CN109468330A - Elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application - Google Patents
Elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application Download PDFInfo
- Publication number
- CN109468330A CN109468330A CN201811592341.7A CN201811592341A CN109468330A CN 109468330 A CN109468330 A CN 109468330A CN 201811592341 A CN201811592341 A CN 201811592341A CN 109468330 A CN109468330 A CN 109468330A
- Authority
- CN
- China
- Prior art keywords
- hor3298
- eif4e
- gene
- barley
- sed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Botany (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Mycology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
Abstract
The invention discloses elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application, the eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.DCAPS detects eIF4EHOR3298The technical method and PCR primer molecule of gene, which includes: the upstream primer containing the nucleotide sequence as shown in SED ID NO.2, and the downstream primer containing the nucleotide sequence as shown in SED ID NO.3.Resistant gene eIF4E of the inventionHOR3298, to the resistant effect of the virulent strain of barley yellow mosaic virus and Barley mild mosaic virus, antagonism gene eIF4E can be passed throughHOR3298Testing and appraisal can be used for elimination of barley's yellow mosaic resistance breeding to obtain resistant plant.DCAPS Markers for Detection eIF4E of the inventionHOR3298The technical method of gene can effectively detect resistant gene eIF4EHOR3298, realize molecular mark.
Description
Technical field
The present invention relates to a kind of elimination of barley's yellow mosaic resistant genes, and in particular to elimination of barley's yellow mosaic resistant gene
eIF4EHOR3298And its identification method and application.
Background technique
Elimination of barley's yellow mosaic is a kind of soil-borne disease virus disease, by barley yellow mosaic virus (BaYMV) or the mild floral leaf of barley
Viral (BaMMV) or both coexists complex and causes, and two kinds of viruses belong to marmor upsilon section, is Europe and East Asia etc.
One of the important disease in winter barley producing region, it is different according to occurring degree and disease time, it is averaged the underproduction in susceptible Tanaka barley
10%-50% seriously threatens In Eurasia winter barley grain-production.
In the resting spore of the more slime moulds of the cereal of BaYMV and BaMMV parasitism in the soil, due to soil tilth, wind soil
Earth particle, the moisture short distance transportation containing zoospore, virus are not completed in different plants and not with the propagation of fungal spore
It is propagated between region.Under field conditions (factors), BaYMV and BaMMV usually infects seedling root in the fall, and early spring in the coming year is planting at first
There is typical floral leaf illness in strain young leaves, leads to that yellowing leaf, plant are short and small, tiller is few, seed as scab is increasing
Yield decline, or morning is withered or does not ear solid.Due to the more slime mould resting spores of cereal in the soil can it is more than Survival for 10 Years,
In the case that external environment is suitable for, takes viruliferous resting spore sprouting and infect host plant again, thus the disease becomes one kind
For a long time, Disease Stress persistently.
Elimination of barley's yellow mosaic is the most important disease in China, barley producing region, the middle and lower reach of Yangtze River, seriously affects the barley of this area
Yield.The effect that existing chemistry and bio-control method reduce the more slime mould contents of cereal in soil is limited, cannot prevent disease
Evil occurs, and a large amount of use of pesticide also can polluted agricultural land and environment.Under field conditions (factors), part barley material is to barley's yellow leaf
Disease has hereditary disease resistance, and disease resistence gene is imported in Cultivate berley kind, disease can be effectively prevented, be current agriculture
The preventions being widely used in industry production.Since hereditary variation, new virulent strain frequently occur for virus under the conditions of natural selection
Appearance may cause current disease resistence gene failure, identify new resistant gene (or the resistant variant that known is new
Type) therefore there is important Breeding value.
At present it is known that elimination of barley's yellow mosaic resistance locus totally 18, only 2 gene PDIL5-1 and eIF4E are by figure position
Clone.Genetics of resistance site rym4 (rym, Resistance to yellow mosaic disease, anti yellow flower leaf disease),
Rym5 and rym6 is allele, by eukaryotic translation initiation factor (eukaryotic translation initiation
Factor4E) eIF4E series jump causes, and the eIF4E gene coded sequence in disease-resistant material is different from susceptible material, to lead
Encoding amino acid sequence is caused to change；Genetics of resistance site rym1 and rym11 is allele (rym is recessive gene), by albumen
Matter disulfide isomerase gene (Protein Disulfide Isomerase Like) PDIL5-1 function loss causes.rym4/
Rym5, rym1/11 are main Resistance resources to be used in barley production.
Currently, being directed to occur in middle and lower reach of Yangtze River some areas of Germany, French, Japan and other countries and China
Pathological form virulent strain (such as European virulence dissociation strain BaYMV-II, BaMMV-SIL of rym4, rym5, rym6 and rym1/11
And BaMMV-Teil, Japanese virulence dissociation strain BaYMV-III, virulence dissociation the strain BaYMV-C and BaMMV-C in China), it is meant that
It is impossible to meet breeding uses for existing Resistance resource, it is necessary to excavate new resistant gene and matched Marker-assisted selection side
Method.
Summary of the invention
The object of the present invention is to provide elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application, solution
There is the problem of pathological form virulent strain in determined carrying elimination of barley's yellow mosaic resistance locus rym4/rym5 and rym1/11, carries anti-
Property gene eIF4EHOR3298Barley material respectively multiple sick nursery fields (sick nursery carry pathological form virulent strain can infect
Rym4/rym5 and rym1/11) in show complete resistance to barley yellow mosaic virus and barley warm nature mosaic virus, can use
In elimination of barley's yellow mosaic resistance breeding.
In order to achieve the above object, the present invention provides elimination of barley's yellow mosaic resistant gene eIF4EHOR3298, should
eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.
The present invention also provides a kind of barley for carrying anti-elimination of barley's yellow mosaic gene, which contains elimination of barley's yellow mosaic
Resistant gene eIF4EHOR3298, the eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.
The present invention also provides a kind of elimination of barley's yellow mosaic resistant gene eIF4EHOR3298Identification method, this method packet
Contain:
(1) eIF4E will be carriedHOR3298The barley of gene is big with carrying PDIL5-1 gene resistant variant's gene rym1/11's
Wheat is hybridized as parent material, obtains F1For genetic stocks, by F1It is selfed for genetic stocks and obtains F2In generation, separates hereditary group
Body；
(2) by F2Generation and parent material are seeded in the sick soil containing BaYMV/BaMMV virus at random and cultivate, long to plant
Greatly, phenotype investigation is carried out, is judged disease-resistant or susceptible；
(3) total serum IgE of plant, reverse transcription, using PDIL5-1 gene resistant variant's base in PCR detection plant DNA are extracted
Because of rym1/11, genetic analysis is carried out to the plant for not carrying rym1/11 and sequence is analyzed, to obtain eIF4EHOR3298Base
Cause detects eIF4E using dCAPS molecular marking techniqueHOR3298Gene.
Wherein, the eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.
Wherein, the primer molecule of the dCAPS molecular marking technique includes: such as SED ID NO.2 and SED ID NO.3 institute
The nucleotide sequence shown.
Preferably, in step (2), the breeding condition are as follows: 12 DEG C of illumination and 8 DEG C of dark alternatings.
Preferably, in step (3), the total serum IgE is extracted using RNAzol reagent and is obtained.
Preferably, in step (3), the reverse transcription uses RT KitWith gDNAEraser.
Preferably, in step (3), the hereditary variation of the rym1/11 is detected using PCR, reaction system are as follows: volume
CDNAtemplate, 10x than 10:10:2:2:2:1:73 contain Mg2+TaqBuffer, dNTP mix, upstream primer PDI_45_
743_f, downstream primer PDI_45_743_r, 5U/ μ L Taq DNApolymerase, ddH2O；Wherein, the upstream primer
PDI_45_743_f includes: the nucleotide sequence as shown in SED ID NO.4, the downstream primer PDI_45_743_r includes:
The nucleotide sequence as shown in SED ID NO.5.
Preferably, in step (3), the eIF4EHOR3298The reaction that gene dCAPS Markers for Detection uses is divided into
Two steps:
First step reaction is to carry out PCR amplification to eIF4E gene, the reaction system of use are as follows: volume ratio 10:10:2:2:
DNAtemplate, 10x of 2:1:73 contains Mg2+TaqBuffer, dNTP mix, upstream primer dCAPS_HOR3298_f2, under
Swim primer dCAPS_HOR3298_r, 5U/ μ L Taq DNApolymerase, ddH2O；Wherein, the upstream primer dCAPS_
HOR3298_f2Include: the nucleotide sequence as shown in SED ID NO.2, the downstream primer dCAPS_HOR3298_r includes:
The nucleotide sequence as shown in SED ID NO.3；
Second step reaction is to eIF4EHOR3298Gene digestion, the reaction system of use are as follows: volume ratio 1000:200:5:
Restriction enzyme EcoRI, ddH of 795 PCR product, the FlyCut Buffer of 10x, 20U/ μ L2O。
The present invention also provides a kind of dCAPS Markers for Detection eIF4EHOR3298The kit of gene, the kit packet
Contain: the upstream primer and contain as shown in SED ID NO.3 that primer molecule contains the nucleotide sequence as shown in SED ID NO.2
Nucleotide sequence downstream primer.
Elimination of barley's yellow mosaic resistant gene eIF4E of the inventionHOR3298And its identification method and application, have following excellent
Point:
Resistant gene eIF4E of the inventionHOR3298, to the pathogenic of barley yellow mosaic virus and Barley mild mosaic virus
The resistant effect of virulent strain, can be used for elimination of barley's yellow mosaic resistance breeding.The present invention provides dCAPS Markers for Detection
Method, this method can effectively detect resistant gene eIF4EHOR3298, for selecting disease resistant plant during Barley Breeding.
Detailed description of the invention
Fig. 1 is the quality testing electrophoretogram of the barley total serum IgE of the embodiment of the present invention 1.
Fig. 2 is the embodiment of the present invention 3 in F2The testing result electrophoretogram of PDIL5-1 genotype is detected in group.
Fig. 3 is the eIF4E of the embodiment of the present invention 3HOR3298(Maker in figure is 50bp to the digestion result electrophoretogram of gene
DNAladder)。
Specific embodiment
The technical scheme in the embodiments of the invention will be clearly and completely described below, it is clear that described implementation
Example is only a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is common
Technical staff's every other embodiment obtained without making creative work belongs to the model that the present invention protects
It encloses.
1 elimination of barley's yellow mosaic resistant gene eIF4E of embodimentHOR3298Genes location
Barley genetic stocks HOR3298 is the barley local varieties from Iran, and W757/612 is the barley from Germany
Breeding material (carries rym1/11 resistant gene, resistance is lost from the function of PDIL5-1 gene).
(1) hybridized using HOR3298 with W757/612, obtain F1For genetic stocks, F is constructed by bagging selfing2Generation point
From genetic group；
(2) by F2Generation and parent material are seeded at random in the sick soil containing BaYMV/BaMMV virus, are cultivated and are trained in illumination
It supports in case (12 DEG C, daytime/8 DEG C 10h, 14h night), after germination, institutes an inquiry it after about waiting plant long to 4 months
Phenotype simultaneously samples for use, and phenotype investigation will carry out in three times, and every minor tick one week judges disease-resistant or susceptible；
(3) plant leaf to be detected of clip passes through RNAzol reagent (the limited public affairs of Beijing Jin Baite biotechnology
Department, article No. R011-100) total serum IgE is extracted, the RNA concentration that Nanodrop fluorescent spectrophotometer assay extracts utilizes 1% (w/
V) Ago-Gel carries out electrophoresis and runs glue Detection and Extraction quality, and experimental result is as shown in Figure 1, for the big of the embodiment of the present invention 1
The quality testing electrophoretogram of wheat total serum IgE.Using RT KitWith gDNAEraser kit, (Beijing Jin Baite biotechnology has
Limit company；P514-100 RNA) is inverted, which is that a tubular type reverse transcription premixes Mix, comprising: 4x gDNA EraserMix,
5x RT MasterMix、RNAase Free H2O will be inverted and be saved after successful cDNA dilutes 5 times to -20 DEG C for use.
(4) Markers for Detection F2 group PDIL5-1 genotype, the method for reference implementation example 3, in F2It is selected not in group
The plant for carrying rym1/11 mixes the RNA of 16 susceptible samples and 16 disease-resistant samples according to phenotype investigation result respectively
Cheng Chi, each sample press 2 μ g/ μ L mixed in equal amounts of concentration, carry out mixed pond transcript profile sequencing (Bulked segregant RNA-
Seq, BSR-seq) and bioinformatic analysis, it should be as a result, it was confirmed that containing only a resistance position in barley variety HOR3298
Point is positioned at the long-armed end chromosome 3H.
(5) F that barley variety HOR3298 hybridizes with barley variety Franka (carrying rym4 resistant gene)1It is alternative
In Allelism test.Hybridization is obtained into F1It is seeded in seedlings nursing plate for group and parent material, is put into illumination box and sends out seedling
(24 DEG C, daytime/18 DEG C 14h, 10h night), it is long to be inoculated with barley yellow mosaic virus to two leaves, one heart stage mechanical friction, find F1Generation
Plant all shows anti-elimination of barley's yellow mosaic.Illustrate that the resistant gene that barley variety HOR3298 is carried belongs to equipotential pass with rym4
System, it was demonstrated that the resistance of HOR3298 is provided by eIF4E gene.
EIF4E gene resurveys sequence in 2 barley variety HOR3298 of embodiment
To eIF4E full length gene coding region in barley variety HOR3298, i.e. the nucleic acid piece of 648bp (SED ID NO.1)
Section is sequenced by PCR amplification and a generation, identifies the nucleotide sequence variation of eIF4E gene, and such as the following table 1 is the embodiment of the present invention
The reaction system table of 2 barley variety HOR3298 progress PCR amplification.
Table 1 is the reaction system table that 2 barley variety HOR3298 of the embodiment of the present invention carries out PCR amplification
Upstream primer eIF4E-54s includes: the nucleotide sequence as shown in SED ID NO.6
(GCCCGTCCGTCSTAGAAAAG), the downstream primer eIF4E-849as includes: the nucleotide as shown in SED ID NO.7
Sequence (GAAACAGCATCCACCCGCTA).
Table 2 is the program list that 2 barley variety HOR3298 of the embodiment of the present invention carries out PCR reaction
By sequencing result using Sequencher5.4.6 software carry out sequence analysis, compare barley variety HOR3298 and
The sequence difference between other variation types that eIF4E gene has been delivered finds eIF4EHOR3298With delivered sequence not phase
Together, such as the following table 3, the eIF4E base of the eIF4E gene and other variation types delivered that are barley variety HOR3298 of the present invention
Sequence difference table because between, shows that the resistant gene of HOR3298 is the another novel variant haplotype of eIF4E.
The eIF4E base of eIF4E gene and other variation types delivered that table 3 is barley variety HOR3298 of the present invention
Sequence difference table because between
Note: 1. refer to PingYangetal., Theoretical&AppliedGenetics (2017), 130 (2): 331-
344；2,3: referring to Nils Stein etal., ThePlantJournal (2005), 42 (6): 912-922；4,5: reference
Dragan Perovic etal.,Theoretical&Applied Genetics(2014),127(5):1061-1071。
3 Markers for Detection F of embodiment2Group's PDIL5-1 genotype
Using molecular labeling (Yang et al.2014, the Theoretical and Applied delivered
Genetics, 127:1625-1634) it selects to lose variation, the i.e. F of resistant gene rym1/11 without PDIL5-1 gene function2
Plant, such as the following table 4 detect the PCR reaction system table of resistant gene rym1/11 for the embodiment of the present invention 2.
Table 4 is the PCR reaction system table that the embodiment of the present invention 2 detects resistant gene rym1/11
Experimental material: EasyTaq DNApolymerase (article No. AP111) and 10x EasyTaq Buffer (+Mg2+)
(article No. GK101-01), purchase is in Beijing Quanshijin Biotechnology Co., Ltd；DNTP mixture solution (article No.
B500056-0500), purchase is in Sangon Biotech (Shanghai) Co., Ltd..
Upstream primer PDI_45_743_f includes: the nucleotide sequence as shown in SED ID NO.4, the downstream primer
PDI_45_743_r includes: the nucleotide sequence as shown in SED ID NO.5.
Table 5 is the PCR response procedures table that the embodiment of the present invention 2 detects resistant gene rym1/11
Electrophoresis is carried out with the Ago-Gel of 1% (w/v) and runs glue, and 2 μ L loading dye are added in 10 μ L amplified productions
(6x) loading, using ' 5000+DNA ladder ' (Beijing Bo Maide gene technology Co., Ltd) as clip size indicate,
180V electrophoresis 30min, experimental result is as shown in Fig. 2, be the embodiment of the present invention 2 in F2PDIL5-1 gene is detected in group
The testing result figure of type has in Fig. 2 band to lack, that is, illustrates that a certain fragment sequence of plant PDIL5-1 gene delection leads to this
Gene function lose, the plant be on the site PDIL5-1 it is disease-resistant, on the contrary it is then be it is susceptible.
Embodiment 4 detects eIF4E using molecular labeling dCAPS_HOR3298HOR3298Gene
Based on eIF4EHOR3298Specific single nucleotide polymorphism on 565bp develops dCAPS molecular labeling, uses
Upstream primer dCAPS_HOR3298_f2With downstream primer dCAPS_HOR3298_r, upstream primer dCAPS_HOR3298_f2Packet
Contain: the nucleotide sequence as shown in SED ID NO.2, downstream primer dCAPS_HOR3298_r includes: such as SED ID NO.3 institute
The nucleotide sequence shown, specific amplification obtain the 224bp segment across the 3rd introne and the 4th exon of eIF4E gene.
It is reacted by digestion with restriction enzyme, eIF4E is cut using FlycutEcoRIHOR329833bp segment.
Table 6 is that the embodiment of the present invention 4 detects eIF4EHOR3298PCR reaction system table
Table 7 is that the embodiment of the present invention 4 detects eIF4EHOR3298PCR response procedures table
Above-mentioned PCR product is subjected to digestion, 37 DEG C of incubation 1.5h in PCR instrument, abundant digestion obtains digestion products.
Table 8 is the embodiment of the present invention 4 to eIF4EHOR3298PCR product digestion reaction system table
Experimental material: FlyCutEcoRI (article No. JE201-01) and 10x FlyCut Buffer are bought in the full formula in Beijing
Golden Bioisystech Co., Ltd.
Using the Ago-Gel of 3% (w/v), (note: the clip size difference of digestion products is only 30bp, needs high concentration
Gel could effective district divide Fragment Differential), 20 μ L digestion products be added 3 μ L loading dye loading, using ' 50bp
DNAladder ' (Beijing Bo Maide gene technology Co., Ltd) as clip size indicate, 180V electrophoresis 30-35min,
As shown in figure 3, being the eIF4E of the embodiment of the present invention 3HOR3298The restriction enzyme digestion and electrophoresis result figure of gene, the amplified band that PCR is obtained,
The PCR product that i.e. clip size is 224bp is contained using restriction enzyme FlycutEcoRI progress endonuclease reaction
eIF4EHOR3298The PCR product of gene is cut off the segment of 34bp, as 190bp, it can be seen from the figure that occurring being less than
The band (sample HOR3298) of 224bp；Without eIF4EHOR3298The segment of gene will not be digested, as 224bp (sample
W757/612, sample HTX come from place of china kind)；Occur two segment (samples of 224bp and 190bp under heterozygous state simultaneously
HOR3298+W757/612 and sample HOR3298+HTX), it should be as a result, it was confirmed that can have using dCAPS_HOR3298 molecular labeling
The homozygous eIF4E under heterozygous state of effect identificationHOR3298Gene.
5 molecular labeling dCAPS_HOR3298 detection kit of embodiment
Molecular labeling dCAPS_HOR3298 detects resistant gene eIF4EHOR3298Kit (50 times), the Kit components
(such as table 1) includes: two dCAPS primers (upstream primer and downstream primer), positive control (eIF4EHOR3298Plasmid DNA),
Taq DNApolymerase, Taqbuffer, dNTP mix, FlyCutEcoRI, 10x FlyCutBuffer and ddH2O。
The component list of the molecular labeling dCAPS_HOR3298 detection kit of the present invention of table 9
Detection process is referring to embodiment 4, as a result as shown in Figure 3.
It is discussed in detail although the contents of the present invention have passed through above preferred embodiment, but it should be appreciated that above-mentioned
Description is not considered as limitation of the present invention.After those skilled in the art have read above content, for of the invention
A variety of modifications and substitutions all will be apparent.Therefore, protection scope of the present invention should be limited to the appended claims.
Sequence table
<110>Yang Ping
Shi Lijie
Jiang's fir jadelike stone
Kan Jinhong
<120>elimination of barley's yellow mosaic resistant gene eIF4EHOR3298 and its identification method and application
<141> 2018-10-23
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 648
<212> DNA
<213> Artificial Sequence
<400> 1
atggcggagg acacggagac gaggcccgcg tcggcgggcg cggaggagag ggaggagggg 60
gagatcgcgg acgacggaga cgggtccgcg gcggcggcgg ccgggcgcgt cagcgcccac 120
cctctggaga acgcctggac cttctggttc gacaacccgc agggcaagtt ccgggcggtg 180
gcctggggga gcaccatcca ccccatccac accttctcca ccgtcgagga cttctggagc 240
ctttacaaca atattcatca ccctagcaag ttgaatgttg gagccgactt ccattgcttc 300
aaggataaga ttgagccaaa atgggaagac cccatttgtg ccaatggcgg tatatggacc 360
atcagttgtg gcaaagggaa atctgacaca ttttggttgc atactttgct ggcattgatt 420
ggtgaacaat tcgactttgg tgatgaaatt tgcggagcag tcgtcagcgt gcgtaagaac 480
caggaaagag tagctatctg gactaaaaat gctgccaatg aaactgctca gataagcatc 540
ggtaagcagt ggaaggagtt tctggactac aaggactcca ttggattcgt cgttcatgag 600
gatgctaaga ggtccggcaa agccgccaag aaccgctaca cggtttga 648
<210> 2
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 2
ctttggtgat gaaatttgcg gagcagtcgt cagcgtg 37
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence
<400> 3
tcacatgaac gacgaatcca atggagtcct tggaat 36
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 4
gtatccgcct tctcctcgtc 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 5
cggtcaaaac tcgcattgta 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
gcccgtccgt cstagaaaag 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 7
gaaacagcat ccacccgcta 20
Claims (9)
1. elimination of barley's yellow mosaic resistant gene eIF4EHOR3298, which is characterized in that the eIF4EHOR3298Include such as SED ID NO.1
Shown in nucleotide sequence.
2. a kind of barley for carrying anti-elimination of barley's yellow mosaic gene, which is characterized in that the barley contains elimination of barley's yellow mosaic resistance
Gene eIF4EHOR3298, the eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.
3. a kind of elimination of barley's yellow mosaic resistant gene eIF4EHOR3298Identification method, which is characterized in that this method includes:
(1) eIF4E will be carriedHOR3298The barley of gene and the barley for carrying PDIL5-1 gene resistant variant's gene rym1/11 make
Hybridized for parent material, obtains F1For genetic stocks, by F1It is selfed for genetic stocks and obtains F2Generation separation genetic group；
(2) by F2Generation and parent material are seeded in the sick soil containing BaYMV/BaMMV virus at random and cultivate, and grow up to plant, into
The investigation of row phenotype, judges disease-resistant or susceptible；
(3) total serum IgE of plant, reverse transcription, using PDIL5-1 gene resistant variant's gene in PCR detection plant DNA are extracted
Rym1/11 carries out genetic analysis to the plant for not carrying rym1/11 and sequence is analyzed, to obtain eIF4EHOR3298Gene,
EIF4E is detected using dCAPS molecular marking techniqueHOR3298Gene；
Wherein, the eIF4EHOR3298Include the nucleotide sequence as shown in SED ID NO.1.
Wherein, the primer molecule of the dCAPS molecular marking technique includes: as shown in SED ID NO.2 and SED ID NO.3
Nucleotide sequence.
4. elimination of barley's yellow mosaic resistant gene eIF4E according to claim 3HOR3298Identification method, which is characterized in that
In step (2), the breeding condition are as follows: 12 DEG C of illumination and 8 DEG C of dark alternatings.
5. elimination of barley's yellow mosaic resistant gene eIF4E according to claim 3HOR3298Identification method, which is characterized in that
In step (3), the total serum IgE is extracted using RNAzol reagent and is obtained.
6. elimination of barley's yellow mosaic resistant gene eIF4E according to claim 3HOR3298Identification method, which is characterized in that
In step (3), the reverse transcription uses RT KitWith gDNAEraser.
7. elimination of barley's yellow mosaic resistant gene eIF4E according to claim 3HOR3298Identification method, which is characterized in that
In step (3), the hereditary variation of the rym1/11 is detected using PCR, reaction system are as follows: volume ratio 10:10:2:2:2:
CDNAtemplate, 10x of 1:73 contains Mg2+Taq Buffer, dNTP mix, upstream primer PDI_45_743_f, downstream draw
Object PDI_45_743_r, 5U/ μ LTaq DNApolymerase, ddH2O；Wherein, the upstream primer PDI_45_743_f packet
Contain: the nucleotide sequence as shown in SED ID NO.4, the downstream primer PDI_45_743_r includes: such as SED ID NO.5 institute
The nucleotide sequence shown.
8. elimination of barley's yellow mosaic resistant gene eIF4E according to claim 3HOR3298Identification method, which is characterized in that
In step (3), the eIF4EHOR3298The reaction that gene dCAPS Markers for Detection uses is divided into two steps:
First step reaction is to carry out PCR amplification to eIF4E gene, the reaction system of use are as follows: volume ratio 10:10:2:2:2:1:
73 DNAtemplate, 10x contains Mg2+Taq Buffer, dNTP mix, upstream primer dCAPS_HOR3298_f2, downstream draws
Object dCAPS_HOR3298_r, 5U/ μ L Taq DNA polymerase, ddH2O；Wherein, the upstream primer dCAPS_
HOR3298_f2Include: the nucleotide sequence as shown in SED ID NO.2, the downstream primer dCAPS_HOR3298_r includes:
The nucleotide sequence as shown in SED ID NO.3；
Second step reaction is to eIF4EHOR3298Gene digestion, the reaction system of use are as follows: volume ratio 1000:200:5:795's
Restriction enzyme EcoRI, ddH of PCR product, the FlyCut Buffer of 10x, 20U/ μ L2O。
9. a kind of dCAPS Markers for Detection eIF4EHOR3298The kit of gene, which is characterized in that the kit includes: primer
The upstream primer and contain the nucleosides as shown in SED ID NO.3 that molecule contains the nucleotide sequence as shown in SED ID NO.2
The downstream primer of acid sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811592341.7A CN109468330B (en) | 2018-12-25 | 2018-12-25 | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811592341.7A CN109468330B (en) | 2018-12-25 | 2018-12-25 | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109468330A true CN109468330A (en) | 2019-03-15 |
| CN109468330B CN109468330B (en) | 2021-06-08 |
Family
ID=65677452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811592341.7A Active CN109468330B (en) | 2018-12-25 | 2018-12-25 | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109468330B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111034557A (en) * | 2019-12-19 | 2020-04-21 | 扬州大学 | Seedling for indoor inoculation of barley yellow mosaic disease and culture method of seedling after inoculation |
| CN114292852A (en) * | 2022-01-21 | 2022-04-08 | 中国农业科学院作物科学研究所 | Marking composition created by wheat yellow mosaic disease resistant material |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010048398A2 (en) * | 2008-10-22 | 2010-04-29 | Cornell University | Mutated eif4e sequences from potato which are useful in imparting virus resistance |
| WO2011161466A1 (en) * | 2010-06-25 | 2011-12-29 | The University Of Warwick | Plant eukaryotic translation initiation factor 4e |
-
2018
- 2018-12-25 CN CN201811592341.7A patent/CN109468330B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010048398A2 (en) * | 2008-10-22 | 2010-04-29 | Cornell University | Mutated eif4e sequences from potato which are useful in imparting virus resistance |
| WO2011161466A1 (en) * | 2010-06-25 | 2011-12-29 | The University Of Warwick | Plant eukaryotic translation initiation factor 4e |
Non-Patent Citations (3)
| Title |
|---|
| HOFINGER B.J. ET AL: "FN646088.1,Hordeum vulgare subsp. Vulgare partial mRNA for eukaryotic translation initiation factor 4E(eIF4E gene),cultivar Aizu 6", 《NCBI GENBANK》 * |
| PEROVIC D. ET AL: "Genetic analyses of BaMMV/BaYMV resistance in barley accession HOR4224 result in the identification of an allele of the translation initiation factor 4e (Hv‑eIF4E) exclusively effective against Barley mild mosaic virus (BaMMV)", 《THEOR APPL GENET》 * |
| TIBOR S. ET AL: "Development of CAPS Marker for Identification of rym4 and rym5 Alleles Conferring Resistance to the Barley Yellow Mosaic Virus Complex in Barley", 《CZECH JOURNAL OF GENETICS AND PLANT BREEDING》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111034557A (en) * | 2019-12-19 | 2020-04-21 | 扬州大学 | Seedling for indoor inoculation of barley yellow mosaic disease and culture method of seedling after inoculation |
| CN111034557B (en) * | 2019-12-19 | 2022-04-19 | 扬州大学 | Seedling for indoor inoculation of barley yellow mosaic disease and culture method of seedling after inoculation |
| CN114292852A (en) * | 2022-01-21 | 2022-04-08 | 中国农业科学院作物科学研究所 | Marking composition created by wheat yellow mosaic disease resistant material |
| CN114292852B (en) * | 2022-01-21 | 2022-11-01 | 中国农业科学院作物科学研究所 | Marking composition created by wheat yellow mosaic disease resistant material |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109468330B (en) | 2021-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maliepaard et al. | Aligning male and female linkage maps of apple (Malus pumila Mill.) using multi-allelic markers | |
| EP3789506B1 (en) | Prunus mume pendulous trait snp molecular markers and use thereof | |
| CN105950736B (en) | Molecular marker co-separated from bruchid-resistant gene VrPGIP of mung bean and application thereof | |
| CN111763755B (en) | SNP molecular marker of rice cadmium absorption related gene OsNRAMP5 and application thereof | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| CN102154282B (en) | Molecular marker SIsv0151 closely interlocked with gene associated with leaf color of millet | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| CN105219858B (en) | Grain Weight in Common Wheat gene TaGS5 3A single nucleotide polymorphisms and its application | |
| CN114427007A (en) | KASP molecular marker related to bitter gourd whole female and application thereof | |
| CA2656777C (en) | Resistance to powdery mildew and absence of necrosis in cucumis sativus | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| CN109468330A (en) | Elimination of barley's yellow mosaic resistant gene eIF4EHOR3298And its identification method and application | |
| Sharma et al. | Assessment of genetic diversity among sugarcane cultivars using novel microsatellite markers | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| Kimura et al. | Development of SSR markers in carnation (Dianthus caryophyllus) | |
| Wang et al. | Development of molecular markers linked to Cladosporium fulvum resistant gene Cf-6 in tomato by RAPD and SSR methods | |
| Y Amin et al. | QTL mapping of wheat (Triticum aestivum L.) in response to salt stress | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| KR101803077B1 (en) | Primer set and method for selection fusarium wilt resistant in cabbage | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| WO1999053100A2 (en) | Method for finding genetic markers of somaclonal variation | |
| AU2014318042A1 (en) | Molecular markers for blackleg resistance gene Rlm4 in Brassica napus and methods of using the same | |
| CN117363785B (en) | Method for screening or assisting in screening wheat with different grain lengths and special primer group thereof | |
| JP4575613B2 (en) | DNA marker linked to aluminum resistance factor and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |