
It is possible to the limitation by genetic background in application process with the molecular labeling of target gene close linkage, in different groups
It is middle the polymorphism of parent to be detected；In addition, the molecular labeling for having certain distance with target gene is remained because of dye
A possibility that colour solid occurs exchange and loses target gene, this to will appear wrong choosing or leakage in target gene qualification process
The case where selecting (Hayashi et al., 2006；Ingvardsen et al., 2008).However, being based on gene internal sequence institute
The gene specific molecular labeling of exploitation can be such that the above problem is effectively solved, and imitate to improve utilizing for resistant gene
Rate facilitates the development of rice blast resistance breeding.
Pi5 is the wide spectrum blast resistant gene (Jeon etc., 1994) being positioned on the 9th chromosome, sequencing discovery Pi5-1 and
Pi5-2 has 5 and 6 exons respectively.The rice blast resistance that Pi5 is mediated needs while having the two genes, resistant gene Pi5
The rice blast resistance of wide spectrum shown makes it have great application value in rice blast resistance breeding work.But Pi5
Distribution situation in China's Rice Germplasm Resources and kind remains unknown, and constrains the resistant gene answering in breeding extensively
With.Effectively rice blast broad-spectrum resistance gene Pi5 is applied in rice resistance breeding work in order to more acurrate, it is necessary to
The gene internal of resistant gene Pi5 develops the special InDel molecular labeling of Ρ i5, and this gene specific molecular labeling can be right
The accuracy rate theoretical value of target gene screening is up to 100%.
Summary of the invention
The technical issues of solution: in order to which rice blast resistance gene Pi5 faster, is more effectively applied to resistance breeding
In, the present invention provides a kind of rice blast resistance gene Pi5 gene specific molecular labeling Pi5InDel and its application.The molecule mark
Remember that difference (Insertion-deletion, InDel) research of the Pi5InDel based on gene order insertion and deletion obtains, can mention
Utilization efficiency of the high gene in molecular marker assisted selection breeding, gene pyramiding breeding and transgenic breeding.
Technical solution: resistance gene of rice blast Pi5 specific Function molecular labeling is named as Pi5InDel, nucleic acid
Sequence is as shown in SEQ ID NO.1.
The above-mentioned rice blast resistance kind for carrying rice blast resistance gene Pi5 is resistant rice cultivars IRBL5-M.
Above-mentioned molecular labeling is identifying the application in Rice Blast resistant gene.
Above-mentioned application comprises the following steps: (1) expanding: using primers F l and Rl to the genome of rice varieties to be detected
Carry out PCR；(2) detect: molecular size range is the nucleotide fragments of 93bp, then rice varieties to be detected carry rice blast
Resistant gene Pi5；If not detecting, molecular size range is the nucleotide fragments of 93bp, and rice varieties to be detected are not taken
With rice blast resistance gene Pi5.
For expanding the primer pair of the molecular labeling, nucleic acid sequence is as follows:
SEQ ID NO.2:Fl:5 '-GTTTCGAGATAGTGCTAA-3 '；
SEQ ID NO.3:Rl:5 '-GAATGACAGTAATAGAAA-3 '.
A kind of kit identifying Rice Blast resistant gene, containing nucleic acid sequence as shown in SEQ ID NO.1
Pi5InDel, and the primer pair as described in SEQ ID NO.2 and SEQ ID NO.3.
The principle of the present invention: insertion/deletion (insertion-deletion, InDel) marks based on PCR amplification technique,
Because its stability is good, polymorphism is high, classification system is simple, start to be applied to the genetic analysis of animals and plants group, marker assisted selection
And the fields such as medical diagnosis.The present invention finds the InDel occurred inside Pi5 gene order by the method for Multiple Sequence Alignment,
The upstream and downstream design primer in site carries out standard PCR amplification with it to F1/R1 accordingly, and the amplification for carrying Pi5 rice varieties produces
Object molecular size range is 93bp, in polyacrylamide gel electrophoresis of the presently claimed invention detection, carries Pi5 rice varieties
Digestion products molecular weight is 93bp, and the digestion products molecular weight without the rice varieties of carrying Pi5 is presented with 95bp or without band.
