CN107916300A - A kind of rice blast resistance gene seat Pi2/9 functional genes molecular labeling and its application - Google Patents
A kind of rice blast resistance gene seat Pi2/9 functional genes molecular labeling and its application Download PDFInfo
- Publication number
- CN107916300A CN107916300A CN201810054310.XA CN201810054310A CN107916300A CN 107916300 A CN107916300 A CN 107916300A CN 201810054310 A CN201810054310 A CN 201810054310A CN 107916300 A CN107916300 A CN 107916300A
- Authority
- CN
- China
- Prior art keywords
- gene
- rice blast
- blast resistance
- resistance gene
- functional
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of rice blast resistance gene seatPi2/9Functional gene specific molecular marker and its application, be to be amplified by primer pair SEQ ID NO.1 2 from oryza sativa genomic dna and rice blast resistance genePi2、Piz‑t、Pi9WithPigmIn the molecular labeling of specific banding pattern.Rice blast resistance gene seat provided by the present inventionPi2/9Functional gene specific molecular marker there is important application value, can improve the gene in Screening of Germplasm, molecular marker assisted selection breeding, gene pyramiding breeding, and the efficiency utilized in transgenic breeding using this mark.
Description
Technical field
The invention belongs to agricultural biological technical field, more particularly to a kind of rice blast resistance gene seatPi2/9Functional gene it is special
Opposite molecule marks and its application.
Background technology
By Pyricularia oryzae (Magnapothe oryzae) caused by rice blast disease be the most important disease of rice, give world's rice
Main producing region can all cause serious loss.Since rice blast biological strain pathogenicity variation is frequent, cause most resistant varieties
Resistance can be gradually lost in 35 years planting；Therefore, it is disease-resistant variety to identify and rationally utilize broad-spectrum resistance gene
Important channel.In recent years, as multiple resistance gene of rice blast are able to by finely positioning or clone, and molecular labeling
Development and application, promote the identification of resistant gene and the development of more disease-resistant gene pyramiding breedings.But in the resistance cloned
In gene, most highly resistance gene clusters are distributed on the same area, such asPi2/9、PikWithPi-taIsoloci, linked marker without
The gene of same gene seat is differentiated and come by method.Therefore, Direct Analysis function allele sequence in itself and its function is developed
Specific molecular labeling makes choice target gene, not only selects reliability high, can also greatly accelerate breeding paces.
Exist at presentPi2/9At least found on locusPi2, Piz-t, Pi9WithPigmDeng resistant gene.Pi2Anti- spectrum
Compare wide, some researches show that the gene pairs from the overwhelming majority performance resistances in Chinese rice blast microspecies, its donor parents
C101A5l is to 36 performance resistances in 13 national 43 rice blast bacterial strains.Pi9Anti- spectrum it is also relatively wide, the base
Because showing very high resistance to multiple national rice blast bacterial strains in the world.In production application performance, Wang Qian etc. has foundPi2/9Gene on locus is the anti-source that northeast each department resistance is best, anti-spectrum is most wide.Zhang Xuetang etc. and Zeng Fansong etc. are each
From research in also confirm thatPiz-tAllele is current excellent resistant gene.PigmIt is wherein more important disease-resistant base
One of because, as the gene is cloned and correlative study achievement is delivered, we can determine substantiallyPigmIt is current most wide spectrum
One of gene of highly resistance.Currently, exploitation goes out the mark of functional gene on some locus to researcher.These marks will
It is based on the polymorphism analysis between specific parent, or being the flank positioned at resistant gene, there is certain with target gene
Physical distance.Therefore, they are only applicable between the parent of part, are unsuitable for germplasm identification or Resistance resource screening.Even if
It is functional label, can only also identifies one to two gene function genes, therefore, easily resists rice blast in order to more efficient
Property locusPi2/9Functional gene be applied in rice resistance breeding work, it is necessary to the true reflection target gene of exploitation, side
Just easy-to-use locusPi2/9The special molecular labeling of functional gene.
The content of the invention
For overcome the deficiencies in the prior art and shortcoming, primary and foremost purpose of the invention is to provide a kind of rice blast resistance gene seatPi2/9Functional gene specific Function molecular labeling Pi2/9-FM.
Another object of the present invention is to provide the rice blast resistance gene seatPi2/9Functional gene specific molecular
Mark the detection method of Pi2/9-FM.
It is still another object of the present invention to provide the rice blast resistance gene seatPi2/9Functional gene specific molecular
Mark the application of Pi2/9-FM.
The purpose of the present invention is achieved through the following technical solutions：
A kind of rice blast resistance gene seatPi2/9Functional gene specific molecular marker Pi2/9-FM, is by primer pair SEQ
ID NO.1 and SEQ ID NO.2 are accounted for from rice varieties China, are expanded in No. 4 genomic DNAs of Toride-1,75-1-127 and Gu Mei
Go out withPi2, Piz-t, Pi9WithPigmGene is in the molecular labeling of specific banding pattern；
SEQ ID NO.1（5’ -3’）: CTTATTTCGTTTGCTATGC ；
SEQ ID NO.2（5’ -3’）：GGACTATGTGATCGGTTAG ；
The rice varieties account for for China（Pi2）、Toride-1（Piz-t）、75-1-127（Pi9）With paddy plum No. 4（PigmDonor
Parent）；
The rice blast resistance genePigmIncludingPi9, Nbs5-Pi9, Pigm-R2 3 ' UTR fragments I and Nbs2-Pi2,
Pi2、The NBS-LRR fragment II of Pigm-R4 and Pigm-R6,
I: cttattt cgtttgctat gagcaccaat cgtttgctag aatgtctgaa agatcttgtg
tacatatggt ggactgaaca attgaacatt acaagttatc atattttata ttgttgctaa ccgatcacat
agtcc。
II: c ttatttcgtt tgctatgcgc agttgcgcac caaccgtttg ctagaatgtc
tgaaagagcc tatgtacata tggtggcctg aacattacaa gttatcatat tttatattgt tgctagcttt
cctttcaaaa aaaaaaaatt gttcctaacc gatcacatag tcc。
The rice blast resistance gene seatPi2/9Functional gene specific molecular marker Pi2/9-FM detection side
Method, by comparing multiple resistance gene of rice blast seatsPi2/9Allelic sequences, comprise the steps of:
(1) downloaded from public database obtaining and its homologousPi2(DQ352453)、Pi9(DQ285630.1)、Piz-t
(DQ352040) and Pigm(KU904633.2) and sequencing kind Nipponbare (Nipponbare) corresponding region gene
Group sequence, for locusPi2/9Functional gene site carries out sequence alignment, examination locusPi2/9Functional gene it is special,
The polymorphic site of other rice blast resistance alleles of the site can be different from；
(2) polymorphism information obtained using step (1), according to the design principle of mark, at the polymorphic site above and below
It is as follows to swim design gene-specific primer, primer pair base sequence at 100 200bp:
Fl:5- CTTATTTCGTTTGCTATGC -3；
Rl:5- GGACTATGTGATCGGTTAG -3；
(3) accounted for using carrying rice blast resistance gene rice varieties as China（Pi2）、Toride-1（Piz-t）、75-1-127
（Pi9）With paddy plum No. 4（Pigm）STb gene be template, carry out PCR amplification, the PCR product obtained is rice blast resistance base
Because of seatPi2/9Functional gene specific molecular marker Pi2/9-FM；
The rice blast resistance gene seatPi2/9Functional gene specific molecular marker Pi2/9-FM is differentiating rice varieties rice
The application of seasonal febrile diseases resistant gene, particularly suitable for differentiatingPi2/9The application of the different rice blast resistance gene in gene cluster region；
Preferably comprise following steps:
(I) expand:PCR is carried out to the genome of rice varieties to be detected using primers F l and Rl；
(2) detect:Detected using polyacrylamide gel electrophoresis, if detecting the core that molecular size range is 132bp and 164bp
Acid fragments, then carry rice blast resistance genePigm；If detecting the nucleotide fragments that molecular size range is 132bp,
Rice varieties to be detected carryPi9；If it is 165/166bp to detect molecular size range, then rice varieties to be detected are taken
CarryPi2/z-t;If the nucleotide fragments not detected, rice varieties to be detected do not carry locusPi2/9Function
Gene.
The principle of the present invention：The present invention finds locus by the method for Multiple Sequence AlignmentPi2/9In functional gene sequence
Two fragments occurred, the difference due to the two fragments in different functional genes there are situation, does not contain in Nipponbare
The site, therefore be easy to locusPi2/9Functional gene distinguishes.The present invention designs primer pair F1/R1 accordingly, passes through
Standard PCR amplification, when polyacrylamide gel electrophoresis detects, segment in different sizes is presented.
The present invention is had the following advantages relative to the prior art and effect:
(1) molecular labeling specificity provided by the invention is high:Pi2/9Gene cluster there is includingPi2、Piz-t、Pi9WithPigmCandidate gene Deng including, between the ortholog of these resistant genes, between paralog gene and its each other all exists
It is highly similar；Therefore, common SSR marker is difficult that the gene in the site is distinguished (Zhou et al. 2007; Dai
et al.2010) .Molecular labeling provided by the invention is inventor's process pairPi2/9Gene cluster constantly carries out sequence
Row polymorphism compares, and is obtained by experimental verification, can significantly byPi2/z-t、Pi9WithPigmFromPi2/9In locus
Separate respectively.
(2) molecular labeling provided by the invention in practical applications, low cost, high throughput：It is at present to utilize electrophoresis mostly
Platform carries out parting, and the parting platform is fast economical, it is not necessary to complicated experimental facilities, it is workable.Electropherotyping platform
There are agarose gel electrophoresis, denaturation or native polyacrylamide gel electrophoresis and Capillary Electrophoresis.Provided by the invention point
Son mark only needs PCR combinations agarose gel electrophoresis or native polyacrylamide gel electrophoresis, and cost is low, flux is high, adds
Specific high (i.e. accuracy is high), especially suitable in production practices.
(3) present invention is first and is directed toPi2/9The mark that four functional genes of locus are developed.The present invention can lead to
The method for crossing electrophoresis detection successfully willPi2/z-t、Pi9WithPigmFromPi2/9Other allele of locus distinguish, and arrive
So far, also without the report in relation to this kind of mark.It is provided by the present inventionPi2/9Locus functional gene specific molecular
It is a compound phenotypic marker to mark Pi2/9-FM, its reliability and accuracy are better than dominant marker in actual application.This
Invention can be applied toPi2/z-t、Pi9WithPigmScreening of Germplasm, transgenosis identification and gene pyramiding and based on MAS skills
In the rice resistance breeding work of art.The mark is present inPi2/9Inside locus functional gene, thus it is rightPi2/z-t、Pi9
WithPigmScreening capacity theoretical value up to 100%, its comprehensive performance is better than what is reportedPi2/9The molecular labeling of locus and
Functional label.
(4) molecular labeling provided by the invention can easily be applied in the different colony of genetic background.It is existingPi2/9
What the most of sequence polymorphism both for the different parents of same colony two of locus molecular labeling was developed, these marks
Remember that the applicability in other colonies is limited.The functional label developed, it is uncomfortable since the gene and process of identification are comparatively laborious
Should be in large-scale germplasm identification and MAS breedings.The present invention is suitable for the transgenic breeding under any genetic background, base
Because of polymerization and resistance breeding based on MAS technologies, without repeating the screening of parent's polymorphism, breeding effect is substantially increased
Rate.
Therefore, rice blast resistance gene provided by the present inventionSeat Pi2/9Functional gene specific molecular marker has weight
The application value wanted, the gene can be improved in Screening of Germplasm, molecular marker assisted selection breeding, gene using this mark
The efficiency utilized in pyramiding breeding, and transgenic breeding.
Brief description of the drawings
Fig. 1 isPi2/9Functional gene specific molecular marker Pi2/9-FM existsPi2/9Gene cluster region difference rice blast resists
Property gene and Nipponbare, 9311 verification result figure, wherein：Swimming lane 1 is DNA ladder, and the DNA profiling of swimming lane 27 is successively
For resistant variety paddy plum No. 4 (Pigm), resistant variety China account for (Pi2), resistant variety Toride-1 (Piz-t), resistant variety
75-1-127 (Pi9), susceptible variety Nipponbare (NPB), susceptible variety Co39.
Fig. 2 isPi2/9Verification result figures of the functional gene specific molecular marker Pi2/9-FM in other rice varieties,
Wherein:Swimming lane 1 is DNA ladder, and the DNA profiling of swimming lane 2 13 is followed successively by Gu Mei 4, China accounts for, Toride-1,75-1-
127th, Gu Feng A, Hubei Province is early 11, Fujian is extensive 3119, new 1223, Y58s, in die B, Hunan morning Xian 45, middle morning 23, preferably 618B, perfume 1B, flower
It is fragrant B, II-32B, the rich B of 629B, 2155, five, the rich B of luxuriant growth, the rich B of peace, Long Tepu B, the anti-1B of gold, safe rich B, the rich B, IR88988B in day, wide
Anti- 13B, Zhenshan 97B, gold 23B, perfume B, D702B, Bobai B, depth 95B, the rich B in Guangdong, good fortune her B, 710S, SE21S, Fujian 2B, southern exposure
No.1 B, dawn B, Jin Nante 43B, excellent 1 B, high mountain 4B, D62B, ridge 46B, Feng Yuan B, D702B, bright extensive 86, R1128, no loadtransformer,
Hunan morning Xian 7, in extensive 8015, silver account for, extensively surpass 128, it is small account for, Huang Huazhan, fragrant No. 1 middle, middle mirror 100, Guanglu ai 4, special number of south,
Osmanthus towards in No. 2, platform come 1, ten thousand profit Xian, town Xian 232, short son account for, two or nine south 1, extensive 29, short-foot Nan Te, bright extensive 63, IR661-
1st, Nanjing 11, Gui 630, short a small bay in a river paddy 151, Hunan evening Xian 1, Dongting Lake evening Xian, raise rice No. 2, middle peasant No. 4, wide by extensive 128, special blue or green choosing,
Survey 64, evening 3, R527, wide by extensive 998, happy extensive 188, another name for Sichuan Province extensive 881, polyphyly 1, another name for Sichuan Province are extensive 498, bright extensive 72, Lu is extensive 17, Yanhui 559,
Fuhui 838, river oil is extensive 151, anti-mosquito green grass or young crops accounts for, osmanthus 99, into extensive 448, spoke extensive 718.
Embodiment
With reference to embodiment and attached drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited
In this.
Embodiment 1:Rice blast resistance gene seatPi2/9Functional gene specific molecular marker and its design of primers and detection
(1) Pi2/9The analysis of gene cluster functional gene polymorphism:
Download and obtain from public databasePi2、Piz-t、Pi9WithPigmGenome sequence and sequencing kind Nipponbare
(Nipponbare) genome sequence in corresponding region, forPi2/9Functional gene carries out sequence alignment, examinationPi2/z-t、 Pi9WithPigmThe difference site special, the site allele can be different from.With gene specificPi2、Piz-t、 Pi9WithPigmMultiple Sequence Alignment result following table shown in:
Pi2/z-t：
II:CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACAT
ATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTCAA/AAAAAAAAAAAAATTG
TTCCTAACCGATCACATAGTCC；
Pi9:
I:CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAATGTCTGAAAGATCTTGTGTACATATGGTGGAC
TGAACAATTGAACATTACAAGTTATCATATTTTATATTGTTGCTAACCGATCACATAGTCC；
Pigm:
I:CTTATTTCGTTTGCTATGAGCACCAATCGTTTGCTAGAATGTCTGAAAGATCTTGTGTACATATGGTGGAC
TGAACAATTGAACATTACAAGTTATCATATTTTATATTGTTGCTAACCGATCACATAGTCC；
II:CTTATTTCGTTTGCTATGCGCAGTTGCGCACCAACCGTTTGCTAGAATGTCTGAAAGAGCCTATGTACAT
ATGGTGGCCTGAACATTACAAGTTATCATATTTTATATTGTTGCTAGCTT TCCTTTCAAAAAAAAAAAATTGTTCC
TAACCGATCACATAGTCC；
Wherein, the nucleotide of overstriking isPi2/z-tGene relative toPigm-1 and 2 base that II has more.
(2) primer is designed:
According to the design principle of molecular labeling, primer, primer pair base sequence are being designed at the site at upstream and downstream 100-200bp
Arrange as follows:
Fl:5’ - CTTATTTCGTTTGCTATGC -3’；
Rl:5’ - GGACTATGTGATCGGTTAG -3’。
(3) rice Representative Cultivars are selected:Selection carriesPi2/9Locus functional gene and non-functional allele
Representative Cultivars it is as follows:
China accounts for（Pi2）、Toride-1（Piz-t）、75-1-127（Pi9）With paddy plum No. 4（Pigm）Susceptible check variety:Japan
It is fine.
(4) PCR amplification, is containedPi2/z-t, Pi9WithPigmGene-specific fragment
Using above-mentioned primer pair Fl and R1, using the STb gene of above-mentioned rice varieties as template, gathered after carrying out standard PCR amplification
Acrylamide gel electrophoresis detects, and obtains that the results are shown in Figure 1.
Amplification reaction system is as follows:
2 × Mix buffer(Mg2+Plus):12.5μ L
Primers F l (10 μ Μ):1 μL
Primer Rl (10 μ Μ):1 μL
Taqase(5U/ml):0.2 μL
DNA templates (20-50ng/ μ L): 1 μL
ddH2O:Complement to 25 μ L.
PCR Thermal cycling conditions are as follows:94 DEG C 3 minutes；94 DEG C 30 seconds, 58 DEG C 30 seconds, 72 DEG C 30 seconds, 35 circulation；
72 DEG C 7 minutes；10 DEG C of preservations.
PCR after reaction, takes appropriate amount of sample to carry out electrophoresis detection on 8% polyacrylamide gel, and deposition condition is
90V, 1 it is small when.
Wherein, the swimming lane I of Fig. 1 is DNA Ladder；Swimming lane II isPigmDonor kind rice varieties paddy No. 4 genomes of plum
The fragment obtained for template PCR, with rice blast resistance genePigmIn specific banding pattern, swimming lane III isPi2Donor kind water
It is the fragment that template PCR is obtained that rice varieties China, which accounts for genome, with rice blast resistance genePi2In specific banding pattern;Swimming lane IV
ForPiz-tDonor kind rice varieties Toride-1 genomes are the fragment that template PCR is obtained, with rice blast resistance genePiz-tIn specific banding pattern；Swimming lane V isPi9Donor kind rice varieties 75-1-127 genomes are the piece that template PCR is obtained
Section, with rice blast resistance genePi9In specific banding pattern;And the Nipponbare for not containing functional gene is presented without band,.
Embodiment 2:Resistant gene seatPi2/9Functional gene specific molecular marker is differentiatingPi2/9Gene cluster region is not
With the application of rice blast resistance gene.
, can be containing target gene according to the PCR product band of polymorphismPi2, Piz-t, Pi9WithPigmRespectively fromPi2/9Distinguished in gene cluster.As shown in Figure 1, can general there are situation according to bandPi2, Piz-t, Pi9WithPigmWith
Other allele that the site is identified distinguish, and 132bp and 164bp represent to containPigmGene, 165bp and
166bp then represent containingPi2/z-tResistant gene, 132bp then represent containingPi9Resistant gene, no band represent not containing the position
The functional gene of point.It can be seen that result of the test matches with what design was analyzed, illustrate resistant gene seatPi2/9Functional gene specificity
Molecular labeling can differentiatePi2, Piz-t, Pi9WithPigmEtc. be applied.
Embodiment 3:Resistant gene seatPi2/9Detection of the functional gene specific molecular marker in other rice varieties should
With
The representative rice varieties of selection 92, are followed successively by:The rich A of paddy, Hubei Province are early 11, Fujian is extensive 3119, new 1223, Y58s, in die B, Hunan
Early Xian 45, middle morning 23,618B, preferably perfume 1B, fragrance of a flower B, II-32B, the rich B of 629B, 2155, five, the rich B of luxuriant growth, pacify rich B, Long Tepu B,
The anti-1B of gold, safe rich B, the rich B, IR88988B in day, wide anti-13B, Zhenshan 97B, gold 23B, perfume B, D702B, Bobai B, depth 95B, Guangdong
It is rich B, good fortune her B, 710S, SE21S, Fujian 2B, southern exposure No.1 B, dawn B, Jin Nante 43B, excellent 1 B, high mountain 4B, D62B, ridge 46B, rich
Source B, D702B, bright extensive 86, R1128, no loadtransformer, Hunan morning Xian 7, in extensive 8015, silver account for, extensively surpass 128, it is small account for, Huang Huazhan, in
Fragrant No. 1, middle mirror 100, Guanglu ai 4, special number of south, osmanthus towards in No. 2, platform come 1, ten thousand profit Xian, town Xian 232, short son account for, Er Jiunan
No. 1, extensive 29, short-foot Nan Te, bright extensive 63, IR661-1, Nanjing 11, Gui 630, short a small bay in a river paddy 151, Hunan evening Xian 1, Dongting Lake evening Xian,
Raise rice No. 2, middle peasant No. 4, wide by extensive 128, special blue or green choosing, survey 64, evening 3, R527, wide by extensive 998, happy extensive 188, another name for Sichuan Province extensive 881, polyphyly 1,
Another name for Sichuan Province is extensive 498, bright extensive 72, Lu is extensive 17, Yanhui 559, Fuhui 838, river oil are extensive 151, anti-mosquito green grass or young crops accounts for, osmanthus 99, extensive into extensive 448, spoke
718。
Its genomic DNA is extracted respectively, and as template, according to the method for embodiment 1, carries out PCR amplification and electrophoresis
Detection., can be resistant gene according to the size of band and there are situationPi2、Piz-t、Pi9WithPigmDistinguish.Such as Fig. 2
It is shown, detected in the 5th, 21,27 and 35PigmType gene specific band；The 8th, 11,16,19,20,31,34,36,37,
42nd, 43,44,47,48,54,58,65 and 72 detectPi2/z-tType gene specific band;It is not detected byPi9Type gene is special
Different in nature band.As it can be seen that result of the test matches with what design was analyzed, illustrate that resistant gene Pi2/9-FM can differentiatePi2、Piz- t、Pi9WithPigmAspect is applied.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention and from above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Fujian Province Agriculture Science Academy, Institute of Biotechnology
<120>A kind of rice blast resistance gene seat Pi2/9 functional genes molecular labeling and its application
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
cttatttcgt ttgctatgc 19
<210> 2
<211> 19
<212> DNA
<213>Artificial sequence
<400> 2
ggactatgtg atcggttag 19
<210> 3
<211> 132
<212> DNA
<213>Artificial sequence
<400> 3
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 4
<211> 164
<212> DNA
<213>Artificial sequence
<400> 4
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaat tgttcctaac cgatcacata gtcc 164
<210> 5
<211> 167
<212> DNA
<213>Artificial sequence
<400> 5
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaaa aattgttcct aaccgatcac atagtcc 167
<210> 6
<211> 132
<212> DNA
<213>Artificial sequence
<400> 6
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 7
<211> 132
<212> DNA
<213>Artificial sequence
<400> 7
cttatttcgt ttgctatgag caccaatcgt ttgctagaat gtctgaaaga tcttgtgtac 60
atatggtgga ctgaacaatt gaacattaca agttatcata ttttatattg ttgctaaccg 120
atcacatagt cc 132
<210> 8
<211> 164
<212> DNA
<213>Artificial sequence
<400> 8
cttatttcgt ttgctatgcg cagttgcgca ccaaccgttt gctagaatgt ctgaaagagc 60
ctatgtacat atggtggcct gaacattaca agttatcata ttttatattg ttgctagctt 120
tcctttcaaa aaaaaaaaat tgttcctaac cgatcacata gtcc 164
Claims (6)
- A kind of 1. rice blast resistance gene seatPi2/9The primer pair of functional gene specific molecular marker, it is characterised in that：It is described Primer pair sequence is as shown in SEQ ID NO.1-2.
- A kind of 2. rice blast resistance gene seatPi2/9Specific molecular marker, it is characterised in that：It is by described in claim 1 Primer pair SEQ ID NO.1-2 are amplified and rice blast resistance gene seat from oryza sativa genomic dnaPi2/9Functional gene is in spy The molecular labeling of different in nature banding pattern.
- A kind of 3. rice blast resistance gene seat according to claim 2Pi2/9Functional gene specific molecular marker, it is special Sign is：The rice blast resistance gene seatPi2/9Including genetic fragment I and II, I and II sequences respectively such as SEQ ID Shown in NO.3 and SEQ ID NO.4.
- 4. rice blast resistance gene seat as claimed in claim 2Pi2/9Functional gene specific molecular marker detection side Method, it is characterised in that：By comparing multiple resistance gene of rice blast seatsPi2/9Functional gene sequence, include following step Suddenly:(1) download and obtain from public databasePi2、Piz-t、Pi9WithPigmGene order and sequencing kind Nipponbare phase The genome sequence of corresponding region, sequence alignment is carried out for mutual difference, each functional gene of examination it is special, this can be different from The polymorphic site of other rice blast resistance alleles of site；(2) polymorphism information obtained using step (1), according to the design principle of mark, at the polymorphic site above and below Design gene-specific primer at 100 200bp is swum, primer pair sequence is as shown in claim 1SEQ ID NO.1-2；(3) to carry rice blast resistance genePi2、Piz-t、Pi9WithPigmRice blast resistance kind China account for, Toride- 1st, the STb gene of 75-1-127 and Gu Mei 4 are template, carry out PCR amplification, the PCR product obtained is rice blast resistance base Because of seatPi2/9Functional gene specific molecular marker Pi2/9-FM.
- 5. rice blast resistance gene seat as claimed in claim 2Pi2/9Functional gene specific molecular marker differentiate water The application of rice varieties rice blast resistance gene.
- 6. rice blast resistance gene seat according to claim 2Pi2/9Functional gene specific molecular marker reflecting NotPi2/9The application of the different rice blast resistance gene in gene cluster region.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810054310.XA CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810054310.XA CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107916300A true CN107916300A (en) | 2018-04-17 |
| CN107916300B CN107916300B (en) | 2021-03-26 |
Family
ID=61891413
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810054310.XA Active CN107916300B (en) | 2018-01-19 | 2018-01-19 | Rice blast resistance gene locus Pi2/9 functional gene molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107916300B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300802A (en) * | 2018-04-27 | 2018-07-20 | 江西省农业科学院水稻研究所 | The general molecular label of detection blast resisting multiple allele Pi-2/gm/zt a kind of and application |
| CN109182342A (en) * | 2018-08-20 | 2019-01-11 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | A kind of rice blast resistant gene Pisj and its application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
-
2018
- 2018-01-19 CN CN201810054310.XA patent/CN107916300B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| DENG,Y等: "GenBank: KU904633.2", 《NCBI-GENBANK》 * |
| GUI XIAO等: "Identification of resistant germplasm containing novel resistance genes at or tightly linked to the Pi2/9 locus conferring broad-spectrum resistance against rice blast", 《RICE》 * |
| 华丽霞等: "抗稻瘟病Pi2/9/z-t基因特异性分子标记的开发", 《中国水稻科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300802A (en) * | 2018-04-27 | 2018-07-20 | 江西省农业科学院水稻研究所 | The general molecular label of detection blast resisting multiple allele Pi-2/gm/zt a kind of and application |
| CN109182342A (en) * | 2018-08-20 | 2019-01-11 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | A kind of rice blast resistant gene Pisj and its application |
| CN109182342B (en) * | 2018-08-20 | 2021-08-20 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | Rice blast resistance gene Pisj of rice and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107916300B (en) | 2021-03-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN103320437B (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN108411028B (en) | Specific SNP codominant molecular marker primer in rice salt-tolerant gene SKC1 gene and application | |
| CN107988419A (en) | A kind of rice blast resistance gene Pigm specific Functions molecular labeling and its application | |
| CN105838812B (en) | The SSR molecular marker isolated with cucumber powdery mildew resistance main effect QTL | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN112481275A (en) | Wheat stripe rust resistant gene yrZ15-1370 and molecular marker and application thereof | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN108165653A (en) | For identifying the InDel molecular labelings of capsicum maturity and its application | |
| CN107916300A (en) | A kind of rice blast resistance gene seat Pi2/9 functional genes molecular labeling and its application | |
| CN110499389A (en) | With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco | |
| CN108913809A (en) | InDel molecular marked compound, detection method and the application of blast resistant gene Pid3-A4 | |
| CN106498068B (en) | Co-dominant SSR marker closely linked with tobacco TMV resistance gene N and application thereof | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN110257546B (en) | New salt-tolerant gene cluster qST12 in rice seedling stage Pokkali And applications | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN108977568A (en) | A kind of rice blast resistance gene Pik-p specific Function molecular labeling and its application | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN105176994B (en) | Rice blast resistance gene Pi9 specific Function molecular labeling Pi9FNP and method and application | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN102690818A (en) | Molecular marker SIsv0832 closely linked with Setaria italica L. Beauv. heading stage gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |