CN103789431B - Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof - Google Patents
Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof Download PDFInfo
- Publication number
- CN103789431B CN103789431B CN201410036908.8A CN201410036908A CN103789431B CN 103789431 B CN103789431 B CN 103789431B CN 201410036908 A CN201410036908 A CN 201410036908A CN 103789431 B CN103789431 B CN 103789431B
- Authority
- CN
- China
- Prior art keywords
- wheat
- stripe rust
- reagent
- pcr amplification
- rust resisting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the primer pair of assisting sifting and seed selection stripe rust resisting wheat new lines.Primer pair is <i>Xcfd141</iGre atT.GreaT.GT and/or <i>Xgwm71</iGrea tT.GreaT.GT; Wherein, <i>Xcfd141</iGre atT.GreaT.GT-<i>FLEssT.LTssT. LT/i>:CGTAAAGATCCGAGAGGGTG; <i>Xcfd141</iGre atT.GreaT.GT-<i>RLEssT.LTssT. LT/i>:TCCGAGGTGCTACCTACCAG; <i>Xgwm71-F</iGr eatT.GreaT.GT:CAAGTGGAGCATTAGGTACACG; <i>Xgwm71-R</iGr eatT.GreaT.GT:GGCAGAGCAGCGAGACTC.The present invention also provides the method for the reagent of assisting sifting and seed selection stripe rust resisting wheat new lines, test kit and screening and seed selection stripe rust resisting wheat new lines.Method assisted Selection of the present invention can improve breeding efficiency, can ensure again effective selection of disease resistance.Seed selection new variety, traditional breeding method generally needs the 8-10 year, applies molecular marker assisted selection of the present invention and only needs the 3-5 year in theory, shorten breeding process widely, improve breeding efficiency.
Description
Technical field
The invention belongs to genetically engineered field, be specifically related to the primer special of assisting sifting and cultivation stripe rust resisting wheat new lines, reagent and test kit and selection thereof.
Background technology
Stripe rust of wheat be by wheat stripe rust (
pucciniastriiformisf.sp.
tritici) a kind of leaf portion air infection diseases of causing, distribution is wide, harm is serious.China is Epidemics of Wheat Strip Rust district maximum in the world, and wherein, northwest and southwest are particularly serious, and this region is also the source of New Race of Wheat Stripe Rust In China.The areas such as Longnan of Gansu Province, the sky and water, Long Dong are the bases, Main Bacteria source of the most important Yue Xiaqu of China's wheat stripe rust and the morbidity of wheat main producing region, east autumn seedling.Bacterium source, Yue Xia district amount number whether fall ill in close relations with occurring degree with wheat main producing region, east autumn seedling.From the 1950's so far; once there are 8 fairly large Epidemics of Wheat Strip Rusts in China; wherein 1950,1964,1990 and 2002 the four times occurring area that are very popular are maximum; endanger also the heaviest; front twice onset area reaches more than 200,000,000 mu, rear twice morbidity more than 1.1 hundred million mu, loses wheat 600,300,265 and 1,000,000 tons of (Wan An people etc. respectively; China's Reviews of occurrence of wheat stripe rust disease plant protection 2003,29:5-8 in 2002).Variant between stripe rust occurrence degree year over nearly 5 years.Within 2009, stripe rust of wheat occurrence scope relates to 16 provinces (city, district), nearly 6,000 ten thousand mu of occurring area, its occurrence scope and degree are rare over nearly 20 years (old ten thousand power in Institute of Plant Protection of the Chinese Academy of Agricultural Sciences, http://finance.people.cm.cn/nc/GB/61158/9399555.html).2010-2011 is domestic because of serious drought in spring, and stripe rust occurs light, little to Wheat Yield Influence.Within 2012, stripe rust of wheat moderate occurs, partial area occur comparatively serious, and this year is excellent period of screening stripe rust resisting kind, and Wheat Production onset area relates to the ground such as Shan, sweet, blue or green, river, cloud, expensive, Hubei, Chongqing, occurrence scope is wide, and hazard rating is large.In recent years because climate change, dressing seed and seedling stage in autumn, spring look into the reasons such as disease in time, stripe rust obtains larger control.But because of the raising of strip rust bacteria Summer-over rate, wintering rate, variety resistance decline, the appearance etc. of Novel physiological microspecies, the impetus of Epidemics of Wheat Strip Rust happens occasionally.
Breeding resistant variety prevents and treats most economical, the safe and effective method of stripe rust of wheat.The wheat stripe rust resisting ospc gene named at present has 56, and being distributed in 53 sites (having 3 multiple allelomorphoss), is wherein Race specificity disease-resistant gene in seedling stage mostly.Seedling stage, disease-resistant gene was obviously liked by breeding man deeply because of good selection, resistance, but the single microspecies of establishing in large scale specially change disease-resistant gene kind in production, the directional trend that can accelerate pathogenic bacteria microspecies is selected, and feeds the growth of dominant races population, accelerates Rust resistant varieties disease resistance and loses frequency.Establishing in large scale as " Lip river class " and " numerous 6 " Derivative line creates the new microspecies CYR31 and CYR32 that causes a disease, thus the stripe rust that result in 2002 is very popular.Because recognizing the potential hazard of single disease-resistant gene, breeding scholar and pathology of plants man wish the usage period by utilizing multiple gene polymerization, gene layout and multiline variety to extend disease-resistant gene in seedling stage.Long-term research and practice proves, realize multiple gene polymerization, gene layout and multiline variety, must have abundant effective anti-source, and effective disease-resistant gene known at present only has
yr5, Yr15, Yr18,
yr26with
yr29deng, only rely on these genes to realize stripe rust of wheat Sustainable Control, difficulty is very large.Therefore find and excavate new anti-source electrode important.Certainly utilize molecular marker assisted selection, the effective utilization accelerating excellent anti-source is also abnormal important.
At present, cloned many plant disease resistance genes (R) both at home and abroad, although these R genes are for different bacteriums, fungi, virus, nematode etc., the protein product of their codings has surprising structural similarity.Common wheat (TriticumaestivumL.) is allohexaploid, not only comprise A, B and D tri-homologous chromosomes groups, and genome is very huge, tumor-necrosis factor glycoproteins is up to more than 80%, in addition wheat stripe rust is that live body is parasitic, cause the stripe rust of wheat disease-resistant gene only three of having cloned at present, namely
yr10,
yr18/Pm38/Lr34,
yr36.
yr10full length gene 3630bp, comprises 2 exons (Exon) and 1 intron (Intron),
yr10for microspecies transforming gene, its structure has typical NBS-LRR, shows similarity to a certain degree with the disease-resistant gene of cloning on amino acid levels.
lr34gene be one simultaneously hold concurrently Stripe rust resistance (
yr18) (Suenagaetal., 2003), Powdery Mildew (
pm38) (Lillemoetal., 2008) and stem rust (
sr57) " one because of the multiple-effect " gene of (Singhetal.unpublished), simultaneously also with barley yellow dwarf viral disease resistance (
bdv1) (Singh, 1993) relevant, for abc transport subbase because of.
yr36under Adult plant comparatively high temps (25-35 DEG C), show resistance of wide spectrum, then show at low temperatures susceptible (less than 15 DEG C), comprise lipid transport structural domain Start region (Uauyetal., 2005 relevant to Steroidgenesis acute regulation protein; Fuetal., 2009).
yr18/Lr34/Pm38with
yr36no matter with the disease-resistant gene of cloning at protein level or DNA level, all there is no significant similarity, and there is no common structural domain between two genes; Illustrate that the molecular mechanism of strain disease-resistant gene is more complicated.Be positioned at 1BL at present chromosomal
yr29/Lr46/Pm39chromosomal with 4DL
yr46/Lr67/Pm46and on 5AL karyomit(e)
yr48deng Plant resistance gene be divided into from or closely linked molecule marker excavate (Rosewarneetal., 2008; Herrera-Foesseletal., 2011; Loweetal., 2011), the cloning work well afoot of these genes.Along with clone and the functional analysis of more and more Stripe Rust Resistance Gene, will people be contributed to deeply understanding the molecular mechanism of plant disease-resistant, providing theoretical foundation for cultivating lasting, anti-type wheat breed of holding concurrently.
Molecular marker assisted selection be by with objective trait close linkage or be divided into from molecule marker offspring's strain carried out to the screening of target gene or chromosome segment, not only can obtain the fine individual plant containing target gene in generation morning, reduce conventional anti-disease enzyme workload, avoid inoculation uneven, fall ill insufficient or identify the inaccurate wrong choice brought, and the multiple disease-resistant gene of polymerizable, greatly improve permanent disease-resistant breeding efficiency.Molecular Marker Assisted Selection Technology is widely applied in the wheat flour quality researchs such as Australia, the U.S. and international corn center (CIMMYT), and by pest-resistant, disease-resistant to be polymerized with Quality Gene in together with, select the new variety of wheat of double Resistant, high-quality, high yield water saving, play huge effect in achievement release areas.
Although also there is certain research in China in this respect, the report of Application effect is less.Gansu Province mirror 127 be one in Gansu the winter wheat variety of popularizing area more than 1,000,000 mu for many years, the 2002 Nian Huo Gansu Province scientific-technical progress first prizes are the excellent kinds integrating high yield, drought resisting, Rust resistance.Extensive plantation through more than ten years at Longnan of Gansu Province, Gansu Province Dong Maiqu, to 29,31,32,33 etc. showing stable resistance in current popular microspecies bar always.Because of the strip rust resistemce of Gansu Province mirror 127, within 2002, at stripe rust epidemic period, tremendous contribution has been made in the agriculture production for locality.At 2007-2008, with in bar 29,31,32, water 4, water 5, water 7, water 14,20 Chinese strip rust bacteria physiological strains such as HY8 have carried out gene derivation to Gansu Province mirror 127, result show Gansu Province mirror 127 wherein 13 bacterial classifications are shown as in high resistance, its anti-spectrum is different from any one known, and showing may containing new gene resistant to stripe rust.Through the mark location of 127 disease-resistant genes that reflect to Gansu Province, find that it carries new microspecies and specially changes disease-resistant gene, and be located in 3D karyomit(e) with SSR and Dart mark, further demonstrate the exactness of conclusions.
Summary of the invention
The object of this invention is to provide the primer special of assisting sifting and seed selection stripe rust resisting wheat new lines, special agent and test kit and selection thereof.
The SSR molecular marker (i.e. primer pair) that the present invention is used for assisting sifting and seed selection stripe rust resisting wheat new lines has 2:
xcfd141,
xgwm71, its sequence refers to primer table (table 1).
SSR molecular marker for assisting sifting and seed selection stripe rust resisting wheat new lines provided by the invention be in following three kinds any one:
1) shown in, primer is primer pair 1:
xcfd141, relate to nucleotide sequence 1 and the sequence 2(table 1 of primer pair 1);
2) shown in, primer is primer pair 2:
xgwm71, relate to nucleotide sequence 3 and the sequence 4(table 1 of primer pair 2);
3) shown in, primer is primer 1 and primer 2, relates to the nucleotide sequence 1,2 of primer pair 1 and nucleotide sequence 3, the 4(table 1 of primer pair 2).
Table 1 is for the SSR molecular marker sequence of assistantly screening anti-stripe rust wheat
。
The reagent that the present invention is used for assisting sifting and seed selection stripe rust resisting wheat new lines comprises following three kinds:
1) primer pair is comprised
xcfd141pCR reagent 1;
2) primer pair is comprised
xgwm71pCR reagent 2;
3) primer pair is comprised
xcfd141pCR reagent 1 and comprise primer pair
xgwm71pCR reagent 2.
Described PCR reagent 1 is made up of described primer pair 1, dNTP, archaeal dna polymerase and pcr amplification damping fluid;
Described PCR reagent 2 is made up of described primer pair 2, dNTP, archaeal dna polymerase and pcr amplification damping fluid.
Each in described PCR reagent 1, described PCR reagent 2 in dNTP final concentration in the PCR reagent at its place is 0.2mM; The final concentration of described archaeal dna polymerase in above PCR reagent is 0.067U/ μ l.
The pathogenic bacteria of described stripe rust is wheat stripe rust (Pucciniastriiformisf.sp.tritici), and described wheat stripe rust (Pucciniastriiformisf.sp.tritici) to be specially in wheat stripe rust (Pucciniastriiformisf.sp.tritici) microspecies bar No. 32.
The present invention is also provided for the test kit of assisting sifting and seed selection stripe rust resisting wheat new lines, comprises following 1)-3) any one test kit.
1) test kit shown in is the test kit containing described PCR reagent 1;
2) test kit shown in is the test kit containing described PCR reagent 2;
3) test kit shown in is the test kit containing described PCR reagent 1 and PCR reagent 2.
4th object of the present invention is to provide a kind of method of assistantly screening anti-stripe rust wheat new lines, and the method specifically comprises the following steps:
With primer of the present invention, described reagent or described test kit, pcr amplification is carried out to wheat to be measured, in electrophoresis detection pcr amplification product, whether target resistant gene exists: contrast not carry molecule marker linked gene and the material that carries molecule marker linked gene for yin and yang attribute respectively, being defined as or candidate is stripe rust resisting wheat if wheat to be measured is consistent with carrying molecule marker linked gene material banding pattern, being defined as or candidate is non-stripe rust resisting wheat if wheat to be measured is consistent with not carrying molecule marker material banding pattern.
Described method of carrying out pcr amplification to wheat to be measured is that the PCR reaction system of every 15 μ l is:
Template DNA (20-50ng/ μ l) 2 μ l
10mM(final concentration is 0.2mM) dNTPs0.3 μ l
Taq DNA polymerase (final concentration is 0.067U/ μ l) 0.4 μ l
Primer (4pmol) the 2 μ l of mark shown in 1 or 2
10×PCRbuffer1.5μl
With sterile distilled water postreaction system to 15 μ l;
The program of described pcr amplification is: 94 DEG C of denaturation 5min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.
The method that described pcr amplification result carries out electrophoresis is: every part of pcr amplification product is added 2.5 μ l sex change sample-loading buffers, mixing, 95 DEG C of sex change 5-7 minute.With 5-6% denaturing polyacrylamide gel electrophoresis separation detection, buffering liquid is: upper groove 0.3 × TBE, lower groove 0.5 × TBE, power 80W, electrophoresis 50-80min, the development of silver dye.
5th object of the present invention provides a kind of method of assist-breeding high yield and/or stripe rust resisting wheat, comprises the following steps:
1) hybridize with another high-quality wheat parent to be measured of getting bumper crops with Gansu Province mirror 127, obtain F
1generation;
2) F step 1) obtained
1carry out selfing for wheat, obtain F
2for wheat;
3) by the described primer pair step 2 in illustrated primer, shown PCR reagent or shown test kit) F that obtains
2pcr amplification is carried out, electrophoresis detection pcr amplification product for wheat:
If the product banding pattern of pcr amplification and Gansu Province reflect 127 consistent, then described wheat to be measured is or candidate is stripe rust resisting wheat;
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 banding patterns that increase are inconsistent, then described wheat to be measured is or candidate is non-stripe rust resisting wheat;
4) be stripe rust resisting F by the candidate that step 3) obtains
2carry out selfing for wheat and obtain F
3for wheat, by described F
3f is obtained for wheat selfing
4for wheat, by described F
4f is obtained for wheat selfing
5for wheat, by described F
5f is obtained for wheat selfing
6for wheat;
5) with the F that illustrated primer, shown PCR reagent or shown test kit obtain step 4)
6carry out pcr amplification for wheat, obtain PCR primer, electrophoresis detection pcr amplification product:
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 banding patterns that increase are consistent, then described wheat to be measured is or candidate is stripe rust resisting wheat;
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 amplified bands are inconsistent, then described wheat to be measured is or candidate is non-stripe rust resisting wheat;
6) be stripe rust resisting F by described candidate
6carry out selfing for wheat, obtain F
7for wheat, screening output is higher than the F of high yield Parents
7for wheat, be high yield, stripe rust resisting wheat;
Described pcr amplification in step 3), all with F
2genomic dna for wheat is template;
Described pcr amplification in step 5), all with F
6genomic dna for wheat is template;
The pathogenic bacteria of described stripe rust be wheat stripe rust (
pucciniastriiformisf.sp.
tritici), described wheat stripe rust (
pucciniastriiformisf.sp.
tritici) be specially wheat stripe rust (
pucciniastriiformisf.sp.
tritici) in microspecies bar No. 32;
Described wheat PCR to be measured detects and all adopts polyacrylamide gel electrophoresis.
Wherein, described pcr amplification condition is: 94 DEG C of denaturation 5min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.
Described electrophoresis every part of pcr amplification product is added 2.5 μ l sex change sample-loading buffers, mixing, 95 DEG C of sex change 5-7 minute; With 5-6% denaturing polyacrylamide gel electrophoresis separation detection, buffering liquid is: upper groove 0.3 × TBE, lower groove 0.5 × TBE, power 80W, electrophoresis 50-80min, the development of silver dye.
6th object of the present invention is to provide above-mentioned primer pair, reagent, the application of test kit in screening and cultivation stripe rust resisting wheat new lines.
Through test determination, the output of described high yield, stripe rust resisting wheat is compared with high yield Parents, and the ratio of raising is higher than 5%.
Molecule marker for assisting sifting and cultivation stripe rust resisting wheat new variety provided by the invention has 2,
xcfd141,
xgwm71.The invention provides a kind of method that molecule marker assists breeding for disease resistance, the method is consistent with the process of conventional breeding, unlike, after parents' apolegamy, it carries out Molecular Detection first to utilize above-mentioned primer pair, and then determines which combination can utilize the method; To the combination that these are suitable for, at F
2time, with described 2 SSR marker, reagent or test kits, respectively pcr amplification is carried out to candidate's individual plant that breeding man is selected, detect amplified production, the 127 consistent individual plants of banding pattern that increase that reflect with Gansu Province in amplified production are the candidate's individual plant carrying target Stripe Rust Resistance Gene, only these individual plants are used for next step breeding work; At F
6described primer, reagent or test kit is again utilized to carry out Molecular Detection to the strain of substantially isozygotying, thus whether the selected strain of checking is still containing target Stripe Rust Resistance Gene, retain the strain containing gene resistant to stripe rust, appraise through comparison further by comprehensive agronomy proterties, and then obtain the excellent and seed materials of high stripe rust resisting of economical character, finally obtain kind.Method assisted Selection of the present invention can improve breeding efficiency, can ensure again effective selection of disease resistance.Seed selection new variety, traditional breeding method generally needs the 8-10 year, and molecular marker assisted selection only needs the 3-5 year in theory, shortens breeding process widely, improves breeding efficiency.
Accompanying drawing explanation
Fig. 1 is for using SSR molecular marker
xcfd141increase disease-resistant parent Gansu Province mirror 127(Pr), Susceptible parent engraves virtuous 169(Ps), disease-resistant pond (Br), susceptible pond (Bs) and F2 colony individual plant result;
Fig. 2 is for using SSR molecular marker
xgwm71increase disease-resistant parent Gansu Province mirror 127(Pr), Susceptible parent engraves virtuous 169(Ps), disease-resistant pond (Br), susceptible pond (Bs) and F2 colony individual plant result;
Fig. 3 is that 9 on 3D karyomit(e) mark and disease-resistant gene
yrLj127linkage map.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.
All primer synthesis complete by Beijing AudioCodes biotech firm.In following examples, all wheat lines used are all from wheat institute of Gansu Academy of Agricultural Science.
embodiment 1:a new gene resistant to stripe rust in wheat lines Gansu Province mirror 127
yrLj127discovery and the acquisition of linked marker
one, phenotypic acquisition and colony's wheat seeding situation thereof
Make institute of section Quality Laboratory low temperature controllable greenhouse in the Chinese Academy of Agricultural Sciences and complete anti-disease enzyme work, carry out inoculation Resistance Identification with 32 enantiopathy parent Gansu Province mirror 127, Susceptible parent inscription virtuous 169 and filial generation F1, F2 and F3 in current Epidemic Races bar, bacterial classification is provided by Institute of Plant Protection of the Chinese Academy of Agricultural Sciences.Stripe rust of wheat infects type grade scale see table 2 seedling stage, engrave virtuous 169, Gansu Province mirror 127 and F1, F2 colony individual plant thereof to strip rust bacteria kind CYR32 seedling stage response type see table 3.Statistic analysis result shows: Gansu Province reflects anti-high resistance in 127 couples of CYR32 performance, and infecting type is 0; ~ 2, virtuous 169 performance height of engraving are felt, and infecting type is 4.The type that infects of F1 generation 10 individual plants of the two hybridization is 2 grades, close with disease-resistant parental performance.500 its F2 are 0 for infecting type in individual plant; Level have 107 strains, infect 73 strains of 1 grade, type, infect 180 strains of 2 grades, type, infect 38 strains of 3 grades, type, infect 102 strains of 4 grades, type.F1, F2 and F3 generation according to parents and hybridization thereof infects type rank and the number infecting type at different levels, by 0; ~ 2
+level divides into disease-resistant, and 3
-~ 4 grades divide into susceptible, then F2 is 360R:140S for the anti-sense segregation ratio of colony, and Chi-square test meets theoretical proportions (the χ 2=2.40 of 3R:1S, df=1, P>0.05), illustrate that Gansu Province 127 pairs of CYR32 resistances of reflecting are controlled by 1 pair of dominant gene, tentative by name
yrLj127.
Table 2 stripe rust of wheat infects type grade scale seedling stage
。
Table 3 engraves virtuous 169, Gansu Province mirror 127 and F1, F2 colony individual plant thereof to the response type in seedling stage of strip rust bacteria kind CYR32
。
two, the acquisition that primer special is right
Select 10 extremely disease-resistant individual plants and 10 extremely susceptible individual plants respectively its DNA to be carried out balanced mix according to seedling stage assay result and form disease-resistant pond and susceptible pond.Select and be distributed in wheat 21 chromosomal 800 pairs of SSR primer pair parent Gansu Province mirror 127 and the virtuous 169 polymorphism screenings of inscription, comprise the GWM(1998 that R der etc. announces) (Gaterslebenwheatmicrosatellite) serial primer, the GDM series that Pestsova etc. (2000) report, the BARC series that Song etc. (2002) develop, the WMC(WheatMicrosatelliteConsortium that Gupta etc. (2002) report) series, the CFA that Sourdille etc. (2004) report, the primers such as CFD and GPW series, above primer basic cover break wheat full-length genome.267 pairs of SSR primers show polymorphism, wherein show polymorphism between 17 pairs of anti-sense ponds of primer, only 4 to mark after upper microcommunity
xgwm52,
xgdm72,
xbarc119with
xcfd141show certain polymorphism, according to the public collection of illustrative plates of wheat molecular marker, wherein 3 marks on 3D karyomit(e)
xgwm52,
xgdm72with
xcfd141between parent and anti-sense pond, there is polymorphism, tentatively show that these marks are chain with Stripe Rust Resistance Gene.
three, the acquisition of linkage map and source thereof
Select on 3D karyomit(e)
xgwm,
xbarc,
xgdm,
xwmcincrease between parents, anti-sense pond Deng SSR and EST primer, to having microcommunity and large group on the mark of polymorphism to verify between parents, anti-sense pond, whether tool stablizes polymorphism for it,
xcfd141,
xgwm71with
bE591684be marked at parents Deng 9, between anti-sense pond and target group, stably amplify difference.Use Mapmaker3.0b(Lincoln etc., 1992) 2 tests (LOD>=3.0) carry out linkage analysis, find this 9 marker sites and Stripe Rust Resistance Gene
yrLj127close linkage, linkage distance is 1.5cM-29.3cM, distance
yrLj127nearest is labeled as
xcfd141with
xgwm71, genetic distance is respectively 1.5cM and 1.8cM(and sees Fig. 3).
Wherein, the PCR reaction system of SSR label primer is: PCR reaction system is 15 μ l, that is: 1.5 μ l10 × PCRbuffer, 0.3 μ l10mMdNTPs, every bar primer 2 μ l(4pmol),
taqarchaeal dna polymerase (2.5U/ μ l)) 0.4 μ l, template DNA 2 μ l(20ng), with sterile distilled water postreaction system to 15 μ l.Response procedures: 94 DEG C of denaturation 4min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.2.5 μ l sex change loading buffer are added, mixing, 95 DEG C of sex change 5-7 minute in pcr amplification product.With 5-6% denaturing polyacrylamide gel electrophoresis separation detection, buffering liquid is: upper groove 0.3 × TBE, lower groove 0.5 × TBE, power 80W, electrophoresis 50-80min, the development of silver dye.
The PCR reaction system of EST labeled primer is: cumulative volume 20 μ l, wherein 2 μ l template DNAs (containing 80ng), 2 μ l10 × PCR damping fluids, 0.4 μ ldNTPs (40mM), 0.2 μ lTaqDNA polysaccharase (2.5U/ μ l) and 1.3 μ l primers (4pmol), with sterile distilled water postreaction system to 20 μ l.Response procedures: 94 DEG C of denaturations 5 minutes; Then 94 DEG C of sex change 1 minute, 52 DEG C-65 DEG C annealing, 1 minute (different primers annealing temperature can different), 72 DEG C of extensions 2 minutes, 40 circulations; Last 72 DEG C extend 10 minutes.PCR primer 12% non-denaturing polyacrylamide gel electrophoresis 2.5-3.5 hour under 80W power, the development of silver dye.
xcfd141with
xgwm71as
yrLj127close linkage flanking marker, fully can be applied to the tracing detection of this gene transgression economical character Parents, to guarantee effective importing of disease-resistant gene, is the important means of gene pyramiding and assisted Selection.
With distance disease-resistant gene
yrLj127two nearest marks
xcfd141with
xgwm71further detection 200 F3 familys (table 4).Interpretation of result shows: 200 F3 familys meet 1 and resist: 2 are separated: the segregation ratio (χ 2=1.87, df=2, P>0.05) of 1 sense, proves that Gansu Province mirror 127 is containing a pair dominant Stripe Rust Resistance Gene further.
The pathogenic bacteria of described stripe rust is wheat stripe rust (Pucciniastriiformisf.sp.tritici), and described wheat stripe rust (Pucciniastriiformisf.sp.tritici) to be specially in wheat stripe rust (Pucciniastriiformisf.sp.tritici) microspecies bar No. 32.
The F2 that released by the response type in F3 family seedling stage of table 4 is for the genotype of individual plant and corresponding two marker sites thereof
xcfd141with
xgwm71banding pattern
。
Note: RR=isozygotys disease-resistant gene type; Rr=heterozygous genotypes; Rr=isozygotys susceptible genotype; The disease-resistant banding pattern occurred in A=Gansu Province mirror 127;
The susceptible banding pattern occurred in B=inscription virtuous 169; H=heterozygosis banding pattern.
embodiment 2 marks checking and application
Black No. 1 of Gansu Province (mirror 127/ // Gansu Province, mirror 127//Gansu Province, spiral shell precious No. 1/Gansu Province mirror 127), mirror 386(1321/ Gansu Province, Gansu Province mirror 127) and Gansu Province mirror 103(Gansu Province mirror 127/Mo (W) 697) one of parent be Gansu Province and reflect 127, three kinds be at present seedling stage susceptible, Adult plant stripe rust resisting, strong winter habit Drought resistant Wheat kind, extensively plant at east Gansu drought plateau.
Be divided into from close linkage marker assisted selection effect and practicality in order to verify from Gansu Province 127 disease-resistant genes that reflect, configuration black No. 1 of Gansu Province, Gansu Province mirror 103 and Gansu Province mirror 386 combination, with the Breeding Process of molecular marker assisted selection and above 3 kinds of traditional breeding method simulation.Its Breeding Process is as follows: F
1in generation, does not eliminate, and gathers in the crops all plant after impurity elimination; F
2in generation, about program request 1000 strain, in its process of growth, select 50-80 strain candidate individual plant by plant formalness and variable rate technology, then utilize above-mentioned 127 disease-resistant genes that reflect with Gansu Province (
yrLj127) closely linked 2 SSR marker (
xcfd141with
xgwm71) Molecular Detection is carried out to candidate's individual plant, retain individual plant containing this Stripe Rust Resistance Gene (namely reflecting the consistent object band of 127 banding patterns containing with check variety Gansu Province in its PCR primer), screening individual plant altogether 35-55 is individual; F
3-F
5generation, same to conventional breeding, row broadcasts elected individual plant offspring, from elite plant strain, select the most excellent individual plant, finally has 15-40 individual plant to be selected in; F
6in generation, by the seed of elected individual plant respectively by community dense planting, select the excellent and consistent community of performance according to economical character and disease resistance, then primer is utilized to the strain of elected community
xcfd141and/or
xgwm71carry out Markers for Detection, only retain and to reflect the strain of 127 disease-resistant gene target stripe containing Gansu Province, be respectively 5-20; Head progeny row drilling is carried out to the material of screening, then carries out variety comparative test etc., therefrom to have cultivated with Gansu Province black No. 1, Gansu Province mirror 103 and Gansu Province reflects the basically identical new strain of wheat of 386 phenotypes.Molecule tracing process finds to carry in black No. 1 of Gansu Province, Gansu Province mirror 386 combination offspring
yrLj127individual ratio high, and Gansu Province mirror 103 combination offsprings carry
yrLj127individual ratio low, illustrate that gene transport in various combination is different.This research prove Gansu Province of the present invention reflect 127 disease-resistant genes mark effectively can be applied to assisted Selection stripe rust resisting wheat kind, mark reproducible, practical, assisted Selection effect highly significant.
The concrete grammar utilizing molecule marker to carry out detecting is: utilize molecule marker to carry out pcr amplification to sample, amplified production is carried out electrophoresis, is compared by electrophoretic band with the target banding pattern of disease-resistant variety, selects banding pattern consistent.
In described pcr amplification, the PCR reaction system of every 15 μ l is as follows:
Template DNA (20-50ng/ μ l) 2 μ l
10mM(final concentration is 0.2mM) dNTPs0.3 μ l
Taq DNA polymerase (final concentration is 0.067U/ μ l) 0.4 μ l
Primer (4pmol) 2 μ l
10×PCRbuffer1.5μl
With sterile distilled water postreaction system to 15 μ l.
The program of described pcr amplification is: 94 DEG C of denaturation 5min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.Every part of pcr amplification product is added 2.5 μ l sex change sample-loading buffers, mixing, 95 DEG C of sex change 5-7 minute.With 5-6% denaturing polyacrylamide gel electrophoresis separation detection, buffering liquid is: upper groove 0.3 × TBE, lower groove 0.5 × TBE, power 80W, electrophoresis 50-80min, the development of silver dye.
embodiment 3
The difference of the present embodiment and embodiment 2 is: the present embodiment the primer is
xcfd141, all the other steps are all identical.Last to have cultivated equally with Gansu Province black No. 1, Gansu Province mirror 103 and Gansu Province reflects the basically identical new strain of wheat of 386 phenotypes.
embodiment 4
The difference of the present embodiment and embodiment 2 is: the present embodiment the primer is
xgwm71, all the other steps are all identical.Last to have cultivated equally with Gansu Province black No. 1, Gansu Province mirror 103 and Gansu Province reflects the basically identical new strain of wheat of 386 phenotypes.
Conclusion: application
xcfd141with
xgwm71in arbitrary pair of primers just can complete the screening of stripe rust resisting wheat kind, when to use two pairs of primer pairs simultaneously, can phase mutual induction card.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. a primer pair for assisting sifting and seed selection stripe rust resisting wheat new lines, described primer pair is
xcfd141and/or
xgwm71;
Wherein,
xcfd141-
f: CGTAAAGATCCGAGAGGGTG;
Xcfd141-
R：TCCGAGGTGCTACCTACCAG；
Xgwm71-F：CAAGTGGAGCATTAGGTACACG；
Xgwm71-R：GGCAGAGCAGCGAGACTC。
2., for a reagent for assisting sifting and seed selection stripe rust resisting wheat new lines, comprise reagent 1 and/or reagent 2;
Described reagent 1 is for comprising primer pair
xcfd141pCR reagent 1;
Described reagent 2 is for comprising primer pair
xgwm71pCR reagent 2.
3. reagent according to claim 2, is characterized in that: described PCR reagent 1 is by described primer pair
xcfd141, dNTP, archaeal dna polymerase and pcr amplification damping fluid composition; Described PCR reagent 2 is by described primer pair
xgwm71, dNTP, archaeal dna polymerase and pcr amplification damping fluid composition;
Each in described PCR reagent 1, PCR reagent 2 in dNTP final concentration in the PCR reagent at its place is 0.2mM; The final concentration of described archaeal dna polymerase in above PCR reagent is 0.067U/ μ l.
4., for a test kit for assisting sifting and seed selection stripe rust resisting wheat new lines, it is characterized in that: described test kit comprises the PCR reagent 1 described in Claims 2 or 3 and/or PCR reagent 2.
5. the method for an assistantly screening anti-stripe rust wheat new lines, with primer pair described in claim 1, described in reagent described in claim 2 and 3 or claim 4, test kit carries out pcr amplification to wheat to be measured, in electrophoresis detection pcr amplification product, whether target resistant gene exists: contrast not carry molecule marker linked gene and the material that carries molecule marker linked gene for yin and yang attribute respectively, to be defined as or candidate is stripe rust resisting wheat if wheat to be measured is consistent with carrying molecule marker linked gene material banding pattern, to be defined as or candidate is non-stripe rust resisting wheat if wheat to be measured is consistent with not carrying molecule marker material banding pattern.
6. method according to claim 5, is characterized in that: the program of described pcr amplification is: 94 DEG C of denaturation 5min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.
7. a method for assist-breeding high yield and/or stripe rust resisting wheat, is characterized in that: step is as follows:
1) hybridize with another high-quality wheat parent to be measured of getting bumper crops with Gansu Province mirror 127, obtain F
1generation;
2) F step 1) obtained
1carry out selfing for wheat, obtain F
2for wheat;
3) with test kit described in reagent described in primer pair, claim 2 and 3 described in claim 1 or claim 4 to step 2) F that obtains
2pcr amplification is carried out, electrophoresis detection pcr amplification product for wheat:
If the product banding pattern of pcr amplification and Gansu Province reflect 127 consistent, then described wheat to be measured is or candidate is stripe rust resisting wheat;
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 amplified bands are inconsistent, then described wheat to be measured is or candidate is non-stripe rust resisting wheat;
4) be stripe rust resisting F by the candidate that step 3) obtains
2carry out selfing for wheat and obtain F
3for wheat, by described F
3f is obtained for wheat selfing
4for wheat, by described F
4f is obtained for wheat selfing
5for wheat, by described F
5f is obtained for wheat selfing
6for wheat;
5) with the F that test kit described in reagent described in primer pair, claim 2 and 3 described in claim 1 or claim 4 obtains step 4)
6carry out pcr amplification for wheat, obtain PCR primer, electrophoresis detection pcr amplification product:
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 banding patterns that increase are consistent, then described wheat to be measured is or candidate is stripe rust resisting wheat;
If the product banding pattern of pcr amplification and Gansu Province reflect, 127 banding patterns that increase are inconsistent, then described wheat to be measured is or candidate is non-stripe rust resisting wheat;
6) be stripe rust resisting F by described candidate
6carry out selfing for wheat, obtain F
7for wheat, screening output is higher than the F of high yield Parents
7for wheat, be high yield, stripe rust resisting wheat;
The pathogenic bacteria of described stripe rust is wheat stripe rust, and described wheat stripe rust to be specially in wheat stripe rust microspecies bar No. 32.
8. method according to claim 7, is characterized in that: described pcr amplification condition is: 94 DEG C of denaturation 5min; 45 circulations subsequently: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min, 72 DEG C extend 2min; Finally extend 8min.
9. method according to claim 7, is characterized in that: described electrophoresis every part of pcr amplification product is added 2.5 μ l sex change sample-loading buffers, mixing, 95 DEG C of sex change 5-7 minute; With 5-6% denaturing polyacrylamide gel electrophoresis separation detection, buffering liquid is: upper groove 0.3 × TBE, lower groove 0.5 × TBE, power 80W, electrophoresis 50-80min, the development of silver dye.
10. the application in screening and cultivation stripe rust resisting wheat new lines of the reagent described in primer pair according to claim 1, Claims 2 or 3, test kit according to claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410036908.8A CN103789431B (en) | 2014-01-26 | 2014-01-26 | Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410036908.8A CN103789431B (en) | 2014-01-26 | 2014-01-26 | Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103789431A CN103789431A (en) | 2014-05-14 |
| CN103789431B true CN103789431B (en) | 2016-01-06 |
Family
ID=50665483
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410036908.8A Expired - Fee Related CN103789431B (en) | 2014-01-26 | 2014-01-26 | Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103789431B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200122B (en) * | 2014-11-17 | 2019-01-18 | 中国农业科学院植物保护研究所 | Quantitative detection kit for wheat stripe rust and application thereof |
| CN114600767A (en) * | 2022-04-07 | 2022-06-10 | 四川省农业科学院作物研究所 | Method for rapidly breeding wheat durable stripe rust resistant variety |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302564A (en) * | 2008-05-27 | 2008-11-12 | 周口市农业科学院 | Primer sequence for screening wheat brown leaf rust-resistance and use thereof |
| CN101838694A (en) * | 2010-03-16 | 2010-09-22 | 河北农业大学 | Primer sequence for screening wheat leaf rust resistance gene and application thereof |
| CN102229986A (en) * | 2011-05-24 | 2011-11-02 | 中国农业科学院作物科学研究所 | Method for assisted selection of wheat variety with stripe rust resistance and special PCR reagent used therein |
-
2014
- 2014-01-26 CN CN201410036908.8A patent/CN103789431B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302564A (en) * | 2008-05-27 | 2008-11-12 | 周口市农业科学院 | Primer sequence for screening wheat brown leaf rust-resistance and use thereof |
| CN101838694A (en) * | 2010-03-16 | 2010-09-22 | 河北农业大学 | Primer sequence for screening wheat leaf rust resistance gene and application thereof |
| CN102229986A (en) * | 2011-05-24 | 2011-11-02 | 中国农业科学院作物科学研究所 | Method for assisted selection of wheat variety with stripe rust resistance and special PCR reagent used therein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103789431A (en) | 2014-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103146691B (en) | SNP loci linked with blight resistant gene Fon-1 in watermelon, and markers thereof | |
| CN103305510A (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN102220430B (en) | Auxiliary screening method for stripe rust-resistance wheat and its special primers | |
| CN104969855B (en) | Method for cultivating rice breeding material with broad spectrum and lasting spike blast resistance | |
| CN103320437A (en) | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof | |
| CN104630215A (en) | Series molecular markers closely linked with muskmelon powdery mildew resistant gene Pm-2Fand acquisition method of series molecular markers | |
| CN106566888A (en) | Method for selecting and breeding variety with diversified resistance by molecular marker-assisted selection | |
| CN102229986B (en) | Method for assisted selection of wheat variety with stripe rust resistance and special PCR reagent used therein | |
| CN106755359B (en) | Method for screening or auxiliary screening of wheat with different plant heights and special kit thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| CN103320427B (en) | Method for assisting in identifying resistance of soybeans to soybean mosaic viruses | |
| CN102586240B (en) | Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof | |
| CN103952403B (en) | The closely linked molecular marker of rice bacterial blight resistance new gene Xa39 | |
| CN103789431B (en) | Assisting sifting and cultivate the primer special of stripe rust resisting wheat new lines, reagent and test kit and selection thereof | |
| CN105961185A (en) | Method for cultivating rice blast-resisting rice variety | |
| CN106222262A (en) | Primer to and differentiate Oryza sativa L. nitrogen efficiently utilize the application in gene NRT1.1B genotype | |
| CN1858256A (en) | Method for screening stripe rust resisting wheat and its special primer | |
| CN101487056A (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN111073991B (en) | Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application | |
| CN108690883B (en) | Molecular marker RMD7 for assisting in identifying soybean powdery mildew resistance of soybean to be detected | |
| CN109234447B (en) | Method for identifying soybean cyst nematode-resistant No. 4 microspecies soybean resource and special SSR primer | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN109468330A (en) | Elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application | |
| CN101659989A (en) | Molecular markers of wheat powdery mildew resistance gene Pm2 and method for acquiring same | |
| CN110273022B (en) | Molecular marker, primer, detection method and application for detecting soybean phytophthora root rot resistance gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160106 Termination date: 20180126 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |