CN109680093B - Molecular marker primer of rape grain number per pod character major gene locus and application - Google Patents
Molecular marker primer of rape grain number per pod character major gene locus and application Download PDFInfo
- Publication number
- CN109680093B CN109680093B CN201910047177.XA CN201910047177A CN109680093B CN 109680093 B CN109680093 B CN 109680093B CN 201910047177 A CN201910047177 A CN 201910047177A CN 109680093 B CN109680093 B CN 109680093B
- Authority
- CN
- China
- Prior art keywords
- rape
- number per
- grain number
- marker
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly discloses a molecular marker primer of a major gene locus of rape grain number per kernel character and application thereof, wherein phenotypic data of the grain number per kernel character is obtained by performing field experiments and seed tests on isolated populations of families F2 and F2:3 of Zhongshuang No. 11 and 73290; QTL detection is performed by combining the genotype and genetic map of the F2 segregation population. Obtaining the major gene locus controlling the grain number per pod of rape on the A7 linkage groupqSN.A7And a molecular marker Ni 201. The marker is used for carrying out genotype analysis on F3 generations derived from amphiphilic parents, the average value of the grain number per corner of the selected single plant carrying the favorable gene exceeds the average value of the single plant carrying the unfavorable gene, and the seed test result shows that the proportion of the grain number per corner of the selected single plant carrying the favorable marker which is higher than the average value of the group of the single plant carrying the unfavorable gene is up to 88.0 percent, so that the selection efficiency of high-yield breeding can be greatly improved by using the marker for auxiliary selection.
Description
Technical Field
The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a molecular marker primer of a rape grain number per kernel trait major gene locus, and also relates to application of the molecular marker in rape high-yield breeding.
Background
Rape is the first major oil crop in our country, accounting for about 20% of world rape yield (Hu et al, 2016). Rapeseed oil is the first major source of domestic edible vegetable oil, accounts for 57.2% of the total amount of domestic edible vegetable oil, and plays an important role in the national edible oil supply safety strategy (generating Ming et al, 2018). The external dependence of domestic vegetable oil in China exceeds 60%, and the vegetable oil has a tendency of increasing continuously (Wang Han Zhong, etc., 2014). In addition, the rapeseed oil and the diesel oil have similar fatty acid compositions, and are green renewable energy sources. Under the conditions that the urbanization scale of China is continuously enlarged and the cultivated land area is further reduced, the improvement of the oil yield per unit area (single yield multiplied by oil content) of rape is one of the most urgent tasks of rape production in China at present, and is a fundamental problem about the continuation and development of the rape industry in China.
In recent years, the high oil breeding of rape in our country has made a breakthrough (Fourier et al, 2014), while the yield per unit is only 57% of the European Union, still below the world average level and increasing speed is very slow (http:// apps. fas. usda. gov/psdonline /). This seriously affects the enthusiasm of farmers for planting rape and limits the economic benefit of rape and the international competitiveness of rape industry. Therefore, the yield per unit of rape needs to be improved urgently in China (2012 in Yiyan and Wang Han). At the same planting density, the yield per unit of rape depends on the yield per plant, which is composed of three components (the number of siliques per plant, the number of kernels per pod and the weight of the kernels). Studies have shown that the three constitutive factors of single-plant yield of oilseed rape exhibit varying degrees of negative correlation, but the correlation coefficient is often not large (azolla et al, 2016), suggesting that yield can be increased by increasing the single yield constitutive factor (e.g., grain per silique). The potential of improving the yield per unit of rape is very large, which is particularly reflected in that the average value of yield forming factors of rape varieties to be tested in various countries has a considerable gap compared with the highest level of rape germplasm resources. For example, the average grain number per horn of winter rape four large-area reference rape varieties in 2000-2009 in China is about 20 grains (Shuqiying et al, 2010), and the highest grain number of horn fruits in rape germplasm resources exceeds 30 grains.
Although the traditional breeding method provides a plurality of excellent rape varieties for production once, the requirements of the current rape production cannot be completely met due to long breeding period and low selection efficiency. With the development of molecular biology and molecular genetics, selection of traits by breeders is gradually transitioning from phenotypic selection to genotypic selection. The molecular marker assisted breeding is a new breeding means which effectively combines molecular genetics and traditional phenotype selection, and the basic principle is that in the rape breeding process, molecular markers which are closely linked and coseparated with target character genes are directly utilized to carry out target region and whole genome screening on selected individuals, so that the purposes of improving the target character selection efficiency and shortening the breeding period are achieved.The key of the molecular marker assisted selective breeding technology is to identify DNA molecular markers closely linked with important agronomic traits. In recent years, research work in this area has been invested in enormous quantities in developed countries such as the united states. With the development of molecular markers for agronomic traits of important crops such as rice, corn, wheat and the like, the auxiliary selective breeding by using the screened molecular markers is gradually mature, and the target traits are also expanded from simple single-gene quality traits to complex multi-gene quantitative traits. With the rapid development of genomics and sequencing technologies, the research on rape molecular markers is receiving more and more attention, and the research field relates to various aspects such as germplasm genetic diversity analysis, genetic map construction, gene marking and positioning, variety purity identification, combining ability prediction, marker-assisted selection and the like, and makes important progress. However, compared with developed countries, the research on the molecular breeding of rape in China has a large gap, which is mainly reflected in that: the method is not capable of effectively exploring and utilizing the beneficial genes in the germplasm resources and lacks autonomyIntellectual propertyAnd genes and markers of breeding value.
With the continuous development of molecular marker technology, the application of the molecular marker technology in crops is more and more extensive. Grodzicker et al (1974) have created a Restriction Fragment Length Polymorphism (RFLP) tagging technique. RFLP is the first generation molecular marker, and has the characteristics of abundant quantity, stable inheritance, specificity, good repeatability, co-dominance and the like. However, this marker requires a relatively large amount of DNA; the operation procedure is complicated, time-consuming, labor-consuming and long in period; the need to label the probe with a radioisotope has also limited the widespread use of RFLP labeling. AFLP markers combine PCR and RFLP marker technologies, and are widely applied to researches on crop genetic diversity, cytology, variety purity identification, disease resistance and the like (Song cishunua, et al, 2006; Yuanxia, 2009; Wang Xue, 2004). However, AFLP markers also have some disadvantages: the cost is high, the process is complex, and the technical difficulty is high; the markers are mostly dominant markers; the requirements on the quality of DNA and the quality of restriction enzyme are high. SSR markers, also called microsatellite DNA markers, have been widely used in studies on crop gene localization, molecular marker-assisted selection, DNA fingerprinting, variety purity identification, preservation and utilization of germplasm resources, genetic diversity analysis, and the like (Chen Yeli, 2010; Miao Yun, 2007; Jing Zan, 2010; Wang Dongmei, 2011). SSR markers have the advantages of abundant quantity, high polymorphism, simple operation, low cost and the like, and are widely introduced to molecular marker-assisted selection for a long time. In recent decades, with the continuous progress of sequencing technologies, the development of molecular markers based on genomic sequence information has become possible, such as SNP markers and InDel markers (Hyten et al, 2010). At present, the whole genome selective breeding chip only starts to try in rice (Yu et al, 2014), and other crops such as rape are still mainly selected by the aid of molecular markers.
Most important agronomic characters (such as yield, quality, resistance and the like) show the genetic characteristics of quantitative characters, and phenotypes are continuously distributed and are easily influenced by environmental conditions, so that the conventional breeding method based on phenotypic selection has poor selection effect on complex quantitative characters, the breeding efficiency is low, and the breeding period is prolonged. Due to the development and integration of molecular marker technology and quantitative genetics, one has decomposed complex quantitative traits into single Quantitative Trait Loci (QTL) and then studied multiple genes that control quantitative traits like quality traits. QTL positioning is that on the basis of genetic segregation population, quantitative trait phenotypic data of the segregation population are analyzed by using QTL mapping software by means of molecular markers and genetic maps, so that the position and the effect of quantitative trait genes on chromosomes are determined. At present, QTL positioning research on the grain number of rape per pod is reported, but the usually detected QTL has smaller effect value and poor repeatability, and is difficult to be applied to rape breeding. The research aims to screen the QTL with positive effect on the grain number of each rape pod through QTL positioning and is used for the marker-assisted selection of rape yield traits.
Disclosure of Invention
The invention aims to provide a molecular marker primer of a QTL locus of rape grain number per kernel trait, which comprises the following steps: AAACGCAAGTGCTATGTCCC, and CCACGGAAAACTTGTAACGG.
The invention also aims to provide application of the molecular marker primer of the QTL locus of the rape grain number per kernel trait, the QTL locus has higher effect value and contribution rate, plays a key role in regulating and controlling the rape grain number per kernel, and can be used for site cloning, rape high-yield breeding and molecular marker-assisted selection.
In order to achieve the purpose, the invention adopts the following technical measures:
the method for obtaining the QTL locus of the rape grain number per pod character comprises the following steps:
(1) the hybrid F1 generation was selfed to produce the F2 population and its F2:3 and F2:4 lines using the double 11 (. apprxeq.21 grains) and 73290 (. apprxeq.11 grains) crosses in oilseed rape varieties with very significant differences in grain number per pod.
(2) The CTAB method (Doyle et al 1987) was used to extract total DNA from leaves of the parental double 11 and 73290 and F2 isolates.
(3) Rape public (http:// www.ukcrop.net/Brassica DB) and self-developed SSR and InDel primers are synthesized, the parental DNA is subjected to PCR amplification, products are electrophoresed in denaturing polyacrylamide gel, the size of a band is distinguished after dyeing and developing, and polymorphic primers are screened.
(4) And (3) carrying out molecular marker analysis on the F2 segregation population by using the polymorphic primer pair to obtain genotype data.
(5) Inputting the genotype data of the F2 segregating population into the Joinmap4.0 software (commercially available) to construct a genetic linkage map;
(6) genotype data (limited to markers mapped to genetic maps) for the F2 population and the number of grains per corner trait data for the F2 population and its F2:3 and F2:4 families were input into the winqtlcart2.5 software for QTL mapping, for a total of 8 QTLs controlling the number of grains per corner were detected. The QTL located on the A7 linkage group can be repeatedly detected in the two groups, and the effect value and the contribution rate are large.
By utilizing the technical measures, the applicant finally obtains the major gene locus qSN.A7 of the rape kernel number per kernel character, the major gene locus is positioned on a rape A7 chromosome and is tightly linked with the InDel marker Ni201 which is independently developed by the applicant, and the primer sequence of the major gene locus is 5'-AAACGCAAGTGCTATGTCCC-3' aiming at the Ni 201; ni201R: 5'-CCACGGAAAACTTGTAACGG-3'. The application of WinQTLCart2.5 software analysis to determine that the contribution rate of the rape to the grain number per pod is 10.8%, the additive effect is 0.86 and the dominant effect is 0.62.
The application of the molecular marker primer closely linked with the rape grain number per kernel character comprises the application of the primer provided by the invention, and the application of the primer can be used for breeding the cabbage type rape, including screening a plurality of single plants, and being used for map-based cloning of the cabbage type rape or being used for molecular marker assisted selection of the cabbage type rape.
Compared with the prior art, this has following advantage:
the invention positions the important QTL site for controlling the number of grains per kernel of double 11 rape variety, the genetic distance between the marker and the major gene site is very close (<2cM) and the marker is a codominant InDel marker based on genome sequence information, thus being reliable and convenient to use, and providing great convenience for breeding of double 11 derived strains in the future. A phenotypic variance of 10.8% can be explained. In the conventional breeding method, the phenotypic identification of the trait per kernel number needs to wait until the mature period for seed test, which is time-consuming, labor-consuming and inefficient in selection (the phenotype per kernel number is greatly influenced by the environment). By detecting the major gene locus of the grain number character of each horn, the major gene locus can be eliminated in the seedling stage, so that the production cost is saved, and the selection efficiency is greatly improved. The position of the major gene locus of each grain number is clear, and the detection method of the major gene locus is convenient and quick and is not influenced by the environment. The applicant utilizes the marker to perform auxiliary selection on the offspring of a breeding group, the result shows that the average value of fruit grain number per corner (15.2 grains/corner) of the selected single plant carrying the favorable gene exceeds the average value of the single plant carrying the unfavorable gene (13.1 grains/corner), and the seed test result shows that the proportion of the fruit grain number per corner of the single plant carrying the favorable marker to the average value of the single plant carrying the unfavorable gene is up to 86.7 percent, which shows that the marker is practical and effective for auxiliary selection. The number of grains per horn can be predicted by detecting the molecular markers related to the properties of the number of grains per horn, so that a plurality of single plants can be accurately and quickly screened.
Drawings
FIG. 1 is a histogram of grain counts per pod when planted in different environments for families F2:3 and F2: 4;
the results show that the number of grains per horn is normally distributed, the variation range is wide, and the number of grains per horn is proved to belong to quantitative traits.
Detailed Description
The technical solutions of the present invention, if not specifically mentioned, are conventional in the art, and the reagents or materials, if not specifically mentioned, are commercially available.
Example 1:
constructing a rape per-pod number segregation population and determining the characters:
the segregating populations used in this example were the double 11 (ca 21) and 73290 (ca 11) derived F2 (planted in 2009 at the chinese farm oil institute prowl integrated test site) and F2:3 (planted in 2010 at the chinese farm oil institute prowl integrated test site) and F2 in the multi-and few-grain oilseed rape parents: 4 lines (2011 planted in Qinghai university test base). The number of grains per kernel phenotype of both parents and both populations was identified by seed test after harvest at maturity. The number of grains per horn indicates: the two parents have weak super-parent separation, which shows that the multi-particle genes are mainly distributed in the middle double No. 11 genome; the number of grains per horn of the population is normally distributed, and the quantitative inheritance characteristics of the number of grains per horn are proved (figure 1).
The family F2:3 examined a population, wherein the test species of the W10F2:3b population is the number of granules per horn on the branch, and the test species of the W10F2:3W population is the number of granules per horn on the whole plant;
the F2:4 pedigree examined 1 population, and the X11F2:4b population was enumerated as the number of granules per corner on the branch.
Example 2:
development and synthesis of primers:
SSR primers utilized by applicants include two classes: one is the published primer sequences in the published articles and Brassica databases (http:// www.brassica.info/resource/markers/ssr-exchange. php); the other type is developed by the applicant according to Chinese cabbage and cabbage scaffold sequences and named as BrSF and BoSF series respectively, and the specific development method is that SSR Hunter software is used for searching SSR in each scaffold, and then Primer3.0 software is used for designing SSR primers. The autonomously developed InDel primers were derived by aligning 73290 the re-sequenced sequence to the midduplex 11 reference genomic sequence, first mapping 73290 the re-sequenced sequence to the midduplex 11 whole genomic reference sequence using BWA software, and then searching for InDel using samtools software.
Example 3:
the process of screening primer polymorphism includes the following steps:
(1) 10 DNA strains randomly selected from each parent were mixed in equal amounts and used as templates for screening primers.
(2) Carrying out PCR amplification on the parent DNA by using the dissolved primer,
reaction system:
PCR reaction procedure:
(3) gel electrophoresis band pattern interpretation
Example 4:
f2 population genotype analysis, genetic linkage map construction and QTL positioning, which comprises the following steps:
(1) extracting DNA of 179 individuals of an F2 population by adopting a CTAB method;
(2) the DNA of 179 individuals of F2 population is amplified by PCR with selected polymorphic primers, and then the PCR products are subjected to polyacrylamide gel electrophoresis, development, staining and banding pattern interpretation. The molecular markers to which the invention relates are co-dominant markers, i.e. the differential bands show a variation in position (i.e. amplification product size), and the banding patterns of the segregating population are read as A, B and H, respectively, indicating the banding patterns from Mediterranean 11, 73290 and heterozygous, respectively.
(3) And (4) judging the band type of the molecular marker obtained after dyeing to obtain the genotype data of the molecular marker.
(4) The molecular marker genotype data of the F2 population are subjected to linkage analysis by using Joinmap4.0 software to construct a molecular marker genetic linkage map, so that 19 linkage populations (containing 805 molecular markers) are obtained, and the linkage populations exactly correspond to 19 chromosomes of the brassica napus.
(5) Based on the genetic map, genotype data of an F2 population and phenotype data of the grain number per kernel of the two populations, QTL detection is carried out by using QTLCart2.5 software, a main effect QTL locus with good repeatability is detected near an InDel marker Ni201 of an A7 chromosome (Table 1), the LOD value and the contribution rate of the main effect QTL locus are both large (Table 2), the contribution rate of the main effect QTL locus to the grain number per kernel of rape is 10.8%, the additive effect is 0.86 and the dominant effect is 0.62. The primers related to the Ni201 molecular marker are shown in Table 1, and a band with the size of 251bp, which is marked as A in the invention, is obtained by amplifying the primer in Zhongshui No. 11; a band obtained by amplification in 73290, the size of which is 256bp and is marked as B in the invention; the two bands amplified in the heterozygote are 251bp and 256bp in size, and are marked as H in the invention.
TABLE 1A7 primer sequence of major QTL linkage marker Ni201 per Kernel number of linkage group
TABLE 2A7 basic information of major QTL for grain number per corner of linkage group
Example 5:
the application of the molecular marker Ni201 in the high-yield breeding of rape comprises the following steps:
(1) f3 generation seeds of selected F2 individuals were planted in the field.
(2) F3 single plant is sampled before final singling, total DNA of leaves is extracted, and the genotype of the major QTL of the grain number per corner is analyzed by utilizing a molecular marker Ni 201.
(3) F3 individuals were harvested at maturity and were subjected to a number of seeds per horn. The results show that the mean particle number per corner (15.5 particles/corner) of the medium-double 11 background single strains (marked A) selected by molecular marker-assisted selection exceeds the mean particle number per corner (73290 background (marked B) single strains (13.9 particles/corner), and the mean particle number per corner of the medium-double 11 background single strains accounts for 88% of the mean particle number of the 73290 background population (Table 3). Therefore, the elimination is carried out in the seedling stage, so that the production cost is saved, the selection efficiency is greatly improved, and then a plurality of strains can be quickly screened out for high-yield breeding of the rape.
TABLE 3 seed number per pod data of F3 individuals obtained by InDel marker Ni201 assisted selection
SEQUENCE LISTING
<110> institute of oil crop of academy of agricultural sciences of China
<120> molecular marker primer of rape grain number per kernel trait major gene locus and application
<160> 2
<170> PatentIn version 3.1
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Claims (2)
1. A molecular marker primer of a QTL locus of rape grain number per kernel trait is disclosed, wherein the primer is as follows: AAACGCAAGTGCTATGTCCC, and CCACGGAAAACTTGTAACGG.
2. Use of the primers of claim 1 for screening brassica napus for grain per kernel trait, wherein the brassica napus parents are medic-double 11 and 73290.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910047177.XA CN109680093B (en) | 2019-01-18 | 2019-01-18 | Molecular marker primer of rape grain number per pod character major gene locus and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910047177.XA CN109680093B (en) | 2019-01-18 | 2019-01-18 | Molecular marker primer of rape grain number per pod character major gene locus and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109680093A CN109680093A (en) | 2019-04-26 |
| CN109680093B true CN109680093B (en) | 2022-02-18 |
Family
ID=66193493
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910047177.XA Active CN109680093B (en) | 2019-01-18 | 2019-01-18 | Molecular marker primer of rape grain number per pod character major gene locus and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109680093B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118222751B (en) * | 2024-04-23 | 2024-09-27 | 中国农业科学院油料作物研究所 | Molecular marker closely linked with main effect QTL-qON.A7 of number of ovules per ovary of rape and application |
| CN118389727A (en) * | 2024-04-23 | 2024-07-26 | 中国农业科学院油料作物研究所 | Molecular marker closely linked with main effect QTL-qSN.C9 of rape grains per pod and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102226189A (en) * | 2011-06-09 | 2011-10-26 | 中国农业科学院油料作物研究所 | Seed number per pod character major gene site of rape and application thereof |
| CN104805080A (en) * | 2014-10-30 | 2015-07-29 | 中国农业科学院油料作物研究所 | Rapeseed pod number major QTL molecular marker and application thereof |
| CN107794261A (en) * | 2016-08-29 | 2018-03-13 | 中国农业科学院油料作物研究所 | Molecular labeling and its application of the rape per seed number per pod main effect QTL site close linkage |
-
2019
- 2019-01-18 CN CN201910047177.XA patent/CN109680093B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102226189A (en) * | 2011-06-09 | 2011-10-26 | 中国农业科学院油料作物研究所 | Seed number per pod character major gene site of rape and application thereof |
| CN104805080A (en) * | 2014-10-30 | 2015-07-29 | 中国农业科学院油料作物研究所 | Rapeseed pod number major QTL molecular marker and application thereof |
| CN107794261A (en) * | 2016-08-29 | 2018-03-13 | 中国农业科学院油料作物研究所 | Molecular labeling and its application of the rape per seed number per pod main effect QTL site close linkage |
Non-Patent Citations (1)
| Title |
|---|
| Linkage and regional association analysis reveal two new tightly-linked major-QTLs for pod number and seed number per pod in rapeseed (Brassica napus L.);Jiaqin Shi等;《Scientific Reports》;20151005;第5卷;第1-18页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109680093A (en) | 2019-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107630099B (en) | Molecular marker closely linked with rape grain weight or silique length multi-effect main effect QTL and application thereof | |
| CN109929945B (en) | Molecular marker BrSF2604 primer of main effect QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN110117673B (en) | Molecular marker of brassica napus dwarf trait locus and application thereof | |
| CN110157829B (en) | Molecular marker SNPA9-5 associated with thousand seed weight of rape and application | |
| CN110184373B (en) | Molecular marker associated with thousand seed weight of rape and application thereof | |
| CN108504773B (en) | Molecular marker of major QTL (quantitative trait loci) site for grain weight and silique length of brassica napus and application of molecular marker | |
| CN105087768B (en) | A kind of method of the anti-bean weevil kind of molecular marking supplementary breeding mung bean | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN115927703A (en) | Primer group for detecting specific molecular markers of rice grain type genes GS3 and GW5 and application thereof | |
| CN109680093B (en) | Molecular marker primer of rape grain number per pod character major gene locus and application | |
| CN116179755A (en) | Soybean grain weight major QTLqSW20-1 and Indel molecular marker developed by same and application thereof | |
| Sadeghzadeh et al. | Molecular marker linked to a chromosome region regulating seed Zn accumulation in barley | |
| CN110004242B (en) | Molecular marker BrSF0239 primer of main QTL sites in flowering phase and mature phase of brassica napus and application thereof | |
| CN111100946B (en) | Molecular marker primer of rape grain weight character major gene locus and application | |
| CN116042897B (en) | Molecular marker VEQ2 and application thereof | |
| CN107746895B (en) | Molecular marker for improving barley harvest index QTL site under low-phosphorus condition and application | |
| CN107794261B (en) | Molecular marker closely linked with major QTL (quantitative trait loci) of rape grain number per pod and application thereof | |
| CN113197089B (en) | Breeding method facilitating early generation selection of soft weak gluten wheat | |
| CN111118196B (en) | Molecular marker CNU288 primer of rape grain weight character major gene locus and application thereof | |
| CN114231651A (en) | Radish whole genome SSR core primer combination suitable for SSR-Seq technology and application thereof | |
| Xiao-Xia et al. | Development of SSR markers linked to low hydrocyanic acid content in sorghum-sudan grass hybrid based on BSA method | |
| CN111004857A (en) | Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| CN110923355A (en) | Linkage KASP molecular marker for rice high temperature resistance character and application thereof | |
| CN106148499A (en) | The molecular marker of Semen Maydis panicled characters hybrid vigor main effect QTL and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |