CN111218521A - Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof - Google Patents
Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof Download PDFInfo
- Publication number
- CN111218521A CN111218521A CN202010032359.2A CN202010032359A CN111218521A CN 111218521 A CN111218521 A CN 111218521A CN 202010032359 A CN202010032359 A CN 202010032359A CN 111218521 A CN111218521 A CN 111218521A
- Authority
- CN
- China
- Prior art keywords
- pib
- rice blast
- rice
- resistance gene
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 115
- 235000009566 rice Nutrition 0.000 title claims abstract description 115
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 87
- 239000003147 molecular marker Substances 0.000 title claims abstract description 31
- 238000001514 detection method Methods 0.000 title claims description 14
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 114
- 201000010099 disease Diseases 0.000 claims abstract description 20
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims abstract description 20
- 239000012634 fragment Substances 0.000 claims description 12
- 108020004414 DNA Proteins 0.000 claims description 11
- 238000001962 electrophoresis Methods 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 239000002773 nucleotide Substances 0.000 claims description 6
- 125000003729 nucleotide group Chemical group 0.000 claims description 6
- 230000003321 amplification Effects 0.000 claims description 5
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 5
- 229920000936 Agarose Polymers 0.000 claims description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 claims description 4
- 238000012217 deletion Methods 0.000 claims description 4
- 230000037430 deletion Effects 0.000 claims description 4
- 238000000034 method Methods 0.000 claims description 4
- 238000012216 screening Methods 0.000 claims description 4
- 238000003780 insertion Methods 0.000 claims description 3
- 230000037431 insertion Effects 0.000 claims description 3
- 150000007523 nucleic acids Chemical group 0.000 claims description 2
- 102000004169 proteins and genes Human genes 0.000 claims description 2
- 238000009395 breeding Methods 0.000 description 11
- 230000001488 breeding effect Effects 0.000 description 11
- 239000003550 marker Substances 0.000 description 7
- 235000013339 cereals Nutrition 0.000 description 6
- 238000013461 design Methods 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 108700028369 Alleles Proteins 0.000 description 3
- 208000035240 Disease Resistance Diseases 0.000 description 3
- 238000004458 analytical method Methods 0.000 description 3
- 238000006243 chemical reaction Methods 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 244000052616 bacterial pathogen Species 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 230000004907 flux Effects 0.000 description 2
- 238000006116 polymerization reaction Methods 0.000 description 2
- 230000009467 reduction Effects 0.000 description 2
- 238000009394 selective breeding Methods 0.000 description 2
- 230000009261 transgenic effect Effects 0.000 description 2
- 241000196324 Embryophyta Species 0.000 description 1
- 238000005251 capillar electrophoresis Methods 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 230000001351 cycling effect Effects 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000012214 genetic breeding Methods 0.000 description 1
- 229920002521 macromolecule Polymers 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000007918 pathogenicity Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000009897 systematic effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a functional specific molecular marker of a rice blast resistance gene Pib, wherein the functional specific molecular marker of the rice blast resistance gene Pib is Pib-InDel; the Pib-InDel is a molecular marker which is amplified from the genome DNA of a rice variety carrying the rice blast resistance gene Pib through a primer pair SEQ ID NO.1 and SEQ ID NO.2 to obtain a specific banding pattern with the rice blast resistance gene Pib; wherein, SEQ ID NO. 1: 5'-TATGAGACTGCCTGGGAGGAA-3', respectively; SEQ ID NO. 2: 5'-TCCATTATAATATAGGATAGT-3', respectively; the functional specificity molecule of the rice blast disease-resistant gene Pib obtained by the invention can be applied to identifying the rice blast disease-resistant gene in rice varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a functional specific molecular marker of a rice blast resistance gene Pib, and a detection method and application thereof.
Background
The rice is one of the main grain crops in the world, more than 50% of people in the world use the rice as the main grain, and the annual yield of the rice is increased by 40% on the basis of the existing yield in 2030 years to meet the consumption demand of people in the world. The rice blast disease caused by rice blast germs is the most important disease for the stable yield of rice, and occurs in different rice planting and production countries or regions to different degrees. In China, more than moderate rice blast diseases occur in different rice production areas almost every year, and the rice blast diseases have a tendency to increase continuously in the last 20 years. The rice blast can cause great yield reduction of rice, the yield reduction is 40-50% when the rice is serious, and even no grain is harvested. From the viewpoint of grain safety and rice genetic breeding, breeding disease-resistant varieties is one of the most economical and effective methods for preventing and treating rice blast. But the pathogenicity of physiological race of rice blast is changed rapidly, so the resistance of single resistant variety is gradually lost; the traditional disease-resistant breeding strategy has the characteristics of large workload, long period and the like. Therefore, there is an urgent need to change the traditional strategy of breeding for disease resistance.
The molecular marker is a genetic marker developed based on the polymorphism of biological macromolecules, heritable and detectable DNA sequences or proteins are called broad molecular markers, DNA molecular markers are called narrow molecular markers, and the DNA molecular markers are applied to aspects of genome mapping, gene positioning, genetic diversity evaluation, functional genomics research, transgenic plant identification, molecular marker-assisted selective breeding and the like. The gene function specific molecular marker is a marker developed based on DNA sequence polymorphism in a target gene, is highly related to biological phenotypic characters, shows more remarkable accuracy and directness in the identification of the biological phenotypic characters, and is an ideal molecular marker type in auxiliary selective breeding. The gene characteristic molecular marker is a functional molecular marker developed from functional SNP loci or InDels in a target functional gene sequence, can accurately track and locate functional alleles, has higher accuracy in the identification of crop phenotypic traits, and can efficiently screen beneficial genes required by breeding.
In the 60 s of the 20 th century, the research work of rice blast resistance gene analysis of rice varieties was first developed in Japan, 14 genes on the first 8 resistance sites were identified, a set of identification system for rice blast resistance gene analysis was established, systematic research on rice blast resistance inheritance was gradually developed in International Rice research institute and Rice producing countries such as China along with development of rice disease-resistant molecular genetics over recent decades, many resistance genes were finely positioned or cloned, and development and application of molecular markers greatly promoted identification of resistance gene genetic background and development of poly-resistance gene polymerization breeding, among the cloned resistance genes, some resistance genes were located at the same site, and these multiple alleles, functional sequences and non-functional sequences were highly homologous, so that the sequences of functional alleles themselves were directly analyzed and functional specific molecular markers thereof were developed to select target genes, not only has high selection reliability, but also greatly accelerates the breeding pace.
The rice blast resistance gene Pib has resistance to most of the small species of rice blast germs on the day, and can show strong disease-resistant reaction to Chinese strains ZB13 and ZC15 degrees, so in order to more accurately and effectively apply the rice blast broad-spectrum resistance gene Pib to rice resistance breeding work, a Pib specific molecular marker which truly reflects a target gene and is convenient and easy to use needs to be developed.
Disclosure of Invention
The invention provides a functional specific molecular marker of a rice blast resistance gene Pib and a method and application thereof, and develops the Pib specific molecular marker which truly reflects the rice blast broad-spectrum resistance gene Pib, is convenient and easy to use and has higher accuracy and stability, so that the rice blast broad-spectrum resistance gene Pib can be better applied to rice resistance breeding.
The purpose of the invention is realized by the following technical scheme:
the invention provides a functional specific molecular marker of a blast disease resistance gene Pib, wherein the functional specific molecular marker of the blast disease resistance gene Pib is Pib-InDel; the Pib-InDel is a molecular marker which is amplified from the genome DNA of a rice variety carrying the rice blast resistance gene Pib through a primer pair SEQ ID NO.1 and SEQ ID NO.2 to obtain a specific banding pattern with the rice blast resistance gene Pib; wherein,
SEQ ID NO.1：5’-TATGAGACTGCCTGGGAGGAA-3’；
SEQ ID NO.2：5’-TCCATTATAATATAGGATAGT-3’。
further, the rice variety carrying the rice blast resistance gene Pib is a rice disease-resistant variety IR 24.
Further, the rice blast resistance gene Pib comprises a gene fragment SEQID NO. 3:
TATGAGACTGCCTGGGAGGAAGAGGTACAGGAAGCAAGGCGCAAGGGAGGTGAACTGAAGAGGAAAATCCGAGAACAGCTTGCTCGGAATCCAAACCAACCCATCATTACCTGAGCTCCTTTGGAGTTACTTTGCCGTGCTCCATACTATCCTACAAGTGAGATCCTCTGCAGTACTGCATGCTCACTGACATGTGGACCCGAGGGGCTGTGGGGCCCACATGTCAGTGAGCAGTACTGTGCAGTACTGCAGAGGACCTGCATCCACTATCCTATATTATAATGGA。
the invention also provides a detection method of the functional specificity molecule of the rice blast disease-resistant gene Pib, which comprises the following steps:
a1, downloading the Pib and the homologous genome sequence thereof from the public database and the genome sequence of the corresponding region of the sequenced variety Nipponbare and 9311, carrying out sequence comparison aiming at the Pib locus, and screening the insertion/deletion InDel locus of the Pib which is specific and can be distinguished from other rice blast allelic resistance genes at the locus;
a2, designing a gene specific primer at the InDel site by using the InDel site information obtained in the step (1);
a3, carrying out PCR amplification by taking the total DNA of the rice blast resistant variety carrying the rice blast resistant gene Pib as a template, wherein the obtained PCR product is the specific molecular marker Pib-InDel of the rice blast resistant gene Pib.
The invention also provides the application of the functional specificity molecule of the rice blast disease-resistant gene Pib in identifying the rice blast resistance gene of rice varieties.
Further, the application of the functional specificity molecule of the rice blast disease-resistant gene Pib in identifying the rice blast resistant gene of a rice variety specifically comprises the following steps:
b1, amplification: carrying out PCR on the genome of the rice variety to be detected by using a primer F1 shown in SEQ ID NO.1 and a primer R1 shown in SEQ ID NO. 2;
b2, detection: detecting by using agarose electrophoresis, wherein if a nucleotide fragment with the molecular weight of 286bp in a PCR product is detected, the rice variety to be detected carries a rice blast resistance gene Pib; if the nucleotide fragment with the molecular weight of 286bp is not detected, the rice variety to be detected does not carry the rice blast resistance gene Pib.
A kit for identifying rice blast resistance of rice varieties comprises a primer pair with a nucleic acid sequence shown as SEQ ID NO.1 and SEQ ID NO. 2.
The invention has the beneficial effects that:
1. the functional specific molecular marker of the rice blast resistance gene Pib provided by the invention has low cost and high flux in practical application; at present, the InDel mark detection mode is simple and convenient, the requirements on instrument equipment and technology are low, the electrophoresis platform can be used for typing, the typing platform is fast and economic, and the operability is strong. The electrophoresis typing platform includes agarose gel electrophoresis, denaturing or non-denaturing polyacrylamide gel electrophoresis and capillary electrophoresis. The molecular marker provided by the invention only needs PCR combined with agarose gel electrophoresis or non-denaturing polyacrylamide gel electrophoresis, has low cost, high flux and high specificity, and is particularly suitable for production practice.
2. The invention relates to a Pib gene specific InDel marker developed aiming at an internal sequence of a Pib gene. The invention can successfully distinguish the Pib from other non-Pib genes positioned on the site by using an electrophoresis detection method, and has high detection efficiency; the Pib specific molecular marker Pib-InDel provided by the invention is a dominant marker, the marker exists in the Pib gene, the theoretical value of the screening capability of the Pib can reach 100%, and the comprehensive performance of the marker is superior to that of reported molecular markers and functional markers linked with the Pib. The invention is suitable for the germplasm resource screening, the transgenic breeding, the gene polymerization and the MAS technology-based resistance breeding of the Pib under any genetic background, and greatly improves the breeding efficiency.
Drawings
FIG. 1 shows the amplification of 9 selected representative varieties of total DNA as templates using primers F1 shown in SEQ ID NO.1 and R1 shown in SEQ ID NO.2 of the present invention;
Detailed Description
The present invention will be described in further detail with reference to the following embodiments and the accompanying drawings, wherein the embodiments are only for explaining the present invention and do not limit the present invention in any way.
Example 1
The functional specific molecular marker of the rice blast resistance gene Pib and the primer design thereof specifically comprise the following steps:
analysis of a1, Pib insertion/deletion (InDel) sites:
downloading a partial genome sequence (GenBank: AB013448.1) of a Pib rice donor variety from a public database, then carrying out sequence comparison on a Pib locus in the rice database, carrying out specific marker design according to a functional region difference locus, sequencing the genome sequence of the rice donor variety of Nipponbare and 9311 without complete corresponding regions, wherein the base parts with deletion and difference in comparison results are identified InDel loci;
wherein, the boxed part is the single base part of the Pib gene with difference detected after the comparison, and the blank is the single base part of the missing Pib gene detected after the comparison;
a2, designing a primer:
according to the design principle of InDel markers, primer design is carried out at the InDel differential site, and the base sequences of primer pairs are shown as follows: SEQ ID NO.1 (F1): 5'-TATGAGACTGCCTGGGAGGAA-3', respectively;
SEQ ID NO.2(R1)：5’-TCCATTATAATATAGGATAGT-3’；
a3, selecting a rice representative variety:
in the invention, 9 representative rice varieties are selected, and the following steps are carried out in sequence: 9311. yixiang A, BL1, CO39, Nipponbare, Lijiang Xinjiang black grain, Suxiu 863, Yiyou 3009 and Zhonghua 11;
a4, PCR amplification, obtaining a fragment containing a resistance gene Pib specificity InDel:
performing conventional PCR amplification on the primers SEQ ID NO.1 and SEQ ID NO.2 and the total DNA of the 9 rice varieties as templates, and performing polyacrylamide gel electrophoresis detection;
wherein, the PCR amplification reaction system comprises the following steps:
2x Reaction Mix:16μL；
primer SEQ ID NO.1(F1) (10 μm): 1 mu L of the solution;
primer SEQ ID NO.1(F1) (10 μm): 1 mu L of the solution;
2 μ L of DNA template (20-50 ng/. mu.L);
ddH2o: make up to 25 μ L;
the PCR temperature cycling conditions were as follows: 5 minutes at 94 ℃; 30 seconds at 94 ℃; 30 seconds at 55 ℃; 30 seconds at 72 ℃; 35 cycles; 7 minutes at 72 ℃; storing at 10 deg.C;
after the PCR reaction is finished, an appropriate amount of sample is taken to carry out electrophoresis detection on 3% agarose, and the electrophoresis condition is 110V and 40 minutes.
Example 2
The application of the functional specific molecular marker of the rice blast disease-resistant gene Pib in identifying the rice blast disease-resistant gene of a rice variety specifically comprises the following steps:
b1, amplification: carrying out PCR on the genome of the rice variety to be detected by using a primer F1 shown in SEQ ID NO.1 and a primer R1 shown in SEQ ID NO. 2;
b2, detection: detecting by using agarose electrophoresis, wherein if a nucleotide fragment with the molecular weight of 286bp in a PCR product is detected, the rice variety to be detected carries a rice blast resistance gene Pib; if the nucleotide fragment with the molecular weight of 286bp is not detected, the rice variety to be detected does not carry the rice blast resistance gene Pib.
Referring to FIG. 1, the amplification of the present invention using primer F1 shown in SEQ ID NO.1 and primer R1 shown in SEQ ID NO.2 was performed using total DNA of 9 selected representative varieties as templates; referring to FIG. 1, Lane 1 is DNAsder, Lane 2 is a fragment obtained by PCR using the genome of the rice variety IR24 of the Pib donor variety as a template, and the fragment and the rice blast resistance gene Pib are in a specific banding pattern, namely Lane 2 is a Pib gene specific molecular marker Pib-InDel, and the size of the fragment is 286 bp; the DNA templates in lanes 3-11 are 9311, Yixiang A, BL1, CO39, Nipponbare, Lijiang Xinjiang black grain, Suxiu 863, Yiyou 3009, and Zhonghua 11 in sequence; as shown in FIG. 1, in the rice variety carrying Pib, the electrophoresis detection band of the PCR amplification product is 286bp, but the electrophoresis detection band of the functional gene not containing the site is 286 bp.
The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all modifications of equivalent structures and equivalent processes, which are made by the present specification, or directly or indirectly applied to other related technical fields, are included in the scope of the present invention.
Claims (7)
1. A functional specific molecular marker of a rice blast resistance gene Pib is characterized in that: the rice blast resistance gene Pib functional specific molecular marker is Pib-InDel; the Pib-InDel is a molecular marker which is amplified from the genome DNA of a rice variety carrying the rice blast resistance gene Pib through a primer pair SEQ ID NO.1 and SEQ ID NO.2 to obtain a specific banding pattern with the rice blast resistance gene Pib; wherein,
SEQ ID NO.1：5’-TATGAGACTGCCTGGGAGGAA-3’；
SEQ ID NO.2：5’-TCCATTATAATATAGGATAGT-3’。
2. the functionally specific molecular marker of the rice blast resistance gene Pib according to claim 1, characterized in that: the rice variety carrying the rice blast resistance gene Pib is a rice disease-resistant variety IR 24.
3. The functionally specific molecular marker of the rice blast resistance gene Pib according to claim 2, characterized in that: the rice blast resistance gene Pib comprises a gene fragment SEQ ID NO.3 of a part of coded NBS-LRR type protein:
TATGAGACTGCCTGGGAGGAAGAGGTACAGGAAGCAAGGCGCAAGGGAGGTGAACTGAAGAGGAAAATCCGAGAACAGCTTGCTCGGAATCCAAACCAACCCATCATTACCTGAGCTCCTTTGGAGTTACTTTGCCGTGCTCCATACTATCCTACAAGTGAGATCCTCTGCAGTACTGCATGCTCACTGACATGTGGACCCGAGGGGCTGTGGGGCCCACATGTCAGTGAGCAGTACTGTGCAGTACTGCAGAGGACCTGCATCCACTATCCTATATTATAATGGA。
4. the method for detecting a molecule specific to a function of a rice blast disease-resistant gene Pib according to any one of claims 1 to 3, comprising the steps of:
a1, downloading the Pib and the homologous genome sequence thereof from the public database and the genome sequence of the corresponding region of the sequenced variety Nipponbare and 9311, carrying out sequence comparison aiming at the Pib locus, and screening the insertion/deletion InDel locus of the Pib which is specific and can be distinguished from other rice blast allelic resistance genes at the locus;
a2, designing a gene specific primer at the InDel site by using the InDel site information obtained in the step (1);
a3, carrying out PCR amplification by taking the total DNA of the rice blast resistant variety carrying the rice blast resistant gene Pib as a template, wherein the obtained PCR product is the specific molecular marker Pib-InDel of the rice blast resistant gene Pib.
5. Use of the functional specific molecule of the rice blast resistance gene Pib of any one of claims 1 to 3 for identifying rice blast resistance genes of rice varieties.
6. The application of the functional specificity molecule of the rice blast disease-resistant gene Pib in the identification of the rice blast disease-resistant gene of a rice variety as claimed in claim 5, which is characterized by comprising the following steps:
b1, amplification: carrying out PCR on the genome of the rice variety to be detected by using a primer F1 shown in SEQ ID NO.1 and a primer R1 shown in SEQ ID NO. 2;
b2, detection: detecting by using agarose electrophoresis, wherein if a nucleotide fragment with the molecular weight of 286bp is detected, the rice variety to be detected carries the rice blast resistance gene Pib; if the nucleotide fragment with the molecular weight of 286bp is not detected, the rice variety to be detected does not carry the rice blast resistance gene Pib.
7. A kit for identifying rice blast resistance of rice varieties is characterized in that: the nucleic acid sequence is shown as a primer pair in SEQ ID NO.1 and SEQ ID NO. 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010032359.2A CN111218521A (en) | 2020-01-13 | 2020-01-13 | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010032359.2A CN111218521A (en) | 2020-01-13 | 2020-01-13 | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111218521A true CN111218521A (en) | 2020-06-02 |
Family
ID=70808163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010032359.2A Pending CN111218521A (en) | 2020-01-13 | 2020-01-13 | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111218521A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113903397A (en) * | 2021-08-23 | 2022-01-07 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pib disease-resistant gene family functional genes |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007061027A (en) * | 2005-09-01 | 2007-03-15 | National Agriculture & Food Research Organization | Primer for identifying rice variety having resistance to rice blast disease by dna discrimination method and primer set in which plurality of primers are combined |
| CN102703443A (en) * | 2012-05-23 | 2012-10-03 | 华南农业大学 | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof |
| US20160153056A1 (en) * | 2013-02-07 | 2016-06-02 | China National Seed Group Co., Ltd. | Rice whole genome breeding chip and application thereof |
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
| CN108018371A (en) * | 2017-12-21 | 2018-05-11 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character |
-
2020
- 2020-01-13 CN CN202010032359.2A patent/CN111218521A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007061027A (en) * | 2005-09-01 | 2007-03-15 | National Agriculture & Food Research Organization | Primer for identifying rice variety having resistance to rice blast disease by dna discrimination method and primer set in which plurality of primers are combined |
| CN102703443A (en) * | 2012-05-23 | 2012-10-03 | 华南农业大学 | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof |
| US20160153056A1 (en) * | 2013-02-07 | 2016-06-02 | China National Seed Group Co., Ltd. | Rice whole genome breeding chip and application thereof |
| CN105950747A (en) * | 2016-06-02 | 2016-09-21 | 福建省农业科学院生物技术研究所 | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof |
| CN108018371A (en) * | 2017-12-21 | 2018-05-11 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113903397A (en) * | 2021-08-23 | 2022-01-07 | 华南农业大学 | Technical system with inclusion and accurate identification and excavation of rice blast Pib disease-resistant gene family functional genes |
| CN113903397B (en) * | 2021-08-23 | 2022-09-02 | 华南农业大学 | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yan et al. | Construction of an integrated map of rose with AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers | |
| Chapman et al. | A genomic scan for selection reveals candidates for genes involved in the evolution of cultivated sunflower (Helianthus annuus) | |
| Li et al. | Comparative mapping of quantitative trait loci associated with waterlogging tolerance in barley (Hordeum vulgare L.) | |
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| Kaur et al. | Utilization of KASP technology for wheat improvement | |
| Zhao et al. | Mapping and candidate gene screening of tomato Cladosporium fulvum-resistant gene Cf-19, based on high-throughput sequencing technology | |
| Teshome et al. | Assessment of genetic diversity in Ethiopian field pea (Pisum sativum L.) accessions with newly developed EST-SSR markers | |
| Li et al. | Precisely mapping a major gene conferring resistance to Hessian fly in bread wheat using genotyping-by-sequencing | |
| Thakur et al. | Extensive sequence variation in rice blast resistance gene Pi54 makes it broad spectrum in nature | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN112481275A (en) | Wheat stripe rust resistant gene yrZ15-1370 and molecular marker and application thereof | |
| Silvar et al. | Fine mapping and comparative genomics integration of two quantitative trait loci controlling resistance to powdery mildew in a Spanish barley landrace | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN110551844B (en) | Sugarcane cultivar genome SSR molecular marker development method and application | |
| CN113621733A (en) | Wheat spike number per spike and drought-resistant character related SNP site and application thereof | |
| CN108977568B (en) | Rice blast resistance gene Pik-p functional specificity molecular marker and application thereof | |
| CN111218521A (en) | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof | |
| CN107937600B (en) | Rice blast resistance gene locus Pik functional gene molecular marker and application thereof | |
| CN116200528B (en) | SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau. -2BL and application thereof | |
| CN105176994B (en) | Rice blast resistance gene Pi9 specific Function molecular labeling Pi9FNP and method and application | |
| CN103789431B (en) | Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof | |
| CN107988337A (en) | A kind of labeling method and its application of rice blast resistant rice identification method and gene | |
| CN113789404B (en) | Functional specificity molecular marker of rice blast resistance gene Pik-zh and application | |
| CN108179222B (en) | Nucleotide sequence of chorismate mutase related to high yield of rice and application thereof | |
| Fondevilla et al. | Expressional and positional candidate genes for resistance to Peyronellaea pinodes in pea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200602 |
|
| RJ01 | Rejection of invention patent application after publication |