The utility model has the advantages that (1) molecular labeling specificity provided by the invention is high: there is function for the genome area where Pi5
The energy non-characteristic segment of nand function gene occurs using the result that existing Marker Identification has many false positives.The present invention mentions
The molecular labeling of confession and is obtained by experimental verification by constantly carrying out sequence polymorphism seeking, can significantly by Pi5
It is distinguished with the paralog gene for being present in the genome area with Pi5 very high homology.
(2) molecular labeling provided by the invention is inexpensive in practical applications, high-throughput: currently, InDel marks detection side
Formula is simple and convenient, lower to instrument and equipment and technical requirements, can carry out on electrophoretic techniques platform.It is provided by the invention
The amplified production banding pattern of InDel molecular labeling is clearly simple, and stability and product separating effect are preferable；Due to amplified production compared with
It is short, it is lower to DNA quality requirement, and DNA that is less, or even can expanding height degradation is required to sample size, especially suitable for life
It produces in practice.
(3) present invention is first Pi5 gene specific InDel label developed for Pi5 gene internal sequence.This
Invention successfully can be distinguished Pi5 with the other non-Pi5 genes being located on the site with the method for electrophoresis detection.To current
Until, there are no the reports in relation to this kind of label.Pi5 specific molecular marker Pi5InDel provided by the present invention is one total
Dominant marker, its reliability and accuracy are better than dominant marker in actual application.Present invention can apply to germ plasm resources
Analysis, the identification of Pi5 transgenosis, gene pyramiding (the especially polymerization of the allele of sequence very high homology), and it is based on MAS skill
In the rice resistance breeding work of art.The label is present in Pi5 gene internal, therefore reachable to the screening capacity theoretical value of Pi5
100%, such screening capacity is better than reported and Pi5 chain molecular labeling.
(4) molecular labeling provided by the invention can be widely used in the different group of genetic background.It is existing to connect with Pi5
The most of sequence polymorphism both for 2 different parents of the same group of the molecular labeling of lock is developed, these labels
Applicability in other groups is limited.The present invention be suitable for any genetic background under germplasms evaluation, transgenic breeding,
Gene pyramiding and resistance breeding based on MAS technology substantially increase breeding without repeating the screening of parent's polymorphism
Efficiency.
Therefore, rice blast resistance gene Pi5 gene specific molecular labeling provided by the present invention has important application
Value can be improved the gene using this label and educate in molecular marker assisted selection breeding, gene pyramiding breeding and transgenosis
The efficiency utilized in kind.
Detailed description of the invention
Fig. 1 is amplification situation of the JJ813 label in 12 parts of representative kinds, in which: swimming lane M is DNA ladder, swimming
The DNA profiling in road 2~12 be followed successively by resistant variety IRBL5-M (Pi5), it is middle spend 16, Guangdong open country to account for, spend glutinous, the rich B in day of section, is bright extensive 63,
OryzasativaLcv.Nipponbare, 9311, Gui Chao 2, even round-grained rice 7, II-32A, extensively account for 63s.
Fig. 2 is the contrast verification figure of Pi5 gene specific molecular labeling Pi5SNP and JJ813.
Specific embodiment
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited
In this.
Embodiment 1: the design of rice blast resistance gene Pi5 gene specific molecular marker and primer thereof and detection
(1) analysis in the site Pi5 insertion/deletion (insertion-deletion, InDel):
Downloading obtains having disclosed Pi5 genome sequence (the Genebank indexed number difference delivered from public database
Are as follows: EU869185, EU869186), be designed primer for the site Pi5, screening Pi5 it is special, the site can be different from its
Insertion/deletion (InDel) the difference site of his rice blast resistance allele.Rice rice blast with gene specific InDel
Sick resistant gene Pi5 and other sequence alignment results wide in variety containing non-Pi5 functional gene are as follows, wherein two of missing
Base portion is Pi5 gene insertion/deletion (InDel) the difference site identified.
IRBL5-M:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTT--CTATTACTGTCAT TCATGTGACTCA
TTTTGTTTTTTAG
Zegu:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTT--CTATTACTGTCATTCA TGTGACTCATTT
TGTTTTTTAG
Lianjing 7hao:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTT--CTATTACTGTCATTCA TGT
GACTCATTTTGTTTTTTAG
Lianjing11hao:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTT--CTATTAC TGTCATTCATGT
GACTCATTTTGTTTTTTAG
Yueyezhan:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTC ATTCATGTGACT
CATTTTGTTTTTTAG
Zhonghua16:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGT CATTCATGTGAC
TCATTTTGTTTTTTAG
Guicao 2hao:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTCATTCA TGTGA
CTCATTTTGTTTTTTAG
Jiayu 948:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTCATTCAT GTGACT
CATTTTGTTTTTTAG
Huanjienuo:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGT CATTCATGTGAC
TCATTTTGTTTTTTAG
Yuxian 7hao:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTCATTCA TGTGA
CTCATTTTGTTTTTTAG
Fengxinzhan:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTG TCATTCATGTGA
CTCATTTTGTTTTTTAG
Yixiang 1B:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTCATTCATG TGAC
TCATTTTGTTTTTTAG
Minghui63:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTC ATTCATGTGACT
CATTTTGTTTTTTAG
Zinuo:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTCATTC ATGTGACTCATT
TTGTTTTTTAG
Minghui81:TATATTTTTCTGTCCCTTAAAATAGTTTTTTTTTTCTATTACTGTC ATTCATGTGACT
CATTTTGTTTTTTAG
(2) design primer:
According to the design principle that InDel is marked, upstream and downstream design primer at the site InDel, primer pair base
Sequence is as follows:
F1:5 '-GTTTCGAGATAGTGCTAA-3 '；
R1:5 '-GAATGACAGTAATAGAAA-3 '.
(3) PCR amplification obtains the segment containing Pi5 gene specific InDel
Using above-mentioned primer pair F1 and R1, plant base (is extracted using CTAB method with the total DNA of 12 above-mentioned rice varieties
Because a group DNA is obtained) it is template, standard PCR amplification is carried out, amplified production is connected to after the detection of 1% agarose gel electrophoresis
On Pmd18-T Vector, the confirmation of PCR method is chosen containing insertion target fragment and be sequenced (your limited public affairs of science and technology of the silent winged generation of match
Department).
Pcr amplification reaction system is as follows:
2x Reaction Mix:12.5 μ L
Primers F 1 (10 μM): 1 μ L
Primer R1 (10 μM): 1 μ L
Golden DNA polymerase:0.4 μ L
DNA profiling (20-50ng/ μ L): 1 μ L
ddH2O: 25 μ L are complemented to.
PCR Thermal cycling conditions are as follows: 94 DEG C 3 minutes；94 DEG C 30 seconds, 58 DEG C 30 seconds, 72 DEG C 30 seconds, 35 circulation；72
DEG C 5 minutes；10 DEG C of preservations.
PCR after reaction, takes appropriate digestion sample to carry out electrophoresis detection, deposition condition on 1% Ago-Gel
For 90V, 20 minutes, kits.
(4) PCR product connection, sequencing
1) following DNA solution is prepared in microcentrifugal tubeFull dose is 5 μ L.
18-T Vector*1 1μL
4 μ L of purified pcr product
2) the Solution I of 5 μ L equivalent is added.
3) it reacts 30 minutes for 16 DEG C.
4) 10 μ L of full dose is added into 100 μ L JM109 competent cells, places 30 minutes in ice.
5) 42 DEG C heating 45 seconds afterIt is placed 1 minute in ice again.
6) be added 890 μ L SOC culture mediums, 37 DEG C shaken cultivation 60 minutes.
7) it is cultivated on the L- Agar Plating containing Amp, forms single colonie.
8) white colony is selected, the length scale of Insert Fragment in PCR method confirmation carrier is used.
Embodiment 2: resistant gene Pi5 gene specific molecular labeling is in the application for identifying Pi5 gene.
According to the PCR product band of polymorphism, can be distinguished target gene Pi5 is contained.Fig. 1 is to utilize to have developed
Label JJ801 to the amplification situations of 12 representative kinds, according to the foundation of the Marker Identification, IRBL5-M (Pi5), middle flower
16, it is all positive banding pattern that Guangdong open country, which accounts for, spends section glutinous, bright extensive 63, Gui Chao 2 and round-grained rice 7,.Fig. 2's the results show that Pi5 gene is special
Opposite molecule label can distinguish the allele not comprising the site and distinguish the allele comprising the site.Also
It is to say, all rice varieties for carrying Pi5, electrophoresis detection band is presented with 93bp, and other equipotential bases on the site
Because being presented with 95bp, not comprising the site to be presented without band.It can be seen that test result relatively before label accuracy be improved,
Illustrate that resistant gene Pi5 gene specific molecular labeling is applied in terms of identifying Pi5 gene.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Huaiyin Normal College
Jiangsu Province Agriculture Science Institute
<120>resistance gene of rice blast Pi5 specific Function molecular labeling and its application
<130>
<160> 18
<170> PatentIn version 3.3
<210> 1
<211> 93
<212> DNA
<213>artificial sequence
<400> 1
gtttcgagat agtgctaata taaattggca tgaatagtaa taatatattt ttctgtccct 60
taaaatagtt ttttttttct attactgtca ttc 93
<210> 2
<211> 18
<212> DNA
<213>artificial sequence
<400> 2
gtttcgagat agtgctaa 18
<210> 3
<211> 18
<212> DNA
<213>artificial sequence
<400> 3
gaatgacagt aatagaaa 18
Claims (5)
1. resistance gene of rice blast Pi5 specific Function molecular labeling, it is characterised in that be named as Pi5InDel, nucleic acid sequence
Column are as shown in SEQ ID NO.1.
2. resistance gene of rice blast Pi5 specific Function molecular labeling according to claim 1, it is characterised in that carry
The rice blast resistance kind for having rice blast resistance gene Pi5 is resistant rice cultivars IRBL5-M.
3. molecular labeling described in claim 1 is identifying the application in Rice Blast resistant gene Pi5.
4. application according to claim 3, characterized by comprising the steps of: (1) expand: using such as SEQ ID
Rl shown in primers F l and SEQ ID NO.3 shown in NO.2 carries out PCR to the genome of rice varieties to be detected；(2) it examines
Survey: molecular size range is the nucleotide fragments of 93bp, then rice varieties to be detected carry rice blast resistance gene Pi5;
If not detecting, molecular size range is the nucleotide fragments of 93bp, and it is anti-that rice varieties to be detected do not carry rice blast
Property gene Pi5.
5. a kind of kit for identifying Rice Blast resistant gene, it is characterised in that nucleic acid sequence such as SEQ ID NO.1
Shown in Pi5InDel, and the primer pair as shown in SEQ ID NO.2 and SEQ ID NO.3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610431981.4A CN106148510B (en) | 2016-06-16 | 2016-06-16 | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610431981.4A CN106148510B (en) | 2016-06-16 | 2016-06-16 | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106148510A CN106148510A (en) | 2016-11-23 |
| CN106148510B true CN106148510B (en) | 2019-07-12 |
Family
ID=57353323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610431981.4A Active CN106148510B (en) | 2016-06-16 | 2016-06-16 | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106148510B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106701749A (en) * | 2017-02-24 | 2017-05-24 | 淮阴师范学院 | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof |
| CN107164547B (en) * | 2017-07-19 | 2020-05-26 | 安徽丰大种业股份有限公司 | Molecular marker closely linked with rice blast resistance gene, primer and application thereof |
| CN108998564B (en) * | 2018-09-25 | 2021-05-07 | 湖南杂交水稻研究中心 | InDel molecular marker of rice blast resistance gene Pid3, detection method and application |
| CN112501339B (en) * | 2020-12-11 | 2023-06-27 | 华智生物技术有限公司 | SNP molecular marker of rice blast resistance gene Pi5 and application thereof |
| CN113151540B (en) * | 2021-03-15 | 2023-08-11 | 淮阴师范学院 | Specific molecular marker of rice nuclear male sterile gene OsNP1 genotype and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146695A (en) * | 2013-03-01 | 2013-06-12 | 福建省农业科学院生物技术研究所 | Functional molecular marker for rice anti-blast gene Pi9 and application thereof |
| CN103215370A (en) * | 2013-05-08 | 2013-07-24 | 辽宁省农业科学院 | Method for detecting rice blast-resistant gene pi5 |
| CN104630364A (en) * | 2015-02-05 | 2015-05-20 | 中国科学院遗传与发育生物学研究所 | Anti-rice blast gene Pi9 specific CAPS marker Pi9caps and application thereof |
-
2016
- 2016-06-16 CN CN201610431981.4A patent/CN106148510B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146695A (en) * | 2013-03-01 | 2013-06-12 | 福建省农业科学院生物技术研究所 | Functional molecular marker for rice anti-blast gene Pi9 and application thereof |
| CN103215370A (en) * | 2013-05-08 | 2013-07-24 | 辽宁省农业科学院 | Method for detecting rice blast-resistant gene pi5 |
| CN104630364A (en) * | 2015-02-05 | 2015-05-20 | 中国科学院遗传与发育生物学研究所 | Anti-rice blast gene Pi9 specific CAPS marker Pi9caps and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Polymorphism analysis of genomic regions associated with broad-spectrum effective blast resistance genes for marker development in rice;G.tacconi等;《Molecular breeding》;20101231;第26卷(第4期);摘要和第604页左栏最后1段至右栏第1段，表3，图2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106148510A (en) | 2016-11-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148510B (en) | Resistance gene of rice blast Pi5 specific Function molecular labeling and its application | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| CN105950743B (en) | A kind of rice blast resistance gene Pi9 specific Function molecular labeling and its application | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN107043813A (en) | No. 25 chromosomes of upland cotton SNP marker related to fibre strength | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN102154281A (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN113637789A (en) | Wheat stripe rust resistant gene YRTD121 linked KASP molecular marker, primer, kit and application | |
| CN109924120A (en) | A method of improvement Rice Resistance To Rice Blast and bacterial leaf spot resistance | |
| CN109924121A (en) | A method of improvement Rice Resistance To Rice Blast | |
| CN109913582B (en) | Molecular marker closely linked with rice blast resistance gene and application thereof | |
| CN111748643A (en) | SNP molecular marker of gene CRs related to Chinese cabbage clubroot disease resistance and application thereof | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN112063740B (en) | KASP molecular marker closely linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN108060162A (en) | SNP marker and its application with cucumber anti-epidemic disease character close linkage | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN102690814B (en) | Molecule marker SIsv0491 closely linked with millet bristle color gene | |
| CN108456740A (en) | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application | |
| CN106636349A (en) | SNP molecular marker in close linkage with bacterial blight resistance gene Xa7 and applications of SNP molecular marker | |
| CN109797238A (en) | Two kinds of molecular labelings and application thereof for gummy stem blight of melon Resistance Identification based on the exploitation of anti didymella linked gene | |
| CN102690813B (en) | Molecule marker SIsv0701 closely linked with millet bristle color gene | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Luo Yuming Inventor after: Yang Liming Inventor after: Ji Jianhui Inventor after: Fang Jichao Inventor after: Liu Yongfeng Inventor before: Yang Liming Inventor before: Luo Yuming Inventor before: Ji Jianhui Inventor before: Fang Jichao Inventor before: Liu Yongfeng |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20221227 Address after: 218 Tangjiaba, Wengjiaying Village, Qinhuai District, Nanjing, Jiangsu Province, 210000 Patentee after: Nanjing Dingde Biotechnology Co.,Ltd. Address before: 223300 No. 111 Changjiang West Road, Huaiyin District, Jiangsu, Huaian Patentee before: HUAIYIN NORMAL University Patentee before: JIANGSU ACADEMY OF AGRICULTURAL SCIENCES |
|
| TR01 | Transfer of patent right | ||
| CP03 | Change of name, title or address |
Address after: 215011 212-37, Building 10, No. 78, Keling Road, Technopole, High tech Zone, Suzhou, Jiangsu Province Patentee after: Suzhou Dingde Biotechnology Co.,Ltd. Address before: 218 Tangjiaba, Wengjiaying Village, Qinhuai District, Nanjing, Jiangsu Province, 210000 Patentee before: Nanjing Dingde Biotechnology Co.,Ltd. |
|
| CP03 | Change of name, title or address |