CN110499389A - With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco - Google Patents
With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco Download PDFInfo
- Publication number
- CN110499389A CN110499389A CN201910934802.2A CN201910934802A CN110499389A CN 110499389 A CN110499389 A CN 110499389A CN 201910934802 A CN201910934802 A CN 201910934802A CN 110499389 A CN110499389 A CN 110499389A
- Authority
- CN
- China
- Prior art keywords
- tobacco
- primer
- rtsw
- spotted wilt
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco, the molecular labeling primer is made of two single stranded DNAs of primer 1 and primer 2.Codominant marker's primer of the invention be capable of specificity identification is marked to tobacco gene group DNA, detect the allelic gene type of RTSW in tobacco-containing material genomic DNA, it can not only identify whether contain anti-spotted wilt site RTSW, and the anti-spotted wilt site RTSW allelic gene type of tobacco can be identified, it is reliable and easy to use, compared with previous anti-spotted wilt label, with with target gene RTSW close linkage, accuracy is high, it is low in cost, the advantages that detection efficiency is high, it is greatly improved the screening efficiency of anti-tobacco spotted wilt gene RTSW kind, greatly shorten the breeding cycle of disease-resistant tobacco bred, improve breeding efficiency.
Description
Technical field
The invention belongs to technical field of molecular biology, wither ospc gene site RTSW more particularly to tobacco antiplaque can be identified
Molecular labeling and its application in tobacco RTSW localization of disease resistance genes, clone or the anti-spotted wilt kind of breeding tobacco.
Background technique
Tobacco spotted wilt is to infect caused tobacco by positive Tospovirus (Orthotospovirus) virus
Disease.The category virus is that host range is most wide, a kind of plant virus the most serious occurs, and american type representative species tomato spot withers
Viral (Tomato Spotted Wilt Virus, TSWV) has constituted biggish prestige to the leaf tobacco production of Yunnan Province of China cigarette district
The side of body.Recent years, TSWV was distributed simultaneously on Yunnan Province tobacco in terms of Yunnan various regions (state, city) county acquisition sample detection result
Has the tendency that expansion and exacerbation.And more allow people it is worried be current Yunnan Province the not anti-TSWV of flue-cured tobacco main breed, field tune
Looking into existing main the cultivations flue-cured tobacco cultivars K326 of discovery, Hongda tobacco, cloud and mist 87 etc. can be infected by TSWV, become TSWV prevalence,
The potential factor of outburst.The common means of prevention of tobacco spotted wilt relies primarily on prevention and treatment and passes virus mediator thrips, but since thrips has
Have the characteristics that development duration is short, individual little Yi is hidden, easily develop drug resistance to insecticide, so existing control measure is difficult
To obtain ideal control effect, thus, the flue-cured tobacco cultivars of the anti-spotted wilt of breeding are most economical, most effective means.
Nicotiana gossei resource resistant gene rich in.Research shows that Henbane (Nicotiana alata) is to TSWV
With good resistance.It is inoculated with TSWV and only shows hypersensitive necrosis symptom in inoculation leaf, can't detect virus in system leaf
In the presence of.By a series of conventional hybridization and backcross transformation, researcher by the resistant gene from the transformation of Henbane resistance to
In flue-cured tobacco cultivars, it is bred as breeding for disease resistance intermediate materials Polalta.Nicotiana alata and Polalta be to the resistance of TSWV
It is controlled by dominant single-gene (being named as RTSW) site.
But regrettably, disease-resistant gene RTSW is not yet cloned.The feelings of disease-resistant gene can not be cloned in a short time
Under condition, the molecular labeling of exploitation and disease-resistant gene close linkage becomes the important means of tobacco spotted wilt breeding for disease resistance.It is so far
Only, only H.Moon and J.S.Nicholson (2007) develops corresponding molecular labeling in the world, but its AFLP label exists
Farther out with resistant gene genetic distance, chain not close, the SCAR mark of exploitation exists in practical applications is easy to produce false sun
The problem of property.And homozygosis/heterozygous genotypes of resistance locus all cannot be distinguished in both labels, limit the big of these labels
Sizable application.In the breeding process for carrying out the anti-spotted wilt of tobacco using RTSW, this can be isolated in hybridization or backcross progeny
The different genotype single plant of gene, this just needs to carry out hybridization or backcross progeny plant the detection of single plant genotype, selects
The single plant of RTSW homozygosis or heterozygosis for then further backcrossing or is selfed.Codominant marker (codominance
It marker) is that can detect dominant and Recessive alleles simultaneously, homozygous and heterozygous genotypes genetic markers can be distinguished.Cause
This, exploitation can be used for identifying the codominant marker of the anti-spotted wilt site RTSW allelic gene type of tobacco, can establish a kind of letter
Just, quickly, accurately, sensitively identification tobacco antiplaque is withered ospc gene method, makes up the deficiencies in the prior art.
Summary of the invention
It is an object of the present invention to solve the deficiency of the existing technology and provide a kind of tight with the anti-spotted wilt site RTSW of tobacco
Close chain codominant marker's primer and the side for identifying the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer
The application of method and the primer in tobacco spotted wilt localization of disease resistance genes, clone or the anti-spotted wilt kind of breeding tobacco is specific
Using, the molecular labeling primer and discrimination method can be used for screening resource and breeding single plant containing RTSW disease-resistant gene site,
And pure/heterozygous genotypes containing RTSW disease-resistant gene site can be accurately obtained, reach easy, quick, accurate, sensitive
Identification tobacco antiplaque is withered the effect of ospc gene site method, provides technology hand to select the tobacco breeding material of highly resistance spotted wilt
Section.
In the context of the present invention, term " antiplaque wither ospc gene site RTSW " refers to comprising the disease-resistant base of tobacco spotted wilt
Because of the site of (RTSW gene) wild tobacco chromosome segment.
To achieve the goals above, the invention adopts the following technical scheme:
With codominant marker's primer of the anti-spotted wilt site RTSW close linkage of tobacco, the primer is by primer 1 and primer 2
Two single stranded DNAs composition；
1 sequence of primer is Seq ID No.1:
RTSW_Marker3_F 5'-CCTATGAAGCAACGAAGCGATA-3'；
The primer 2 sequence is Seq ID No.2:
RTSW_Marker3_R 5'-GTTGACTGTTGACTGTTGATTAGAG-3'；
Identify the method for the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer, steps are as follows:
(1) respectively with tobacco to be identified, the genome of tobacco spotted wilt anti-source Polalta and spotted wilt susceptible variety K326
DNA is template, carries out PCR amplification, In to genomic DNA with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2
The plant of the gene containing RTSW expands to obtain specific clip size to be 490bp, and sequence is SEQ ID No.3；It is being free of
The plant of RTSW gene expands to obtain specific clip size to be 570bp, and sequence is SEQ ID No.4；
(2) by the PCR product of amplification by electrophoresis detection or sequencing, identify as follows and determine cigarette to be identified
The anti-spotted wilt site RTSW allelic gene type of grass:
If 1) band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing only with the banding pattern phase of Polalta
Together, and containing size the band for being 490bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate is anti-spotted wilt tobacco, and
Genotype is that resistance RTSW gene loci is homozygous；
If 2) band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing is only identical as the banding pattern of K326,
And the band for containing size being 570bp, then tobacco to be identified is sense spotted wilt tobacco or candidate is sense spotted wilt tobacco, and gene
Type is that susceptible rtsw gene loci is homozygous；
If 3) band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing contain simultaneously with Polalta and
The identical band of K326 banding pattern, and size is respectively 490bp and 570bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate
For anti-spotted wilt tobacco, and genotype is disease-resistant RTSW/rtsw, gene loci heterozygosis.
Exist the present invention provides described with the anti-spotted wilt site RTSW close linkage of tobacco codominant marker's primer
Application in tobacco spotted wilt localization of disease resistance genes, clone or the anti-spotted wilt kind of breeding tobacco.
Further, the present invention is any using the seed of tobacco, blade, root, floral organ when extracting tobacco DNA to be identified
The tissue at one position or several positions.
Further, of the present invention to be carried out with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2
The reaction system of PCR amplification, PCR is as follows: susceptible with tobacco to be identified, the anti-source Polalta of tobacco spotted wilt and spotted wilt respectively
The genomic DNA of kind K326 be template, PCR amplification system: 2 × Premix Ex TaqMix PCR Buffer, 12.5 μ L,
10 μm of ol/L primers 1 and each 1 μ L of 0.5 μ L, 50ng/ μ L template DNA of primer 2 add sterilizing distilled water to make 25 μ L of total volume；PCR
Response procedures are as follows: 94 DEG C of initial denaturation 5min；Recycle subsequently into 35: 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C extend
30s；72 DEG C of extension 10min after circulation terminates；4 DEG C of preservations.
The PCR primer that two single stranded DNAs of the present invention by primer 1 and primer 2 form be included in Seq ID No.1 or
5 ' the ends or 3 ' ends of Seq ID No.2 increase separately the primer for the essentially identical DNA fragmentation that 1~30 base amplification obtains.
Compared with prior art, the present invention has the advantages that:
Primer of the invention is the label with RTSW gene loci close linkage, molecule labelling method established by the present invention
It is that based on PCR technology generates codominant marker, can be used for the map based cloning and molecular marker assisted selection of disease-resistant gene, pass through inspection
The resistance that antiplaque withers ospc gene site to predict tobacco to spotted wilt is surveyed, the anti-spotted wilt site RTSW allele class of tobacco is identified
Type can carry out eliminating selection in the seedling stage of tobacco, not only save production cost but also greatly improve efficiency of selection, into
And accelerate the anti-spotted wilt breeding process of tobacco.
It is embodied in the following:
1. close linkage: it is demonstrated experimentally that using this method to the result and Resistance Identification of the auxiliary identification of tobacco breeding material
As a result completely the same, and previous anti-spotted wilt AFLP and SCAR mark are utilized, there are partial results and Resistance Identification inconsistent, table
Bright this method can be used in the molecular marker assisted selection of the anti-spotted wilt breeding of tobacco.
2. accuracy is high: using this method to the auxiliary identification of tobacco breeding material as a result, band is clear, banding pattern difference is bright
It is aobvious, and previous anti-spotted wilt SCAR mark amplified fragments are between 100-200bp, easily with the band where primer dimer
Position, which generates, obscures.Compared with previous anti-spotted wilt label, which overcomes false positive height, stability difference etc. and asks
Topic, accuracy rate is up to 100%.
3. low in cost: this research and utilization regular-PCR system, PCR product can be completed detection by electrophoresis, be effectively reduced
High-throughput testing cost.
4. detection efficiency is high: compared with previous anti-spotted wilt AFLP label, this research only with an electrophoretic analysis,
The shortcomings that previous detection needs polyacrylate hydrogel electrophoresis is overcome, detection efficiency is greatly improved.
5. easy to operate: the anti-tobacco spotted wilt gene RTSW with present invention label detection breeding material is easy to operate, no
Production cost is only saved, and greatly improves the screening efficiency of anti-tobacco spotted wilt gene RTSW kind, is greatly shortened disease-resistant
The breeding cycle of tobacco bred improves breeding efficiency.
Detailed description of the invention
Fig. 1 is the present invention using molecular labeling primer 1 and primer 2 as primer, the product electrophoresis expanded to genomic DNA
Testing result, swimming lane 1 are disease-resistant parent Polalta, and swimming lane 2 is the anti-source Polalta (♂) of tobacco spotted wilt and main cultivation susceptible variety
K326 (♀) hybridizes F1 single plant；Swimming lane 3 is Susceptible parent K326；
Fig. 2 is the present invention using primer 1 and primer 2 as the anti-source Polalta (♂) of primer pair tobacco spotted wilt and the main susceptible product of cultivation
The electrophoresis detection result of kind 210 single plant amplified productions of K326 (♀) filial generation BC6F3 segregating population.
Specific embodiment
Below with reference to embodiment, the present invention is described in further detail.
With codominant marker's primer of the anti-spotted wilt site RTSW close linkage of tobacco, the primer is by primer 1 and primer 2
Two single stranded DNAs composition；
1 sequence of primer is Seq ID No.1:
RTSW_Marker3_F 5'-CCTATGAAGCAACGAAGCGATA-3'；
The primer 2 sequence is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’。
Identify the method for the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer, the specific steps are as follows:
(1) respectively with tobacco to be identified, the genome of tobacco spotted wilt anti-source Polalta and spotted wilt susceptible variety K326
DNA is template, carries out PCR amplification to genomic DNA with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2, benefit
The PCR primer formed with two single stranded DNAs of primer 1 and primer 2 by molecular labeling RTSWMarker3 to genomic DNA into
Row PCR amplification expands to obtain specific clip size to be 490bp in the plant of the gene containing RTSW, and sequence is SEQ ID
No.3；It expands to obtain specific clip size to be 570bp in the plant without RTSW gene, sequence is SEQ ID No.4.
When extracting tobacco DNA to be identified, can using the seed of tobacco, blade, root, any one position of floral organ or several positions group
It knits.Extracting method to tobacco DNA is the extracting method of this field routine, can be managed for CTAB method, SDS extraction method, ROSE mono-
The extraction that commercial kits carry out DNA also can be directly used in method, TPS extraction method etc..To those skilled in the art, may be used
To understand, molecular labeling of the invention can also be obtained in the chemically synthesized method of DNA.
When carrying out PCR amplification to genomic DNA with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2,
The reaction system of PCR is as follows: respectively with tobacco to be identified, tobacco spotted wilt anti-source Polalta and spotted wilt susceptible variety K326
Genomic DNA be template, PCR amplification system: 2 × Premix Ex TaqMix PCR Buffer 12.5 μ L, 10 μm of ol/L
Primer 1 and each 1 μ L of 0.5 μ L, 50ng/ μ L template DNA of primer 2 add sterilizing distilled water to make 25 μ L of total volume；PCR response procedures
Are as follows: 94 DEG C of initial denaturation 5min；It is recycled subsequently into 35: 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；Circulation knot
72 DEG C of extension 10min after beam；4 DEG C of preservations.
The sequence Seq ID No.3 is as follows:
GTTGACTGTTGACTGTTGATTAGAGATAAAACAGATCACAAGATTCTTGATTAATAGTTACTTCTTGA
TCAACTTGAACCTGCTTGCATTATAATATGAGAAATTACCTTGACTTTCCTTTTTAACAAATGGAAGCAAAAATAT
TATAAATGACTAAGACGGAAAAAAGATGTTAACAATCGACCAGATCGATTATTTCCAAATTTAATGAAAGTAGACT
TTGCTATAACAATGAGCATGAGCTGGTTAATAACAAATTTAGTAGCCATTGTTGCTTTTTTTTTCCTTCCCAATTA
GCTTATGCCTATGATCTCAATCCTCTACAAGACATATATGTTGGAGTTAAAGACACTAACGCTTCTGGTAAATCAT
ATCCTTCTATAGTCAGGAAAGCTTTTTTATCGAATTTCTTCTTCTTCCTATTTTAAATAATATTGTATGTTATATT
ATAGTGTTGATAAAAGCATGTATCGCTTCGTTGCTTCATAGG；
The sequence Seq ID No.4 is as follows:
GTTGACTGTTGACTGTTGATTAGAGATAAAACAGATCACAAGGTTCTGGATTAACAGTTACTTCTTGA
TCAACTTGAACCTGCTTGTATTTTAATATGAGAAATTACCTTGACTTTCCTTTTTAACAAATGGAAGCAAAAATAT
TATAAATGACTAAGACGGAAACAAGATGTTAACAATTGACCAGATCGAACTATAAGTTATAGACTCCTCAGCTGGT
TGTTTCGTAAAAGAAAAAAAAGTATAACACGCTAACTCCTTACCAAACAAACAATTGTTTCCAAATTTAATGAAAG
TAGACTTTGCTATAACAATGAGCATGAGCTGGTTAATAACAACTTTAGTAGCCATTGCTGCTTTTTTTTCTTCCCA
ATTAGCTTATGCCTATGATCTCAATCCTCTACAAGACATATGTGTTGGAGTTAAAGACACTAACGCTTCTGGTAAA
TCATATCCTTCTATAGTCAGGAAAGCTTTTTTACCGAATTTCTTCTTTTTCCTATTTTATACAATATTGTATGTTA
TATTATAGTGTTGATAAAAGCATGTATCGCTTCGTTGCTTCATAGG。
(2) PCR product of amplification is identified as follows and is determined by electrophoresis detection or sequencing amplified production
The anti-spotted wilt site RTSW allelic gene type of tobacco to be identified:
1) if band of the pcr amplification product of tobacco to be identified after electrophoresis is identical as the banding pattern of Polalta, and contains
Size is the band of 490bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate is anti-spotted wilt tobacco, and genotype is anti-
Property RTSW gene loci it is homozygous (RTSW/RTSW)；
2) if band of the pcr amplification product of tobacco to be identified after electrophoresis is identical as the banding pattern of K326, and containing big
The small band for 570bp, then tobacco to be identified is sense spotted wilt tobacco or candidate is sense spotted wilt tobacco, and genotype is susceptible
Rtsw gene loci is homozygous (rtsw/rtsw)；
3) if band of the pcr amplification product of tobacco to be identified after electrophoresis contains and Polalta and K326 band simultaneously
The identical band of type, and size is respectively 490bp and 570bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate is antiplaque
Disease of withering tobacco, and genotype is disease-resistant RTSW gene loci heterozygosis (RTSW/rtsw).
The codominant marker's primer of the present invention for identifying the anti-spotted wilt site RTSW allelic gene type of tobacco can be applied
In tobacco spotted wilt localization of disease resistance genes, clone or the anti-spotted wilt kind of breeding tobacco.Using primer of the invention, with to be detected
Tobacco gene group DNA be that template carries out PCR, can be detected in tobacco and whether to wither ospc gene site containing tobacco antiplaque
RTSW simultaneously can identify the anti-spotted wilt site RTSW allelic gene type of tobacco.The method that the detection can be PCR detection, tool
Body, the PCR primer being made of two single stranded DNAs of primer 1 and primer 2 can be used, PCR amplification is carried out to genomic DNA.
The detection can also be detected whether by high-flux sequence method containing primer sequence of the present invention and amplified production.
Those skilled in the art are known, can be at its 5 ' end or 3 ' ends in Seq ID No.1 or Seq ID No.2 sequence
Increase separately 1~30 base, the increased base type of institute can be according to tobacco gene group DNA on and Seq ID No.1 or Seq
ID No.2 match region base type and determined according to basepairing rule, thus obtained primer and Seq ID
The amplified production of No.1 or Seq ID No.2 is essentially identical (DNA sequence dna between upstream and downstream primer is identical).Therefore, on
It states and increases separately 1~30 base at the 5 ' ends of Seq ID No.1 or Seq ID No.2 or 3 ' ends and can expand and obtain basic phase
With the primer of DNA fragmentation, it is included in primer of the invention.
Present invention utilizes wither the anti-TSWV tobacco-containing material in ospc gene site comprising RTSW antiplaque, and: Polalta does not include
RTSW antiplaque wither ospc gene site sense TSWV material K326 and the anti-source Polalta (♂) of tobacco spotted wilt and main plant susceptible product
The BC6F3 offspring that kind K326 (♀) hybridization and backcrossing, selfing obtain.The above tobacco-containing material is common tobacco germplasm,
The public can save unit from tobacco germplasm or Yunnan Academy of Tobacco Agricultural Science obtains.Restriction enzyme, OK a karaoke club
Mycin, spectinomycin, Taq archaeal dna polymerase 2 × Premix Ex TaqMix are purchased from Dalian treasured biotech firm.Other chemistry examinations
Agent is commercial product.The reference genome sequence of N.tobacum (K326) (Edwards et al., 2017, A
reference genome for Nicotiana tabacum enables map-based cloning of
homeologous loci implicated in nitrogen utilization efficiency.Bmc Genomics
18,448.) it is disclosed in, the public can be from https: //solgenomics.net/organism/Nicotiana_tabacum/
Genome is obtained.
The specific operational instances of of the invention one are as follows:
1, anti-sense pond is constructed using segregating population tobacco Resistance Identification and transcript profile is sequenced.
It takes and the anti-source Polalta (♂) of tobacco spotted wilt is hybridized with main cultivation susceptible variety K326 (♀) and is returned, is selfed acquisition
210 plants of BC6F3 offspring, utilize nontoxic gene infiltration method carry out TSWV Disease Resistance Identification.When 4~5 leaves, choose complete
The top vane of expansion chooses three positions on same blade and is inoculated with pK2-35S-NSm, pK2-35S-NSs, pK2- respectively
35S-NSm+p2300-35S-Sw-5b.Wherein pK2-35S-NSs is as negative control, pK2-35S-NSm+p2300-35S-Sw-
5b is positive control, and positive control can all generate hypersensitive necrosis on all tobaccos.20~28 DEG C of light after tobacco seedlings inoculation
According to 72h is cultivated in culturing room, it is downright bad (HR reaction) that allergy caused by pK2-35S-NSm on tobacco leaf to be detected is observed in investigation.
There are 161 plants of generation HR reactions in 210 plants, be resistance single plant, 49 plants are reacted without HR, are susceptible single plant.It the results are shown in Table 1
Randomly choose 40 plants of building resistance ponds (R-pool) and sense respectively from 161 plants of resistance single plants and 49 plants of susceptible single plants
Property pond (S-pool), construction method be respectively from disease-resistant 40 plants of single plant single plants of selection every plant take 0.1g blade, amount to 4g
Resistance pond (R-pool) is constructed after mixing, sample presentation carries out transcript profile sequencing after being milled into powder.It is constructed and is felt using identical method
Property pond (S-pool) and sample presentation sequencing.
Transcript profile sequencing selects the BGI500 microarray dataset of Hua Da gene to carry out, and each sample sequencing in anti-/ pond obtains 12Gb
Sequencing data.
2, the screening of resistance linkage molecule label.
Anti-/sense pond data that transcript profile is obtained are compared respectively to K326 and are found altogether with reference to genome by SNP parting
SNP site of the Dealta value greater than 0.4 is 6047 total between anti-/ sense pond, and SNP focuses primarily upon No. 7 chromosomes of K326,
Therefore the antiplaque ospc gene that withers is positioned at No. 7 chromosome.It transfers Reads existing for SNP and is ginseng according to the genome of K326
It examines genome and carries out sequence assembly.High frequency SNP search is carried out using the genome sequence where these SNP, obtains contain SNP altogether
31 sequences of enrichment are for developing the relevant molecular labeling of anti-spotted wilt.The anti-spotted wilt parent material Polalta of extraction tobacco,
Sense spotted wilt parent material K326, the anti-source Polalta (♂) of tobacco spotted wilt hybridize the base of F1 with main cultivation susceptible variety K326 (♀)
Because of a group DNA, according to the 31 of acquisition primers, the polymorphism mark between electrophoresis screening parents is carried out after PCR amplification.Most
The PCR primer that two single stranded DNAs of the present invention by primer 1 and primer 2 form is obtained eventually, with the primer pair genome
DNA carries out PCR amplification, there is apparent polymorphism between parents.
PCR amplification system: 2 × Premix Ex TaqMix PCR Buffer, 12.5 μ L, 10 μm of 1 Hes of ol/L upstream primer
Each 2 μ L of 0.5 μ L, 25ng/ μ L template DNA of downstream primer 2 adds sterilizing distilled water to make 25 μ L of total volume；PCR response procedures: 94
DEG C initial denaturation 5min；It is recycled subsequently into 35: 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；After circulation terminates
72 DEG C of extension 10min；4 DEG C of preservations.
Electrophoresis result shows: the result shows that, forming using by primer 1 and primer 2, two single stranded DNAs from shown in Fig. 1
PCR labeled primer carries out PCR amplification to above-mentioned Polalta, K326 and F1 material, and all material is all expanded, without false yin
Property result occur, show this research institute verifying PCR reaction system it is completely normal, meet testing requirements.PCR product carries out electrophoresis
Comparative analysis, swimming lane 1 are disease-resistant parent Polalta, pcr amplification product after electrophoresis containing there are two band, wherein 490bp size
Band be apparent specific band, the band of 550bp size is non-specific band；Swimming lane 2 is the anti-source of tobacco spotted wilt
Polalta (♂) hybridizes F1 single plant, pcr amplification product three band after electrophoresis, size point with main cultivation susceptible variety K326 (♀)
Other 490bp and 570bp is apparent specific band, and the band of 550bp size is non-specific band；Swimming lane 3 is susceptible parent
This K326, pcr amplification product band containing there are two after electrophoresis, wherein the band of 570bp size is apparent specific band,
The band of 550bp size is non-specific band.Show that there are polymorphisms using this label between parents.Disease-resistant parent will be derived from
490bp specific band and from Susceptible parent 550bp band be tapped and recovered carry out cloning and sequencing obtain molecular labeling
Sequence SEQ ID No.3 and SEQ ID No.4.
3, hybridized using the anti-source Polalta (♂) of tobacco spotted wilt with main cultivation susceptible variety K326 (♀) and be returned, be selfed and obtain
210 single plants of BC6F3 offspring segregating population obtained verify polymorphism mark.
Its single plant is numbered, the DNA sample of 210 different single plants is extracted respectively, according to traditional method for extracting nucleic acid
CTAB method carries out PCR amplification using above-mentioned primer pair genomic DNA using genomic DNA after purification as template.PCR amplification
System: 2 × Premix Ex TaqMix PCR Buffer, 12.5 μ L, 10 μm of ol/L primers 1 and each 0.5 μ L, 25ng/ μ of primer 2
2 μ L of L template DNA adds sterilizing distilled water to make 25 μ L of total volume；PCR response procedures: 94 DEG C of initial denaturation 5min；Subsequently into 35
A circulation: 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；72 DEG C of extension 10min after circulation terminates；4 DEG C of preservations.It takes
PCR reaction product carries out electrophoresis detection verifying.
1 sequence of primer is Seq ID No.1:
RTSW_Marker3_F 5'-CCTATGAAGCAACGAAGCGATA-3'；
The primer 2 sequence is Seq ID No.2:
RTSW_Marker3_R 5'-GTTGACTGTTGACTGTTGATTAGAG-3'；
Electrophoresis result shows: Fig. 2 is the anti-spotted wilt site RTSW allelic gene type of identification tobacco that the applicant establishes
Codominant marker electrophoretic analysis.From the point of view of analyzing result, band brightness is high, and band is clearly easily recognized, stripe size difference
Obviously.If band of the pcr amplification product of tobacco to be identified after electrophoresis is identical as the banding pattern of Polalta, and contains size
For the band of 490bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate is anti-spotted wilt tobacco, and genotype is resistance
RTSW gene loci is homozygous (RTSW/RTSW)；If band and K326 of the pcr amplification product of tobacco to be identified after electrophoresis
Banding pattern is identical, and the band for being 570bp containing size, then tobacco to be identified is sense spotted wilt tobacco or candidate is sense spotted wilt cigarette
Grass, and genotype is that susceptible rtsw gene loci is homozygous (rtsw/rtsw)；If the pcr amplification product of tobacco to be identified is through electricity
Band after swimming contains band identical with Polalta and K326 banding pattern simultaneously, and size is respectively 490bp and 570bp, then to
Identify that tobacco is anti-spotted wilt tobacco or candidate is anti-spotted wilt tobacco, and genotype is disease-resistant RTSW gene loci heterozygosis
(RTSW/rtsw)。
By label testing result discovery, the single plant only containing 490bp banding pattern has 39 plants (resistance is homozygous, RTSW/RTSW),
Single plant only containing 570bp banding pattern has 50 plants (susceptible homozygosis, rtsw/rtsw), 121 plants of heterozygosis banding pattern (resistance locus heterozygosis).
Resistance detecting Purity the result shows that, in 210 single plants, 160 be disease-resistant plant, 50 be disease plant, with label examine
Survey result is consistent, and accuracy rate reaches 100%.By the way that Rapid identification tobacco antiplaque established by the present invention is withered ospc gene site
It is found after the molecular labeling result and Resistance Identification Comparative result of RTSW, the Resistance Identification result of 210 samples is completely the same, table
The bright reliable and stable accuracy of this method result is high, false positive results (being shown in Table 1) does not occur.
The identification of 1 BC6F3 population resistance of table and label testing result statistics
4, the verifying of anti-spotted wilt site RTSW allelic gene type
Resistance RTSW gene loci homozygosis (RTSW/ is randomly selected from 210 single plants of BC6F3 group in above-mentioned 3rd point
RTSW), genotype is that susceptible rtsw gene loci is homozygous (rtsw/rtsw), and genotype is disease-resistant RTSW gene loci heterozygosis
(RTSW/rtsw) each 5 plants of selfings are reserved seed for planting, and are obtained BC6F4 seed and every plant and are sowed 30 plants or so, to each single plant of BC6F4 into
The detection of row disease resistance, determines the allelic gene type of BC6F4 single plant.Randomly selected BC6F3 single plant offspring as can be seen from Table 2
Anti-/sense segregation ratio complies fully with the label testing result of BC6F3 single plant, shows that the reliable and stable accuracy of this method result is high,
There are not false positive results.
BC6F4 single plant disease resistance detects after 2 part BC6F3 individual plant selfing of table is reserved seed for planting
It can be seen that detection tobacco provided by the present invention is reliable to the method for spotted wilt resistance, easy, practical, in cigarette
There is important application prospect, while to cultivate to spotted wilt highly resistance in the assisted Selection of careless germplasm resource evaluation and breeding label
Tobacco bred provides reference frame.
The particular technique that is not specified in embodiment or condition, described technology or conditions according to the literature in the art
Or it is carried out according to product description.Reagents or instruments used without specified manufacturer is that can be obtained by purchase
Conventional products.
Above embodiments are merely to illustrate the present invention, and should not be taken as limiting the scope of the invention, all according to the present patent application
The equivalent changes and modifications that the scope of the patents is done, are all covered by the present invention.
Sequence table
<110>Yunnan Academy of Tobacco Agricultural Science
<120>with codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco
<141> 2019-09-29
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> RTSW_Marker3_F
<400> 1
cctatgaagc aacgaagcga ta 22
<210> 2
<211> 25
<212> DNA
<213> RTSW_Marker3_R
<400> 2
gttgactgtt gactgttgat tagag 25
<210> 3
<211> 490
<212> DNA
<213>artificial sequence ()
<400> 3
gttgactgtt gactgttgat tagagataaa acagatcaca agattcttga ttaatagtta 60
cttcttgatc aacttgaacc tgcttgcatt ataatatgag aaattacctt gactttcctt 120
tttaacaaat ggaagcaaaa atattataaa tgactaagac ggaaaaaaga tgttaacaat 180
cgaccagatc gattatttcc aaatttaatg aaagtagact ttgctataac aatgagcatg 240
agctggttaa taacaaattt agtagccatt gttgcttttt ttttccttcc caattagctt 300
atgcctatga tctcaatcct ctacaagaca tatatgttgg agttaaagac actaacgctt 360
ctggtaaatc atatccttct atagtcagga aagctttttt atcgaatttc ttcttcttcc 420
tattttaaat aatattgtat gttatattat agtgttgata aaagcatgta tcgcttcgtt 480
gcttcatagg 490
<210> 4
<211> 570
<212> DNA
<213>artificial sequence ()
<400> 4
gttgactgtt gactgttgat tagagataaa acagatcaca aggttctgga ttaacagtta 60
cttcttgatc aacttgaacc tgcttgtatt ttaatatgag aaattacctt gactttcctt 120
tttaacaaat ggaagcaaaa atattataaa tgactaagac ggaaacaaga tgttaacaat 180
tgaccagatc gaactataag ttatagactc ctcagctggt tgtttcgtaa aagaaaaaaa 240
agtataacac gctaactcct taccaaacaa acaattgttt ccaaatttaa tgaaagtaga 300
ctttgctata acaatgagca tgagctggtt aataacaact ttagtagcca ttgctgcttt 360
tttttcttcc caattagctt atgcctatga tctcaatcct ctacaagaca tatgtgttgg 420
agttaaagac actaacgctt ctggtaaatc atatccttct atagtcagga aagctttttt 480
accgaatttc ttctttttcc tattttatac aatattgtat gttatattat agtgttgata 540
aaagcatgta tcgcttcgtt gcttcatagg 570
Claims (6)
1. codominant marker's primer with the anti-spotted wilt site RTSW close linkage of tobacco, which is characterized in that the primer is by drawing
Two single stranded DNAs of object 1 and primer 2 composition；
1 sequence of primer is Seq ID No.1:
RTSW_Marker3_F 5'-CCTATGAAGCAACGAAGCGATA-3'；
The primer 2 sequence is Seq ID No.2:
RTSW_Marker3_R 5’-GTTGACTGTTGACTGTTGATTAGAG-3’。
2. identify the method for the anti-spotted wilt site RTSW allelic gene type of tobacco using primer as described in claim 1, it is special
Sign is that steps are as follows:
(1) respectively with tobacco to be identified, the genomic DNA of tobacco spotted wilt anti-source Polalta and spotted wilt susceptible variety K326
For template, PCR amplification is carried out to genomic DNA with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2, is being contained
The plant of RTSW gene expands to obtain specific clip size to be 490bp, and sequence is SEQ ID No.3；Be free of RTSW
The plant of gene expands to obtain specific clip size to be 570bp, and sequence is SEQ ID No.4；
(2) by the PCR product of amplification by electrophoresis detection or sequencing, identify as follows and determine that tobacco to be identified is anti-
Spotted wilt site RTSW allelic gene type:
1) if band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing is only identical as the banding pattern of Polalta, and
The band for being 490bp containing size, then tobacco to be identified is anti-spotted wilt tobacco or candidate is anti-spotted wilt tobacco, and genotype
It is homozygous for resistance RTSW gene loci；
2) if band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing is only identical as the banding pattern of K326, and contains
Having size is the band of 570bp, then tobacco to be identified is sense spotted wilt tobacco or candidate is sense spotted wilt tobacco, and genotype is
Susceptible rtsw gene loci is homozygous；
3) if band of the pcr amplification product of tobacco to be identified after electrophoresis or sequencing contains and Polalta and K326 simultaneously
The identical band of banding pattern, and size is respectively 490bp and 570bp, then tobacco to be identified is anti-spotted wilt tobacco or candidate is anti-
Spotted wilt tobacco, and genotype is disease-resistant RTSW/rtsw, gene loci heterozygosis.
3. codominant marker's primer described in claim 1 with the anti-spotted wilt site RTSW close linkage of tobacco is in tobacco spotted wilt
Application in localization of disease resistance genes, clone or the anti-spotted wilt kind of breeding tobacco.
4. identifying the side of the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer as claimed in claim 2
Method, which is characterized in that when extracting tobacco DNA to be identified, using the seed of tobacco, blade, root, any one position of floral organ or several
The tissue at a position.
5. identifying the side of the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer as claimed in claim 2
Method, which is characterized in that described to carry out PCR amplification, PCR with the PCR primer being made of two single stranded DNAs of primer 1 and primer 2
Reaction system it is as follows: respectively with tobacco to be identified, the base of tobacco spotted wilt anti-source Polalta and spotted wilt susceptible variety K326
Because group DNA is template, PCR amplification system: 2 × Premix Ex TaqMix PCR Buffer, 12.5 μ L, 10 μm of ol/L primers 1
With each 1 μ L of 0.5 μ L, 50ng/ μ L template DNA of primer 2, sterilizing distilled water is added to make 25 μ L of total volume；PCR response procedures are as follows: 94
DEG C initial denaturation 5min；It is recycled subsequently into 35: 94 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C of extension 30s；After circulation terminates
72 DEG C of extension 10min；4 DEG C of preservations.
6. identifying the side of the anti-spotted wilt site RTSW allelic gene type of tobacco using the primer as claimed in claim 2
Method, which is characterized in that the PCR primer that two single stranded DNAs by primer 1 and primer 2 form be included in Seq ID No.1 or
5 ' the ends or 3 ' ends of Seq ID No.2 increase separately the primer for the essentially identical DNA fragmentation that 1~30 base amplification obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910934802.2A CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910934802.2A CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499389A true CN110499389A (en) | 2019-11-26 |
| CN110499389B CN110499389B (en) | 2023-03-10 |
Family
ID=68593065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910934802.2A Active CN110499389B (en) | 2019-09-29 | 2019-09-29 | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499389B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452905A (en) * | 2019-08-22 | 2019-11-15 | 云南省烟草农业科学研究院 | A kind of extracting method and its application improving tobacco DNA deposition efficiency |
| CN113881799A (en) * | 2021-10-25 | 2022-01-04 | 云南省烟草农业科学研究院 | Functional molecular marker for screening/detecting main effect resistance locus of tobacco root black rot and application thereof |
| WO2022262179A1 (en) * | 2021-11-08 | 2022-12-22 | 云南省烟草农业科学研究院 | Anti-spotted-wilt tobacco plant without linkage drag and breeding method therefor |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140040374A (en) * | 2012-09-26 | 2014-04-03 | 서울대학교산학협력단 | Primer set, method and kit for selecting tswv-resistant pepper cultivar |
| CN106119397A (en) * | 2016-08-26 | 2016-11-16 | 北京通州国际种业科技有限公司 | Fructus Lycopersici esculenti spotted wilt resistant gene Sw 5b close linkage SNP site obtains and marker development |
| CN106613136A (en) * | 2016-11-16 | 2017-05-10 | 云南省烟草农业科学研究院 | Method for screening tobacco plants resistant to tomato spotted wilt virus |
| CN107254477A (en) * | 2017-06-05 | 2017-10-17 | 云南省烟草农业科学研究院 | A kind of method that disease-resistant gene screening is carried out using tomato spotted wilf virus NSm genes |
| CN107400674A (en) * | 2017-06-05 | 2017-11-28 | 云南省烟草农业科学研究院 | A kind of method using tomato spotted wilf virus NSm identified for genes tobacco resistances |
| CN109055511A (en) * | 2018-09-19 | 2018-12-21 | 天津市农业生物技术研究中心 | A kind of detection method of anti-tomato spotted wilf virus gene SW-5b |
| KR102000469B1 (en) * | 2018-06-19 | 2019-07-16 | 대한민국 | Tomato spotted wilt virus disease resistance gene Tsw specific primer set for pepper cultivar and uses thereof |
-
2019
- 2019-09-29 CN CN201910934802.2A patent/CN110499389B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20140040374A (en) * | 2012-09-26 | 2014-04-03 | 서울대학교산학협력단 | Primer set, method and kit for selecting tswv-resistant pepper cultivar |
| CN106119397A (en) * | 2016-08-26 | 2016-11-16 | 北京通州国际种业科技有限公司 | Fructus Lycopersici esculenti spotted wilt resistant gene Sw 5b close linkage SNP site obtains and marker development |
| CN106613136A (en) * | 2016-11-16 | 2017-05-10 | 云南省烟草农业科学研究院 | Method for screening tobacco plants resistant to tomato spotted wilt virus |
| CN107254477A (en) * | 2017-06-05 | 2017-10-17 | 云南省烟草农业科学研究院 | A kind of method that disease-resistant gene screening is carried out using tomato spotted wilf virus NSm genes |
| CN107400674A (en) * | 2017-06-05 | 2017-11-28 | 云南省烟草农业科学研究院 | A kind of method using tomato spotted wilf virus NSm identified for genes tobacco resistances |
| KR102000469B1 (en) * | 2018-06-19 | 2019-07-16 | 대한민국 | Tomato spotted wilt virus disease resistance gene Tsw specific primer set for pepper cultivar and uses thereof |
| CN109055511A (en) * | 2018-09-19 | 2018-12-21 | 天津市农业生物技术研究中心 | A kind of detection method of anti-tomato spotted wilf virus gene SW-5b |
Non-Patent Citations (4)
| Title |
|---|
| CHANGJUN HUANG 等: ""From Player to Pawn: Viral Avirulence Factors Involved in Plant Immunity"", 《VIRUSES》 * |
| CHANGJUN HUANG 等: ""Non-Structural Protein NSm of Tomato Spotted Wilt Virus Is an Avirulence Factor Recognized by Resistance Genes of Tobacco and Tomato via Different Elicitor Active Sites"", 《VIRUSES》 * |
| WENYANG ZHAO 等: ""Plasmodesmata targeting and intercellular trafficking of Tomato spotted wilt tospovirus movement protein NSm is independent of its function in HR induction"", 《J GEN VIROL》 * |
| 于海芹 等: ""云南省主要烟区正番茄斑萎病毒属(Orthotospovirus)病毒的调查和检测"", 《基因组学与应用生物学》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452905A (en) * | 2019-08-22 | 2019-11-15 | 云南省烟草农业科学研究院 | A kind of extracting method and its application improving tobacco DNA deposition efficiency |
| CN110452905B (en) * | 2019-08-22 | 2023-06-02 | 云南省烟草农业科学研究院 | Extraction method for improving tobacco DNA precipitation efficiency and application thereof |
| CN113881799A (en) * | 2021-10-25 | 2022-01-04 | 云南省烟草农业科学研究院 | Functional molecular marker for screening/detecting main effect resistance locus of tobacco root black rot and application thereof |
| WO2022262179A1 (en) * | 2021-11-08 | 2022-12-22 | 云南省烟草农业科学研究院 | Anti-spotted-wilt tobacco plant without linkage drag and breeding method therefor |
| US20240049674A1 (en) * | 2021-11-08 | 2024-02-15 | Yunnan Academy Of Tobacco Agricultural Sciences | Tobacco Plant Resistant To Spotted Wilt Disease Without Linkage Drag And Method For Breeding The Same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499389B (en) | 2023-03-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN108486276B (en) | Pepper maturity SNP molecular marker and application thereof | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| Yagi et al. | QTL analysis for resistance to bacterial wilt (Burkholderia caryophylli) in carnation (Dianthus caryophyllus) using an SSR-based genetic linkage map | |
| CN110499389A (en) | With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN112481275A (en) | Wheat stripe rust resistant gene yrZ15-1370 and molecular marker and application thereof | |
| CN106520762B (en) | Molecular labeling and application with the anti-anthrax-bacilus leaf blight gene loci close linkage of apple | |
| CN106957897B (en) | Molecular marking method of cucumber young leaf yellowing gene | |
| CN105907884A (en) | Rice blast resistant gene Pita specific molecular marker of rice and application | |
| CN109929945A (en) | The molecular labeling BrSF2604 primer and its application in cabbage type rape florescence and maturity period main effect QTL site | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN106498068B (en) | Co-dominant SSR marker closely linked with tobacco TMV resistance gene N and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| Bo et al. | Promoter variation in a homeobox gene, CpDll, is associated with deeply lobed leaf in Cucurbita pepo L. | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN110257546A (en) | One rice seedling salt tolerant new gene cluster qST12PokkaliAnd application | |
| CN107338293B (en) | KaSP molecular marker related to resistance of maize rough dwarf disease and application thereof | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN108866233A (en) | For identifying marker site, primer pair, kit and application of the peach to disease-resistant/susceptible character of Meloidogyne incognita | |
| CN108913809A (en) | InDel molecular marked compound, detection method and the application of blast resistant gene Pid3-A4 | |
| CN108203737A (en) | The SNP marker of corn tassel row number related gene GRMZM2G098557 and application | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |