CN110117673A - The molecular labeling of the short bar character site of cabbage type rape and its application - Google Patents

The molecular labeling of the short bar character site of cabbage type rape and its application Download PDF

Info

Publication number
CN110117673A
CN110117673A CN201910417799.7A CN201910417799A CN110117673A CN 110117673 A CN110117673 A CN 110117673A CN 201910417799 A CN201910417799 A CN 201910417799A CN 110117673 A CN110117673 A CN 110117673A
Authority
CN
China
Prior art keywords
seq
cabbage type
sequence
short bar
type rape
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910417799.7A
Other languages
Chinese (zh)
Other versions
CN110117673B (en
Inventor
管荣展
杨茂
樊浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Agricultural University
Original Assignee
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing Agricultural University filed Critical Nanjing Agricultural University
Priority to CN201910417799.7A priority Critical patent/CN110117673B/en
Priority to CN202110499867.6A priority patent/CN113151562B/en
Priority to CN202110500775.5A priority patent/CN112981001B/en
Priority to CN202110499857.2A priority patent/CN113151561B/en
Publication of CN110117673A publication Critical patent/CN110117673A/en
Application granted granted Critical
Publication of CN110117673B publication Critical patent/CN110117673B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Mycology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses the molecular labeling of the short bar character site of cabbage type rape and its applications, and in particular to molecular labeling BnC04Y1361, BnC04Y2255, BnC04Y2498 and the BnC04Y2641 in the short bar site of rape and its application.In F2、F2BC1And F3In group, the short bar character of cabbage type rape is in extremely significant related, F to this four molecular labelings2、F2BC1And F3Single plant genotype is consistent with phenotype, therefore this four molecular labelings have huge application prospect in short bar rape assisted selection from now on.

Description

The molecular labeling of the short bar character site of cabbage type rape and its application
Technical field
The present invention relates to field of plant breeding, and in particular to the short bar site of rape and the compact linkage molecule with short bar site Mark BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 and its application.
Background technique
Plant-type Breeding played most important effect in crop yield raising.The 1960s and the seventies " green revolution " just refers to and short bar character gene is introduced into the crops such as wheat, rice, so that its yield worldwide It is greatly improved.Long-stalked crop kind easily lodges in production, this meeting is so that the yield of crop declines 16% Left and right.Short stalk crop kind lodging resistance is strong, and coefficient of harvest greatly improves.Therefore, short stalk crop breed breeding is crop breeding Highly important content.
Cabbage type rape (Brassica napus) is important oil crops.The rape applied in production belongs to high bar class Type, plant height is generally between 1.8 meters -2.2 meters.High stalk rape variety easily lodges, and influences photosynthesis, and sclerotiniose is often big Occur, causes Severe Reduction；Meanwhile rape plant height is too high, is also unfavorable for mechanized harvest, hinders mechanization production.Oil of short stem For dish because its plant height is shorter, power resistant to lodging is strong, and harvest index is high, is suitable for mechanized harvest, it may also reduce disease.Therefore, mesh Continue to cultivate rape dwarfted varieties on preceding Rape-seed production.And cultivate short bar rape variety, it is necessary to appropriate rape short resources Resource, and corresponding molecular labeling is developed, as breeding technique, improve breeding efficiency.
The research of the short bar character of rape is also fewer at present.In past research, it is believed that rape plant height heredity is more complicated, Mainly by controlled by multiple genes.In limited research, the key-gene site of several control plant heights has also been excavated.Foisset etc. (1995) a cabbage type rape Dwarf mutant site Bzh is obtained, genetically additive effect gene is presented in the site.Shi Shu Steady two main effect site DS-1 and DS-2 for waiting (1995) to have found control cabbage type rape plant height.Wang Maolin etc. (2004) discovery Dwarf Mutant NDF-1, the mutation low body bar character are controlled by 1 pair of additive effect gene.Pu Huiming etc. (1995) is reported The short bar material introduced from Australian company, is named as short source 1, plant height heredity is controlled by 1 pair of dominant gene.Mei Desheng The Dwarf mutant 99CDAM of one plant of plant height 85cm or so, short bar character master are found in cabbage type rape strain Deng (2006) It to be controlled by 3 pairs of recessive genes, and there are mother cell mass effects.Wang Yankun etc. (2016) has found that control cabbage type rape is short The new main effect site BnDWF1 and BnDWF/DCL1 of two of bar is 1 pair of dominant gene control.
Although scholars also to the heredity of rape dwarf character and breeding, have made some positive explorations, short bar rape is educated Kind makes a breakthrough not yet, it is also necessary to which continual exploitation controls new main effect site and its molecular labeling of the short bar character of rape, for oil Dish breeding wheat for semidwarfness provides basis.The compact linkage molecule label for developing the new main effect site of the short bar of rape, can sieve in rape seedling It selects Dwarfing Gene type, improves efficiency of selection, the accuracy of selection can also be improved in segregating generation.Therefore, the master of rape plant height The molecular markers development and application of imitating the close linkage in site are the key technologies of rape breeding wheat for semidwarfness.
Present invention finds the new main effect sites that one controls the short bar character of cabbage type rape, and have developed it and closely connected The molecular marking technique of lock.
Summary of the invention
The object of the present invention is to provide be located at the novel site that the short bar character of rape is controlled on 04 chromosome of cabbage type rape C.
It is a further object of the present invention to provide the molecular labelings in the short bar character new gene site of cabbage type rape BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 primer pair.
A further object of the present invention be to provide the short bar site of cabbage type rape molecular labeling BnC04Y1361, The short bar rape and the short bar rape of breeding of BnC04Y2255, BnC04Y2498 and BnC04Y2641 or its primer pair described in detection Application in kind.
The purpose of the present invention can be achieved through the following technical solutions:
One control short bar site Bndwarf2 of rape, the site Bndwarf2 is located at 04 chromosome of cabbage type rape C Upper BnaC04:41993194bp-43723070bp.The close linkage label BnC04Y1361 is located at cabbage type rape C 04 42375505bp-42375810bp on chromosome；The close linkage label BnC04Y2255 is located at the dye of cabbage type rape C 04 42635056bp-42635376bp on colour solid；The close linkage label BnC04Y2498 is located at the dyeing of cabbage type rape C 04 42697768bp-42698073bp on body；The close linkage label BnC04Y2641 is located at 04 chromosome of cabbage type rape C Upper 42724075bp-42724380bp.Described close linkage label BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 is respectively as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4.
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, BnC04Y2498 and BnC04Y2641, the upstream primer sequence of the molecular labeling of this four close linkages are respectively Seq Y1361- F, Seq Y2255-F, Seq Y2498-F and Seq Y2641-F, downstream primer sequence are respectively Seq Y1361-R, Seq Y2255-R, Seq Y2498-R and Seq Y2641-R,
The sequence of Seq Y1361-F is as shown in SEQ ID NO.5；
The sequence of Seq Y1361-R is as shown in SEQ ID NO.6；
The sequence of Seq Y2255-F is as shown in SEQ ID NO.7；
The sequence of Seq Y2255-R is as shown in SEQ ID NO.8；
The sequence of Seq Y2498-F is as shown in SEQ ID NO.9；
The sequence of Seq Y2498-R is as shown in SEQ ID NO.10；
The sequence of Seq Y2641-F is as shown in SEQ ID NO.11；
The sequence of Seq Y2641-R is as shown in SEQ ID NO.12.
Its sequence are as follows:
Seq Y1361-F:CATCACGGTTTGAGTTTC (5 ' -3 ')
Seq Y1361-R:TTCTTAATTTCGGCTAAG (5 ' -3 ')
Seq Y2255-F:ATTTGGTCTCCATAAGTATT (5 ' -3 ')
Seq Y2255-R:TGAGTCAGTCGTCTTTGTT (5 ' -3 ')
Seq Y2498-F:CCAGTTATAAAGCGCAC (5 ' -3 ')
Seq Y2498-R:TGATTCTTGAAAGGTCC (5 ' -3 ')
Seq Y2641-F:GGACAGAAAATCCAGAG (5 ' -3 ')
Seq Y2641-R:TGCCAAGATGTACCAAG (5 ' -3 ')
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, BnC04Y2498 and BnC04Y2641, answering in the kind and kind quality detection containing the short bar character site of cabbage type rape With.
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, Application of the BnC04Y2498 and BnC04Y2641 in the short bar rape variety of breeding and germplasm.
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, BnC04Y2498 and BnC04Y2641 primer pair, the upstream primer sequence of the molecular labeling of this four close linkages are respectively Seq Y1361-F, Seq Y2255-F, Seq Y2498-F and Seq Y2641-F, downstream primer sequence be respectively Seq Y1361-R, Seq Y2255-R, Seq Y2498-R and Seq Y2641-R.
The sequence of Seq Y1361-F is as shown in SEQ ID NO.5；
The sequence of Seq Y1361-R is as shown in SEQ ID NO.6；
The sequence of Seq Y2255-F is as shown in SEQ ID NO.7；
The sequence of Seq Y2255-R is as shown in SEQ ID NO.8；
The sequence of Seq Y2498-F is as shown in SEQ ID NO.9；
The sequence of Seq Y2498-R is as shown in SEQ ID NO.10；
The sequence of Seq Y2641-F is as shown in SEQ ID NO.11；
The sequence of Seq Y2641-R is as shown in SEQ ID NO.12；
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, BnC04Y2498 and BnC04Y2641 primer pair, in kind and kind quality detection containing the short bar character site of cabbage type rape In application.
The molecular labeling BnC04Y1361, BnC04Y2255 in the short bar site of cabbage type rape of the present invention, Application of the BnC04Y2498 and BnC04Y2641 primer pair in the short bar rape variety of breeding and germplasm.
A method of short bar cabbage type rape being detected using molecular labeling of the present invention or primer pair, utilizes the present invention The primer pair amplifies rapeseed gene group DNA, amplified production detect whether to obtain after 40% polyacrylamide gel electrophoresis The amplified fragments of parent MB1501-1.If obtaining the amplified fragments of parent MB1501-1, show that there are of the present invention Short bar rape.
A method of using molecular labeling of the present invention or the short bar cabbage type rape variety of primer pair breeding, preferably use NC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 primer pair amplifies rapeseed gene group DNA, amplification produce Object detects whether the amplified fragments for obtaining MB1501-1 after 40% polyacrylamide gel electrophoresis.If obtaining MB1501-1 Amplified fragments, then show to predict that the rape is short bar rape there are the short bar site of cabbage type rape of the present invention.If The amplified fragments for obtaining parent ZS11, then show to predict that the rape is there are the high bar site of cabbage type rape of the present invention High bar rape.
The chain molecular labeling of cabbage type rape Dwarfing gene of the present invention screens through the following steps:
(1) genetic group constructs: finding one plant of Dwarf mutant MB1501- in the selfing mostly cabbage type rape strain in generation 1, hybridized using MB1501-1 in conventional excellent variety double 11, obtains hybrid F1, F1Selfing obtains F2, F2Hybridize with ZS11 To F2BC1, F2Selfing obtains F3, to F1、F2、F2BC1And F3Carry out phenotype investigation；
(2) cabbage type rape F2、F2BC1And F3Group's phenotype test: to above-mentioned F2、F2BC1And F3Totally 1947 lists in group Strain carries out Phenotypic Observation and economical character investigation；
(3) building of genetic map: selection F265 single-strain blade DNA samples in group are used for the data of SNP marker It obtains, linkage map is constructed using JoinMap4.0 mapping software；
(4) phenotypic data for being used for the DNA sample of SNP chip is determined together with its SNP genetic linkage map modal data The site Bndwarf2 of position analysis, the control short bar character of cabbage type rape is positioned to C04 linkage group, is located between positioning area In the section of 42697814bp-42698038bp；
(5) the SSR information for utilizing 04 chromosome 41993194bp-43723070bp of rape C, designs molecular labeling；
(6) according to F2、F2BC1And F3Group's phenotypic data and molecular marker data find close linkage co-dominant molecular mark Remember BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641, and its hereditary banding pattern is high-visible.
The utility model has the advantages that
The present invention is located at cabbage type rape C 04 chromosome 41993194bp- for first identified one in the world The short bar site of cabbage type rape is controlled in the region 43723070bp, while finding the co-dominant molecular with short bar site close linkage BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 are marked, these molecular labelings are in F2、F2BC1And F3Group The performance of body makes it have very important value in the short bar breeding of cabbage type rape.
1, first identified one is located at cabbage type rape C 04 chromosome 41993194bp-43723070bp region internal control The short bar site of cabbage type rape processed, while the codominant marker BnC04Y1361 of discovery and short bar site close linkage, BnC04Y2255, BnC04Y2498 and BnC04Y2641；
2, in F2、F2BC1And F3In group, the short bar character of cabbage type rape and this four molecular labelings in extremely significant related, F2、F2BC1And F3Single plant genotype is consistent with phenotype, therefore this four molecular labelings are educated in short bar rape assisted Selection from now on There is huge application prospect in kind；
3, the present invention can find homozygous short bar rape in cabbage type rape, have very great help to short bar Plant-type Breeding.
Detailed description of the invention
Fig. 1: short bar rape phenotypic map.
Fig. 2: molecular labeling BnC04Y1361 is to F2Part single plant Genotyping；Wherein 1 banding pattern is expanded for ZS11,2 are MB1501-1 expands banding pattern, and 4,8,9 and 12 expand banding pattern for high bar rape, and 5-7 is that homozygous short bar rape expands banding pattern, 3,10 and 11 expand banding pattern for the short bar of heterozygosis.
Fig. 3: molecular labeling BnC04Y2255 is to F2Part single plant Genotyping；Wherein 1 for MB15010-1 expand banding pattern, 2 Banding pattern is expanded for ZS11,3,10 and 11 expand banding pattern for high bar rape, and 8 and 12 expand banding pattern for homozygous short bar rape, and 4,5,6,7 Banding pattern is expanded with 9 for the short bar rape of heterozygosis.
Fig. 4: molecular labeling BnC04Y2498 is to F2Part single plant Genotyping；Wherein 1 banding pattern is expanded for MB1501,2 are ZS11 expands banding pattern, and 4,11 and 12 expand banding pattern for homozygous short bar rape, and 5 and 10 expand banding pattern for high bar rape, and 3 and 6-9 is The short bar rape of heterozygosis expands banding pattern.
Fig. 5: molecular labeling BnC04Y2641 is to F2Part single plant Genotyping；Wherein 11 banding pattern is expanded for ZS11,12 are MB1501-1 expands banding pattern, and 1 expands banding pattern for homozygous short bar rape, and 4-6 is that high bar rape expands banding pattern, and 2,3 and 7-10 is miscellaneous Close short bar rape amplification banding pattern.
Specific embodiment
Embodiment 1
The invention is described further with reference to the accompanying drawings of the specification.
Embodiment 1
The acquisition in the short bar site of cabbage type rape:
(1) genetic group constructs
Double 11 hybridized in using two brassica napus " MB1501-1 ", obtains hybrid F1, F1Selfing obtains 284 F2Single plant, F2Hybridize to obtain 880 plants of F with ZS112BC1, F2Selfing obtains 783 F altogether3Single plant.
(2) cabbage type rape F2、F2BC1And F3Group's phenotype test
To above-mentioned F2、F2BC1And F3Totally 1947 single plants carry out Phenotypic Observation and economical character investigation in group.Short bar Rape phenotypic map is as shown in Figure 1.
(3) building of genetic map
Select F265 single-strain blade DNA samples in group are used for the data acquisition of SNP marker, wherein it is high for having 15 plants Rod-type single plant and 50 plants short rod-type single plant.SNP chip shares 52157 sites, but this F2The DNA sample of group is not in institute Having has polymorphism on site.In removal invalid flag (no polymorphic marker and individual gene type proportion are greater than 95%) Afterwards, remaining 7457 labels that there is polymorphism, SNP genetic linkage maps building can be carried out.It is mapped with JoinMap4.0 soft Part constructs linkage map.
(4) result and analysis
The phenotypic data for the DNA sample that 65 are used for SNP chip is determined together with its SNP genetic linkage map modal data The site Bndwarf2 of position analysis, the control short bar character of cabbage type rape is positioned to C04 linkage group, is located between positioning area In the section of BnaC04:42697814bp-42698038bp.
Embodiment 2
The acquisition of the short close molecular labeling in bar site of cabbage type rape:
(1) molecular markers development
Site of short stem is located in the 42697814bp- of 04 chromosome of rape C by this research and utilization SNP chip technology In 42698038bp section, downloading rape refers to genome sequence, using 1.3 site software lookup SSR SSR hunter, Its upstream and downstream respectively increases 150bp design primer, and SSR marker site is named as " site BnC04Y+SSR ", using Primer 5.0 software of Premier designs multiple molecular labelings in the region BnaC04:41993194bp-43723070bp.
(2)F2、F2BC1And F3Group's molecular markers for identification
F is extracted using CTAB method2The genomic DNA of group's rape material blade, PCR reaction system (10ul), wherein containing There are 0.5ulDNA template, upstream and downstream primer (1mmol/L) each 0.25ul, 5ulMix and 4ulddH2O.PCR response procedures: 95 DEG C denaturation 5min；Then carry out 95 DEG C of denaturation 30s of 35 circulations, the annealing of Tm value 30s, 72 DEG C of extension 30s；Extend again through 72 DEG C 10min；Last 4 DEG C of preservations.40% polyacrylamide gel electrophoresis of pcr amplification product, silver staining colour developing.Film is in BIO-RAD Scanning analysis in visadoc3.0 (Bio-RAD, USA) imaging system.
(3) result and analysis
In multiple molecular labelings of design, BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 points Son label reaches 99% with phenotype consistency, it is believed that this four molecular labelings and the short bar site of cabbage type rape are close linkages. In F2And F3Respectively there are three types of banding pattern, BnC04Y1361 stripe size is respectively four compact linkage molecule labels of this in group 170bp, 176bp and possessing two bands simultaneously, the single plant for possessing 170bp banding pattern is homozygous short bar single plant (36.64 ± 1.86cm), The single plant for possessing 176bp banding pattern is high bar rape (193.54 ± 6.80cm), while it is short for having 170bp and 176bp band Bar heterozygote (105.30 ± 5.16cm)；BnC04Y2255 stripe size is respectively 212bp, 191bp and possesses two bands simultaneously, The single plant for possessing 212bp banding pattern is homozygous short bar single plant (36.64 ± 1.86cm), and the single plant for possessing 191bp banding pattern is high bar oil Dish (193.54 ± 6.80cm), while having 212bp and 191bp band is short bar heterozygote (105.30 ± 5.16cm)； BnC04Y2498 stripe size is respectively 231bp, 225bp and possesses two bands simultaneously, and it is homozygous for possessing the single plant of 231bp banding pattern Short bar single plant (36.64 ± 1.86cm), the single plant for possessing 225bp banding pattern is high bar rape (193.54 ± 6.80cm), is had simultaneously Having 231bp and 225bp band is short bar heterozygote (105.30 ± 5.16cm)；BnC04Y2641 stripe size is respectively 227bp, 233bp and possessing two bands simultaneously, the single plant for possessing 227bp banding pattern is homozygous short bar single plant (36.64 ± 1.86cm), The single plant for possessing 233bp banding pattern is high bar rape (193.54 ± 6.80cm), while it is short for having 227bp and 233bp band Bar heterozygote (105.30 ± 5.16cm).The upstream primer sequence of the molecular labeling of this four close linkages is respectively Seq Y1361-F, Seq Y2255-F, Seq Y2498-F and Seq Y2641-F, downstream primer sequence be respectively Seq Y1361-R, Seq Y2255-R, Seq Y2498-R and Seq Y2641-R.
Embodiment 3
Application of the compact linkage molecule label in the selection of short bar rape:
(1) this genome amplification of parents detects
It is respectively that (BnC04Y1361 equipotential band is 170bp to parent " MB1501-1 " for verifying short bar rape parent； BnC04Y2255 equipotential band is 212bp；BnC04Y2498 equipotential band is 231bp；BnC04Y2641 equipotential band is 227bp, plant height are 36.64 ± 1.86cm), (BnC04Y1361 equipotential band is 176bp to parent ZS11；BnC04Y2255 equipotential Band is 191bp；BnC04Y2498 equipotential band is 225bp；BnC04Y2641 equipotential band is 233bp, plant height 193.54 ± 6.80cm), as shown in Figure 2-5.
(2) group's augmentation detection and labeled analysis
With two above, parent hybridizes, and obtains F1Grow up to a F after planting for seed1For single plant, self-fertility is received Obtain F2For seed, the latter's plantation grows up to the F comprising separation character2Group, F2Selfing obtains F3Segregating population, F2With ZS11 Hybridization obtains F2BC1Group, to F2、F2BC1And F3Group's single plant economical character and phenotype test.
Every part of F is extracted using CTAB method respectively2The genomic DNA of single-strain blade.PCR reaction system (10ul), wherein containing There are 0.5ulDNA template, upstream and downstream primer (1mmol/L) each 0.25ul, 5ulMix and 4ulddH2O.PCR response procedures: 95 DEG C denaturation 5min；Then carry out 95 DEG C of denaturation 30s of 35 circulations, the annealing of Tm value 30s, 72 DEG C of extension 30s；Extend again through 72 DEG C 10min；Last 4 DEG C of preservations.40% polyacrylamide gel electrophoresis of pcr amplification product, silver staining colour developing.Film is in BIO-RAD Scanning analysis in visadoc3.0 (Bio-RAD, USA) imaging system.Analysis BnC04Y1361, BnC04Y2255, Type of strip of the BnC04Y2498 and BnC04Y2641 in parent MB1501-1 and ZS11.
(3) result and analysis
In the cross combination offspring F of MB1501-1 and ZS112、F2BC1And F3Because in the detection of type, discovery BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 molecular labeling and phenotype consistency reach 99%.Results showed that with BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 Molecular Prediction rape height bar have preferable pre- Survey effect.
Sequence table
<110>Agricultural University Of Nanjing
<120>molecular labeling of the short bar character site of cabbage type rape and its application
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 306
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 1
attggataag atgaaaaata atagtagttt atataatttc aaatttttaa taatatttca 60
aaaagttact tttatctagt tgttagtgtg cccttttaaa agggtatcgc atcacggttt 120
gagtttcgga atgaacatat ttttttaaaa atatatgtaa atatatatat atatatcaaa 180
acgacgtcgt cttatcttgt taacggttga ctaacttctg ttagagtcta agaatctcag 240
ttaagagact ggggttaaga accgtctctt agccgaaatt aagaatccca gttaagagac 300
tgatgt 306
<210> 2
<211> 321
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 2
ttaaatttat ttggtctcca taagtattta ttttatattt atttggttaa gtataagcat 60
ttattaggaa gaatgatata cccaaaaaac ggaacgcgtc agctgcacca aacacggcgt 120
ctctctcaaa gatcatcatt tataagtttc cttcttcttc ttcttcttct tcctctgctc 180
aacaaagacg actgactcat cacgactgta acagaaaact cgctggagaa gccaccatgt 240
gcgaagatga ctgccgtcct ctcggtttcc tcttaggcct ccctttcgcc ttcttatctc 300
tccttctctc catcgtcggt g 321
<210> 3
<211> 306
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 3
tgtgtttgca ttttagttca ttattcaact aaaatgaaac tttgttccag ttataaagcg 60
cacttatccg ggttggcaag aaaaaccatc cctagtaata acaaaaacat aagcttcgtc 120
tcactaattc atgagtactc aattatcaga atatattttg tagatttgat gtggattgga 180
agtgagcatt atcacttggc ctttcgactt tagacatgga atcatggcat ttccgcatat 240
ggttaaaaca aaaaggacct ttcaagaatc acacacccat ttaattgttt tttttttttt 300
tttttt 306
<210> 4
<211> 306
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 4
atatgggaaa aagccaaaac gtttacttat ccgtcatcat agctggacag aaaatccaga 60
gttcaaaaag ttgttacaaa aaataatagc aaaacggacc caacattcaa aagttcttaa 120
gaaatcgaaa acaagcaggg aaggagaaat agagagacgt caataatcaa cagattagtc 180
gacctcttcg atcttagggc cagcaccgcc tgaggcagga ggagcatcat cgtccatccc 240
tgcggcttca ccaccagctc cttggtacat cttggcaatg attgggttgc agatgctctc 300
caactc 306
<210> 5
<211> 18
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 5
catcacggtt tgagtttc 18
<210> 6
<211> 18
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 6
ttcttaattt cggctaag 18
<210> 7
<211> 20
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 7
atttggtctc cataagtatt 20
<210> 8
<211> 19
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 8
tgagtcagtc gtctttgtt 19
<210> 9
<211> 17
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 9
ccagttataa agcgcac 17
<210> 10
<211> 17
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 10
tgattcttga aaggtcc 17
<210> 11
<211> 17
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 11
ggacagaaaa tccagag 17
<210> 12
<211> 17
<212> DNA
<213>cabbage type rape (Brassica napus)
<400> 12
tgccaagatg taccaag 17

Claims (12)

1. the molecular labeling in the short bar site of cabbage type rape, which is characterized in that the molecular labeling be BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 are located on 04 chromosome of cabbage type rape C, this four close linkages The upstream primer sequence of molecular labeling is respectively Seq Y1361-F, Seq Y2255-F, Seq Y2498-F and Seq Y2641-F, Downstream primer sequence is respectively Seq Y1361-R, Seq Y2255-R, Seq Y2498-R and Seq Y2641-R；Wherein:
The sequence of Seq Y1361-F is as shown in SEQ ID NO.5；
The sequence of Seq Y1361-R is as shown in SEQ ID NO.6；
The sequence of Seq Y2255-F is as shown in SEQ ID NO.7；
The sequence of Seq Y2255-R is as shown in SEQ ID NO.8；
The sequence of Seq Y2498-F is as shown in SEQ ID NO.9；
The sequence of Seq Y2498-R is as shown in SEQ ID NO.10；
The sequence of Seq Y2641-F is as shown in SEQ ID NO.11；
The sequence of Seq Y2641-R is as shown in SEQ ID NO.12.
2. the molecular labeling in the short bar site of cabbage type rape according to claim 1, short containing the cabbage type rape Application in the kind and kind quality detection of bar character site.
3. the molecular labeling in the short bar site of cabbage type rape according to claim 1, in the short bar rape variety of breeding and kind Application in matter.
4. the short bar rape selection of Wild cabbage type according to claim 1, which is characterized in that whether determine cabbage type rape Have molecular labeling described in claim 1, and corresponding selection is made according to the molecular labeling detected.
5. the molecular labeling primer pair in the short bar site of cabbage type rape, which is characterized in that the molecular labeling primer to for BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641 are located on 04 chromosome of cabbage type rape C, this four The upstream primer sequence of the molecular labeling of close linkage be respectively Seq Y1361-F, Seq Y2255-F, Seq Y2498-F and Seq Y2641-F, downstream primer sequence are respectively Seq Y1361-R, Seq Y2255-R, Seq Y2498-R and Seq Y2641- R, in which:
The sequence of Seq Y1361-F is as shown in SEQ ID NO.5；
The sequence of Seq Y1361-R is as shown in SEQ ID NO.6；
The sequence of Seq Y2255-F is as shown in SEQ ID NO.7；
The sequence of Seq Y2255-R is as shown in SEQ ID NO.8；
The sequence of Seq Y2498-F is as shown in SEQ ID NO.9；
The sequence of Seq Y2498-R is as shown in SEQ ID NO.10；
The sequence of Seq Y2641-F is as shown in SEQ ID NO.11；
The sequence of Seq Y2641-R is as shown in SEQ ID NO.12.
6. the molecular labeling primer pair in the short bar site of cabbage type rape according to claim 1, containing the Wild cabbage type Application in the kind and kind quality detection of the short bar character site of rape.
7. the molecular labeling primer pair in the short bar site of cabbage type rape according to claim 1, in the short bar rape product of breeding Application in kind and germplasm.
8. the molecular labeling or primer pair in the short bar site of cabbage type rape according to claim 1 or 4 detect short bar wild cabbage The method of type rape, which is characterized in that utilize primer pair amplifies rapeseed gene group DNA as claimed in claim 4, amplified production exists After 40% polyacrylamide gel electrophoresis, the amplified fragments for obtaining parent MB1501-1 are detected whether.
9. the molecular labeling or the short bar wild cabbage of primer pair breeding in the short bar site of cabbage type rape according to claim 1 or 4 The method of type rape variety, which is characterized in that use primer pair amplifies rapeseed gene group DNA as claimed in claim 4, amplification produces Object detects whether the amplified fragments for obtaining MB1501-1 after 40% polyacrylamide gel electrophoresis.
10. the short bar site of control cabbage type rape according to claim 1, which is characterized in that the control Wild cabbage type oil The short bar site of dish is Bndwarf2, is located at BnaC04:41993194bp-43723070bp on 04 chromosome of cabbage type rape C.
11. the short bar site of control cabbage type rape according to claim 1, which is characterized in that close linkage label BnC04Y1361 is located at 42375505bp-42375810bp on 04 chromosome of cabbage type rape C, sequence such as SEQ ID NO.1 It is shown；Close linkage label BnC04Y2255 is located at 42635056bp-42635376bp on 04 chromosome of cabbage type rape C, Sequence is as shown in SEQ ID NO.2；Close linkage label BnC04Y2498 is located on 04 chromosome of cabbage type rape C 42697768bp-42698073bp, sequence is as shown in SEQ ID NO.3；Close linkage label BnC04Y2641 is located at wild cabbage 42724075bp-42724380bp on 04 chromosome of type rape C, sequence is as shown in SEQ ID NO.4.
12. the screening technique of the molecular labeling in the short bar site of cabbage type rape according to claim 1, which is characterized in that Steps are as follows:
(1) genetic group constructs: one plant of Dwarf mutant MB1501-1, benefit are found in the selfing mostly cabbage type rape strain in generation Hybridized with MB1501-1 in conventional excellent variety double 11, obtains hybrid F1, F1Selfing obtains F2, F2Hybridize to obtain with ZS11 F2BC1, F2Selfing obtains F3, to F1、F2、F2BC1And F3Carry out phenotype investigation；
(2) cabbage type rape F2、F2BC1And F3Group's phenotype test: to above-mentioned F2、F2BC1And F3In group totally 1947 single plants into Row Phenotypic Observation and economical character investigation；
(3) building of genetic map: selection F265 single-strain blade DNA samples in group are used for the data acquisition of SNP marker, Linkage map is constructed using JoinMap4.0 mapping software；
(4) phenotypic data that will be used for the DNA sample of SNP chip carries out positioning point together with its SNP genetic linkage map modal data The site Bndwarf2 of analysis, the control short bar character of cabbage type rape is positioned to C04 linkage group, is located between positioning area In the section of 42697814bp-42698038bp；
(5) the SSR information for utilizing 04 chromosome 41993194bp-43723070bp of rape C, designs molecular labeling；
(6) according to F2、F2BC1And F3Group's phenotypic data and molecular marker data find close linkage codominant marker BnC04Y1361, BnC04Y2255, BnC04Y2498 and BnC04Y2641, and its hereditary banding pattern is high-visible.
CN201910417799.7A 2019-05-20 2019-05-20 Molecular marker of brassica napus dwarf trait locus and application thereof Active CN110117673B (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CN201910417799.7A CN110117673B (en) 2019-05-20 2019-05-20 Molecular marker of brassica napus dwarf trait locus and application thereof
CN202110499867.6A CN113151562B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2641 for identifying dwarf cabbage type rape and application thereof
CN202110500775.5A CN112981001B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof
CN202110499857.2A CN113151561B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910417799.7A CN110117673B (en) 2019-05-20 2019-05-20 Molecular marker of brassica napus dwarf trait locus and application thereof

Related Child Applications (3)

Application Number Title Priority Date Filing Date
CN202110499857.2A Division CN113151561B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof
CN202110499867.6A Division CN113151562B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2641 for identifying dwarf cabbage type rape and application thereof
CN202110500775.5A Division CN112981001B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof

Publications (2)

Publication Number Publication Date
CN110117673A true CN110117673A (en) 2019-08-13
CN110117673B CN110117673B (en) 2021-05-04

Family

ID=67522823

Family Applications (4)

Application Number Title Priority Date Filing Date
CN201910417799.7A Active CN110117673B (en) 2019-05-20 2019-05-20 Molecular marker of brassica napus dwarf trait locus and application thereof
CN202110500775.5A Active CN112981001B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof
CN202110499867.6A Active CN113151562B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2641 for identifying dwarf cabbage type rape and application thereof
CN202110499857.2A Active CN113151561B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof

Family Applications After (3)

Application Number Title Priority Date Filing Date
CN202110500775.5A Active CN112981001B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof
CN202110499867.6A Active CN113151562B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2641 for identifying dwarf cabbage type rape and application thereof
CN202110499857.2A Active CN113151561B (en) 2019-05-20 2019-05-20 Molecular marker BnC04Y2498 for identifying dwarf cabbage type rape and application thereof

Country Status (1)

Country Link
CN (4) CN110117673B (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110578015A (en) * 2019-10-14 2019-12-17 江苏省农业科学院 SNP marker closely linked with cabbage type rape high and short characters and application thereof
CN110607389A (en) * 2019-10-11 2019-12-24 南京农业大学 Molecular marker of brassica napus semi-short stalk character locus and application thereof
CN111500766A (en) * 2020-06-16 2020-08-07 四川大学 Molecular marker for detecting dwarf gene ndf1 in brassica napus and application thereof
CN111996280A (en) * 2020-09-17 2020-11-27 江苏省农业科学院 SNP marker co-separated from cabbage type rape short stalk compact character and application
CN114831021A (en) * 2022-06-14 2022-08-02 江苏省农业科学院 Ornamental rape variety cultivation method suitable for miniature bonsai
CN116287367A (en) * 2022-09-26 2023-06-23 中国科学院遗传与发育生物学研究所 SSR molecular marker closely linked with brassica napus plant height traits and application thereof
CN117512175A (en) * 2023-11-28 2024-02-06 华智生物技术有限公司 SNP molecular marker closely linked with brassica napus dwarf gene BnA03.IAA7 and application thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116716425B (en) * 2023-01-16 2023-11-28 南京农业大学 Molecular marker of drooping character site of cabbage type rape leaf-rolling/pod and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170105380A1 (en) * 2011-02-09 2017-04-20 Dow Agrosciences Llc Ho/ll canola with resistance to clubroot disease
CN107699631A (en) * 2017-11-17 2018-02-16 青海省农林科学院 The female male sterile series Bnmfs of cabbage type rape utilizes the primer and method of molecular marker screening

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105475118B (en) * 2015-12-01 2018-06-26 贵州省油菜研究所 The selection of recessive short bar rape and application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170105380A1 (en) * 2011-02-09 2017-04-20 Dow Agrosciences Llc Ho/ll canola with resistance to clubroot disease
CN107699631A (en) * 2017-11-17 2018-02-16 青海省农林科学院 The female male sterile series Bnmfs of cabbage type rape utilizes the primer and method of molecular marker screening

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
宋贤勇等: "利用SSR标记鉴定甘蓝型油菜秦优11号种子纯度", 《分子植物育种》 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110607389A (en) * 2019-10-11 2019-12-24 南京农业大学 Molecular marker of brassica napus semi-short stalk character locus and application thereof
CN110607389B (en) * 2019-10-11 2021-04-30 南京农业大学 Molecular marker of brassica napus semi-short stalk character locus and application thereof
CN110578015A (en) * 2019-10-14 2019-12-17 江苏省农业科学院 SNP marker closely linked with cabbage type rape high and short characters and application thereof
CN111500766A (en) * 2020-06-16 2020-08-07 四川大学 Molecular marker for detecting dwarf gene ndf1 in brassica napus and application thereof
CN111996280A (en) * 2020-09-17 2020-11-27 江苏省农业科学院 SNP marker co-separated from cabbage type rape short stalk compact character and application
CN111996280B (en) * 2020-09-17 2022-07-26 江苏省农业科学院 SNP marker co-separated from brassica napus dwarf compact trait and application thereof
CN114831021A (en) * 2022-06-14 2022-08-02 江苏省农业科学院 Ornamental rape variety cultivation method suitable for miniature bonsai
CN114831021B (en) * 2022-06-14 2022-12-20 江苏省农业科学院 Ornamental rape variety cultivation method suitable for miniature bonsai
CN116287367A (en) * 2022-09-26 2023-06-23 中国科学院遗传与发育生物学研究所 SSR molecular marker closely linked with brassica napus plant height traits and application thereof
CN117512175A (en) * 2023-11-28 2024-02-06 华智生物技术有限公司 SNP molecular marker closely linked with brassica napus dwarf gene BnA03.IAA7 and application thereof
CN117512175B (en) * 2023-11-28 2024-05-17 华智生物技术有限公司 SNP molecular marker closely linked with brassica napus dwarf gene BnA03.IAA7 and application thereof

Also Published As

Publication number Publication date
CN112981001A (en) 2021-06-18
CN113151562A (en) 2021-07-23
CN113151561B (en) 2023-01-31
CN110117673B (en) 2021-05-04
CN113151562B (en) 2023-01-31
CN112981001B (en) 2023-01-06
CN113151561A (en) 2021-07-23

Similar Documents

Publication Publication Date Title
CN110117673A (en) The molecular labeling of the short bar character site of cabbage type rape and its application
CN102154470B (en) Molecular marker method for anti-rice blast gene Pi-hk1 (t) of paddy
CN110607389B (en) Molecular marker of brassica napus semi-short stalk character locus and application thereof
CN105695478A (en) Gene for regulating plant types and yield of plants and application of gene
CN109929945B (en) Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof
CN110295251A (en) Chain SNP marker and its application with wheat available tillering QTL
CN110184373A (en) A kind of and the associated molecular labeling of rape mass of 1000 kernel and application
CN108504773B (en) Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker
CN111926104B (en) SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof
CN113736910A (en) Linkage molecular marker of peanut single plant pod number main effect QTL site qPN7 and application thereof
CN107619875B (en) Insertion deletion marker locus for identifying watermelon fruit shape, primer and application
CN110004242B (en) Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof
CN109680093B (en) Molecular marker primer of rape grain number per pod character major gene locus and application
CN116516054A (en) SNP molecular marker related to cabbage type rape dwarf trait and application thereof
CN110468229A (en) Rice wide spectrum high resistance to hoja blanca gene Xa45&#39;s (t) isolates molecular labeling Hxjy-1
CN110358861A (en) R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule
CN111100946B (en) Molecular marker primer of rape grain weight character major gene locus and application
CN105177020B (en) Wheat glume villin gene Hg chain SSR molecular marker and its application
CN108048599A (en) A kind of molecular labeling and application with rape lateral root number main effect QTL site RtA07-2 close linkages
CN107058601B (en) SNP (Single nucleotide polymorphism) marker for identifying low stone cell content of pear pulp based on high-resolution dissolution curve and application of SNP marker
CN107794261A (en) Molecular labeling and its application of the rape per seed number per pod main effect QTL site close linkage
CN111004857A (en) Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer
CN111118196B (en) Molecular marker CNU288 primer of rape grain weight character major gene locus and application thereof
CN116694811B (en) Molecular marker closely linked with wheat seedling stage seed root number QTL and application thereof
CN117887885B (en) Soybean oil content-related major single nucleotide polymorphism site and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant