CN113903397B - Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof - Google Patents
Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof Download PDFInfo
- Publication number
- CN113903397B CN113903397B CN202110971011.4A CN202110971011A CN113903397B CN 113903397 B CN113903397 B CN 113903397B CN 202110971011 A CN202110971011 A CN 202110971011A CN 113903397 B CN113903397 B CN 113903397B
- Authority
- CN
- China
- Prior art keywords
- pib
- functional
- disease
- resistant
- haplotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
- G16B30/10—Sequence alignment; Homology search
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/10—Ploidy or copy number detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B20/00—ICT specially adapted for functional genomics or proteomics, e.g. genotype-phenotype associations
- G16B20/20—Allele or variant detection, e.g. single nucleotide polymorphism [SNP] detection
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
- G16B25/20—Polymerase chain reaction [PCR]; Primer or probe design; Probe optimisation
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B40/00—ICT specially adapted for biostatistics; ICT specially adapted for bioinformatics-related machine learning or data mining, e.g. knowledge discovery or pattern finding
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics
- G16B50/10—Ontologies; Annotations
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Medical Informatics (AREA)
- Analytical Chemistry (AREA)
- Theoretical Computer Science (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Evolutionary Biology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Databases & Information Systems (AREA)
- Bioethics (AREA)
- Microbiology (AREA)
- Computer Vision & Pattern Recognition (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Artificial Intelligence (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Data Mining & Analysis (AREA)
- Botany (AREA)
- Epidemiology (AREA)
- Evolutionary Computation (AREA)
- Public Health (AREA)
- Software Systems (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof. The technical system sets a secondary detection marker according to the secondary differentiation of the gene family, such as clear functional haplotype-disease-resistant allele, and the like. The technical system can be used for identifying and excavating rice blast Pib disease-resistant allele family functional genes and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion property and application thereof.
Background
Rice is one of the most important food crops in the world, and rice blast caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious obstacles to rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance relies on direct identification of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, and identification results are easy to cause errors. In particular, the direct selection of phenotypes by gene interaction between disease-resistant genes is very inefficient or impossible due to overlapping of resistance spectra and coverage. With the development of molecular marker identification technology, the application value and the prospect of the technology are more and more concerned due to the advantages of accuracy, reliability, no environmental influence and the like. In plant breeding, by developing molecular markers closely linked with target genes, particularly developing functional specific molecular markers in genes, the reliability of selection of the target genes is high, and the purposiveness and efficiency of breeding work are greatly accelerated.
Generally, in the course of 'arms race' in which the disease-resistant genes of host plants and avirulence genes of pathogenic bacteria are long, the disease-resistant genes generate new disease-resistant specificities in the form of 'multiple-allele families' or 'gene clusters' with the lowest evolution cost, so that the rapid variation of avirulence genes can be followed. That is, under long-term and strong selection pressure of pathogenic bacteria, the above-mentioned 'gene family' generally causes functional/non-functional haplotype (haplotype) differentiation; if it is a broad-spectrum persistent resistance 'gene family' used for a long time in breeding programs, it will further differentiate into alleles (functional alleles) with different disease resistance specificities in functional haplotypes (Zhai et al 2011, New Phytolist 189: 321-.
There are obvious and clear nucleotide polymorphisms including Single Nucleotide Polymorphisms (SNPs) and polynucleotide polymorphisms (differentiated genomic regions) and insertions/deletions (insertions/deletions) in the secondary evolutionary processes of the above-mentioned "functional haplotype-disease resistance alleles". Herein, nucleotide polymorphisms within functional genes are collectively referred to as functional nucleotide polymorphisms. Therefore, on one hand, the disease-resistant genes identified by different resistant varieties are often gathered in the same gene family, and on the other hand, the broad-spectrum durable resistant varieties usually have functional disease-resistant genes in a plurality of gene families simultaneously. Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene families such as rice chromosome 1(Pi37 family), 2(Pib family), 6(Pi2/Pi9 family), 8(Pi36 family), 9(Pii family), 11(Pik family) and 12(Pita family) (Sharma et al 2012, Agricultural Research,1: 37-52; Liu and Wang 2016, National Science Review,3: 295-.
As described above, The Pib gene family located in The telomeric region of chromosome 2 is one of The most widely used broad-spectrum persistent resistance sources in The global rice breeding program for disease resistance (Wang et al 1999, The Plant Journal,19: 55-64; Zhang et al 2015, Scientific Reports,5: 111642; Liu and Wang 2016, National Science Review,3: 295-. In order to apply the broad-spectrum persistent antigen gene to rice disease-resistant breeding programs, researchers developed a series of molecular markers [Pibdom(Fjellstrom et al.2004,Crop Science,44:1790-1798)；b2,b28,b213,b3989(Hayashi et al.2006, Theoretical and Applied Genetics,113:251-260)；Pibdom,Lys145(Liuyang et al, 2008, China agriculture)Science, 41: 9-14);Pibdom,Lys145(Houke et al, 2009, proceedings of plant genetic resources, 10: 21-26);Pibdom(Yangjie et al, 2011, North China agricultural bulletin, 26: 1-6);Pibdom(Dairy et al, 2012, Life sciences research, 16: 340-.
Since The Pib gene family is an important resistance source which is widely used in rice breeding programs for a long time in The rice breeding program for rice breeding in The north and south after The Pik disease resistance allele family (Wang et al 1999, The Plant Journal,19: 55-64; Zhang et al 2015, Scientific Reports,5:111642), under The continuous and strong selective pressure of rice blast germs, complex and diverse variations are generated in The secondary evolutionary level of functional haplotype-disease resistance allele. However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the 2-component molecular marker reported above: (Pibdom,Lys145；b2,b28,b213,b3989) Are developed aiming at specific sites of specific genes, have no clear comparability and logicality, and have no compatibility. And only 2 markers: (Pibdom,Lys145) Is widely used. For complex genomic regions, complex gene families, this gives rise to 3 prominent and realistic problems: (1) any molecular marker which is not designed based on the evolution hierarchy is difficult to identify in a complex genome region, a complex gene family is easy to generate sequencing errors and the like; (2) any molecular marker which is not designed based on the evolution hierarchy is difficult to avoid the problem of false positive of the marker due to the technical limitation of the molecular marker (the same specific fragment/locus does not represent that the test variety contains the gene completely consistent with the target gene); (3) any molecular marker which is not designed based on the evolution hierarchy is difficult to form a technical system with compatibility and comparability, so that new genes are continuously mined, identified and named in a complex gene family, and the problems of 'homonymous heterogeneous genes' and 'true and false target genes' which are easily generated in the complex gene family are identified.
Disclosure of Invention
The inventionAiming at overcoming the defects in the prior art, the method provides a set of technical system which has the advantages of inclusion and accurate identification and excavation of the functional genes of the rice blast Pib disease-resistant gene family. The technical system sets a secondary detection marker according to the clear secondary differentiation of functional haplotype-disease-resistant allele and the like of the gene family; the optimal haplotype specific molecular marker combination for functional haplotype/non-functional haplotype detection is Pib-F/N P/A(1451～1600) And Pib-F/N P /A(2070～2242) (ii) a The optimal target gene specific molecular marker for disease-resistant allele Pib-BL detection of functional haplotype is Pib-BL A5817T (ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pib-ZS of functional haplotype is Pib-ZS T4098C (ii) a The optimal target gene specific molecular marker for detecting disease-resistant allele Pib-MH of functional haplotype is Pib-MH C2856T (ii) a The identification result of any detection marker which is not qualified by the technical system is not the corresponding target gene, so that the detection marker is inferred to be a possible new allele of the gene family.
The second purpose of the invention is to provide a method for comparing the sequences of the pestis rice Pib disease-resistant gene family and identifying the specific sequences thereof.
The third objective of the invention is to provide a functional/non-functional haplotype specific molecular marker of the rice blast Pib disease-resistant gene family and an identification method thereof.
The fourth purpose of the invention is to provide a specific molecular marker of the disease-resistant allele Pib-BL of the functional haplotype of the rice blast Pib disease-resistant gene family and an identification method thereof.
The fifth purpose of the invention is to provide a specific molecular marker of the disease-resistant allele Pib-ZS of the functional haplotype of the rice blast Pib disease-resistant gene family and an identification method thereof.
The sixth object of the present invention is to provide a specific molecular marker for the disease-resistant allele Pib-MH of the functional haplotype of the above rice blast Pib disease-resistant gene family and a method for identifying the same.
The seventh purpose of the invention is to provide the application and the example of identifying and mining the novel disease-resistant allele Pib-CO from the reference variety with incomplete sequencing by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of the rice blast Pib disease-resistant gene family allele.
The eighth purpose of the invention is to provide an application and an example for screening true and false genome differentiation regions, SNP and true and false target genes from a rice blast Pib disease-resistant gene family by using the set of inclusive and accurate identification and mining technology system for alleles of the gene family.
The ninth purpose of the invention is to provide the application and the example of identifying and mining the new and old disease-resistant alleles from Guangdong province rice seed resource groups with unknown target genes by utilizing the set of inclusive and accurate rice blast Pib disease-resistant gene family allele identification and mining technology system.
The tenth purpose of the invention is to provide application and an example for identifying and mining new and old disease-resistant alleles from Guangxi autonomous region rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pib disease-resistant gene family alleles.
The eleventh purpose of the invention is to provide an example of comparing the identification capability of the technical system which is used for identifying and mining the rice blast Pib disease-resistant gene family allele by utilizing one set of the invention and other marking technologies.
The technical solution of the present invention for achieving the above object is as described in the claims and the detailed description.
The scheme of the invention has the following beneficial effects:
the technical system provided by the invention can be used for identifying and excavating rice blast Pib disease-resistant allele family functional genes, and has systematic and strict inclusion and comparability. Can be widely applied to improving the purpose and the efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and the efficiency of the breeding work for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Drawings
FIG. 1 is a set of schematic diagrams for development and application of a technical system for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision.
FIG. 2 sequence comparison of the Pib disease resistance gene family and identification of its specific sequence. Wherein the content of the first and second substances,
the cloned Pib-BL (donor variety TohokuIL-9 is an isogenic line, identical to the target gene of the commonly used donor variety BL 1; Wang et al 1999) has the gene accession number: AB 013448.1; to facilitate sequence alignment analysis, 6 sequencing reference varieties IR8, IR64, Zhenshan 97(Zhenshan 97, ZS), Minghui 63(Minghui 63, MH), Shuhui 498(Shuhui 498), and shennong 265(SN) presumed to be carriers of the target gene were added; and 4 genome sequences corresponding to the reference species Nipponbare (NPB), Suijing 18 (SJ 18), Hitomebore (HTM), Tetep (Tetep) which are presumed to be non-target gene carriers;
wherein, the existence of double copies of Minghui 63 and Shuhui 498 is consistent with the previous report (Wang et al 1999), in the case, the double copies of the gene are compared and detected together);
all validated haplotypes and allele-specific genomic differentiation regions or SNPs have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-8 for details).
In particular, Shennong 265 has a serious error in sequencing and should be a functional haplotype variety (see example 7 for details);
in addition, since the above-mentioned 13 reference sequences are already disclosed, the figure shows only the first one in the following "drawings of the specification" in order to fully understand the specific sequences of the Pib disease-resistant gene family and their marker information in conjunction with FIGS. 3 to 8.
FIG. 3 development and application of functional/non-functional haplotype specific molecular markers of the Pib disease-resistant gene family
3a-b 2 haplotype-specific optimal genomic differentiation regions;
functional haplotype variety: CK1(BL1), CK2(IR8), CK3(IR64), CK4(Shennong 265), CK5(Zhenshan 97), CK6(93-11), CK7(Minghui 63), CK8(Shuhui 498), CK9(CO 39);
non-functional haplotype variety: CK10(Tetep), CK11(Tadukan), CK12(Nipponbare), CK13(Suijing 18), CK14 (K59); m, DL-500;
description of the symbols I: #1 and #2, the numbering of the markers; F/N, functional (functional)/non-functional (non-functional); P/A, presence (presence; target genotype)/absence (absence; non-target genotype); 1451-1600, meaning that the marker is detected in the # 1451-1600 genome segment, and so on (same below).
In particular, 2 specific genomic regions (sequences) of CK4(Shennong 265) were all severely misrouted, and the variety was not a non-functional haplotype variety, but a functional haplotype variety.
FIG. 4 shows the development and application of disease-resistant allele Pib-BL function-specific molecular markers of functional haplotypes of Pib disease-resistant gene family
4a:1 optimal SNP for Pib-BL functional specificity;
the target gene variety: CK1, BL1 (Pib-BL); CK2, IR8 (Pib-BL); CK3, IR64 (Pib-BL); CK4, Shennong 265 (Pib-BL);
non-target gene variety: CK5, ZHENHAN 97 (Pib-ZS); CK6,93-11 (Pib-ZS); CK7, Minghui 63 (Pib-MH); CK8, Shuhui 498 (Pib-MH); CK9, CO39 (Pib-CO); CK10, Tetep (Pib-Null); CK11, Tadukan (Pib-Null); CK12, Nipponbare (Pib-Null); CK13, Suijing 18 (Pib-Null); CK14, K59 (Pib-Null); m, DL-500.
Specification of test varieties: the information of the 14 first reference varieties is as described above, and is not repeated herein if not necessary.
Description of the labeling II: the gene symbol is italicized and represents a functional gene; the gene symbol is a positive body and represents a marker; with Pib-BL A5817T For example, a functional specific marker of the functional gene Pib-BL is meant, and the upper marker is its specific SNP; so on (the same below);
in particular, #5817T from Shennong 265 is a sequencing error and should be # 5817A.
FIG. 5 development and application of functional haplotype disease-resistant allele Pib-ZS function-specific molecular marker of Pib disease-resistant gene family
5a:1 optimal SNP for Pib-ZS functional specificity;
the target gene variety: CK5, ZHENHAN 97 (Pib-ZS); CK6,93-11 (Pib-ZS);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 6 development and application of functional haplotype disease-resistant allele Pib-MH function-specific molecular markers of Pib disease-resistant gene family
6a:1 optimal SNP for Pib-MH functional specificity;
the target gene variety: CK7, Minghui 63 (Pib-MH); CK8, Shuhui 498 (Pib-MH);
non-target gene variety: the remaining 12 first reference varieties.
FIG. 7 shows the application and example of identifying and mining the novel disease-resistant allele Pib-CO from the reference variety with incomplete sequencing by using the technical system with the advantages of inclusion and accurate identification and mining of the rice blast Pib disease-resistant gene family functional genes
7a, a region with incomplete sequence of a target gene of a reference variety CO39 [ CO39 has 4 sequence vacancy regions (gaps) in the ATG-TGA region, wherein the largest gap is shown);
in particular, the gap in the target gene sequence of CO39 causes the position of the base in the alignment chart after adding CO39 to be slightly different from that in FIG. 2, but the position of the mark is still based on the mark in FIG. 2;
7b1 identification of 14 first set of reference varieties by 2 Pib-BL functional haplotype specificity optimal markers (with belt, functional haplotype; without belt, non-functional haplotype), the result shows that CK9(CO39) is a functional haplotype variety (different from the genotypes of CK 10-14);
7b2 identification of 14 reference varieties by 1 Pib-BL function specific optimal markers (upper band, target gene; lower band, non-target gene), the result shows that CK9(CO39) is not a Pib-BL carrier (different from CK 1-4 genotypes);
7b3 identification of 14 reference varieties by 1 Pib-ZS function specificity optimal markers (upper band, target gene; lower band, non-target gene), wherein the results show that CK9(CO39) is not a Pib-ZS carrier (different from the genotypes of CK 5-6);
7b4 identification of 14 reference varieties by 1 Pib-MH function specificity optimal markers (upper band, target gene; lower band, non-target gene), and the result shows that CK9(CO39) is not a Pib-MH carrier (different from CK 7-8 genotypes);
from the results of 7a to 7b, CK9(CO39) was concluded to be a carrier of a novel Pib disease resistance allele (Pib-CO) (unlike the 7b1 genotype of CK 10-14).
The remaining 13 first reference varieties were non-target gene-carrying varieties (as described above).
FIG. 8 is a diagram of the application and examples of screening true and false specific genomic differentiation regions (sequences) and target genes using the above-mentioned technical system for the identification and mining of alleles of the Pib disease-resistant gene family,
8a, 1 haplotype-specific optimal genome differentiation region (see another detailed picture in figure 3), and the result of a reference sequence shows that the japonica rice sequencing reference variety Shennong 265(CK4) is seemed to be completely consistent with the sequence of non-functional haplotype reference varieties such as Nipponbare (CK12), Suijing 18(CK 13);
8b, 2 optimal haplotype specific markers are used for identifying 14 first set of reference varieties, and the result shows that the haplotypes of 4 non-functional haplotype reference varieties such as Shennong 265(CK4), Nipponbare (CK12), Suijing 18(CK13) and the like are not consistent, but are consistent with functional haplotype varieties such as CK 1-9 and the like, thereby indicating that the specific genome differentiation region (sequence) of the Shennong 265 is wrong;
8c, 1 optimal SNP specific to the Pib-BL function, and the result shows that the sequences of 3 functional haplotype varieties such as Shennong 265, Zhenshan 97(CK5), Minghui 63(CK7), Shuhui 498(CK8) and the like and 4 non-functional haplotype reference varieties such as Nipponbare (CK12), Suijing 18(CK13) and the like are completely consistent;
8d, identification examples of 14 first reference varieties by the Pib-BL optimal gene specific marker developed by the SNP show that the sequence of Shennong 265 is not consistent with that of 3 functional haplotype varieties such as Zhenshan 97, Minghui 63, Shuhui 498 and 4 non-functional haplotype reference varieties such as Nipponbare, Suijing 18 and the like, but is consistent with that of 3 carriers of Pib-BL (BL 1(CK1), IR8(CK2) and IR64(CK 3)), thereby showing that the sequence of Shennong 265 in the SNP is also wrong, and the number 5817T of Shennong 265 is sequencing error and is number 5817A;
8e, 2 additional Pib disease-resistant gene families and the optimal gene specificity markers for 14 first set of reference varieties, and the results show that the genotype of the Shennong 265 is consistent with that of Pib-BL carriers such as CK 1-3, so that the Shennong 265 contains Pib-BL.
In conclusion, the technical system of the invention not only discriminates and corrects the specific genome differentiation region and SNP of the japonica rice sequencing reference variety Shennong 265(CK4), but also confirms the target gene carried by the japonica rice sequencing reference variety Shennong 265(CK 4).
FIG. 9 is an example of identifying and mining new and old disease-resistant alleles from a rice seed resource population in Guangdong province, in which target genes are unknown, by using the above-mentioned technical system for identifying and mining alleles of the rice blast Pib disease-resistant gene family with inclusion and precision. Wherein the content of the first and second substances,
9a:2 Pib-BL functional haplotype specific optimal markers [ with bands, functional haplotypes (red); the result of the identification of 44 test varieties of the non-band non-functional haplotypes (black) shows that 4 varieties, such as CV3, CV10, CV15, CV41 and the like, are non-functional haplotype varieties, and the other 40 varieties are functional haplotype varieties;
9b:1 Pib-BL function-specific optimal markers [ upper band, target gene (red); identifying 44 test varieties by using a lower band non-target gene, wherein the result shows that 21 varieties such as CV 11-14, CV19, CV 22-23, CV25, CV 27-32, CV 34-35, CV37, CV 39-40, CV42, CV44 and the like are Pib-BL carriers;
9d:1 Pib-MH functional specificity optimal markers [ upper band, target gene (green); lower band, non-target gene ] identifies 44 test varieties, and the result shows that 5 varieties, such as CV1, CV9, CV18, CV36, CV38 and the like, are Pib-MH carriers;
9a to d-all of the above results show that no specimen having the same genotype as that of CK4 was found, and it was concluded that there was no Pib-CO carrier (light red) among 44 specimens; similarly, 7 test varieties, such as CV 4-5, CV16, CV24, CV26, CV33 and CV43, have the same genotype but are different from all 4 control varieties, and are inferred to be carriers of the novel Pib disease resistance allele (purple);
wherein the second set of reference varieties is CK1, BL1 (Pib-BL); CK2, ZHENHAN 97 (Pib-ZS); CK3, Minghui 63 (Pib-MH); CK4, CO39 (Pib-CO); CK5, Nipponbare (Pib-Null); m, DL-500.
Specifically, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by independent color systems (the same below).
FIG. 10 is an example of identifying and mining new and old disease-resistant alleles from Guangxi autonomous region rice seed resource populations with unknown target genes by using the above-mentioned technical system for identifying and mining alleles of rice blast Pib disease-resistant gene family with compatibility and precision. Wherein the content of the first and second substances,
10a:2 Pib-BL functional haplotype specific optimal markers [ with bands, functional haplotypes (red); the result of the identification of 52 test varieties without bands and with non-functional haplotypes (black) shows that the other 51 varieties are functional haplotype varieties except CV 95;
10b:1 Pib-BL function-specific optimal markers [ upper band, target gene (red); lower band, non-target gene ] identifies 52 test varieties, and the result shows that 30 varieties such as CV 45-49, CV 52-56, CV58, CV60, CV 62-63, CV 65-70, CV 74-75, CV77, CV84, CV 86-88, CV90, CV 93-94 and the like are Pib-BL carriers;
10 a-d, the results are combined, 5 varieties such as CV51, CV57, CV64, CV 71-72 and the like are found to present the same genotype as CK4, and are inferred to be Pib-CO carriers; similarly, 8 test varieties such as CV50, CV76, CV 78-80, CV83, CV85 and CV96 present genotypes different from all 4 control varieties, so that the disease resistance gene is inferred to be a carrier (purple) of the novel Pib disease resistance allele;
the information for the second set of reference varieties is as described above.
FIG. 11 is a comparative example of the discrimination ability of the technical system of the present invention with the capability of inclusively and accurately identifying and mining alleles of the rice blast Pib disease-resistant gene family and other marker technologies
11a 1-4, the result of the identification of 14 first set of reference varieties by the technical system of the invention shows that CK 1-9 is a functional haplotype variety, wherein;
CK 1-4 is Pib-BL carrier; CK 5-6 is Pib-ZS carrier; CK 7-8 is Pib-MH carrier; CK9 is Pib-CO carrier;
11b 1-2, identification of 14 first set of reference varieties by using other labeling technology I (Fjellstrom et al 2004, Crop Science,44: 1790-1798; Liuyang et al 2008, Chinese agriculture Science, 41:9-14), wherein the results show that Pibdom can only identify Pib-BL (from the angle of disease-resistant genes), and can only confirm the existence of Pib-BL (from the angle of disease-sensitive genes) by adding Lys145, thereby generating a large amount of target gene misjudgments (CK 5-9);
11c 1-4, identification of 14 first reference varieties by other marking technology II (Hayashi et al 2006, Theoretical and Applied Genetics,113: 251-;
and (4) conclusion: the technical system of the present invention has remarkable advantages.
In particular, Pibdom, b2, b213 landed on the Pib clone sequence (AB013448.1), so its marker positions and sizes were calculated with the Pib-BL sequence as a reference; b28, b3989 and Lys145 are out of the range of the Pib clone sequence, so the marker positions and sizes are calculated by taking the genome sequence of Nipponbare (NC-029257.1) as a reference.
FIG. 12 shows a set of two-stage markers with the technical system of inclusively and precisely identifying and mining alleles of the rice blast Pib disease-resistant gene family.
Detailed Description
The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
All rice varieties used in the examples: first set of reference articlesSeed CK 1-14 and a second set of reference varieties CK 1-5 (as described above); and the test varieties CV 1-96 are collected and stored in the laboratory of the applicant, and are commonly used in the research field and include but are not limited to the above publications [ ZHai et al 2011, New Phytologist 189:321-334, https:// nph. onlineelibrary. wireless. com ]; hua et al.2012, the scientific and Applied Genetics 125:1047-1055,https://www.springer.com/journal/122(ii) a Snow plum, 2021, master paper at south china university of agriculture (no published labeling of relevant core information); annex charts are available at the respective magazine web sites ].
The technical route diagram developed and applied by the invention is shown in figure 1.
Example 1 sequence comparison of the Rice blast Pib disease-resistant Gene family and identification of its specific sequence (FIGS. 2 to 6)
First, experiment method
Using the cloned genomic sequence (ATG-TGA) of Pib-BL (donor variety TohokuIL-9; GenBank AB013448.1), another 6 genomic sequences of the reference varieties IR8, IR64, Zhenshan 97 (ZHENHAN 97, ZS), Minghui 63(Minghui 63, MH), Shuhui 498(Shuhui 498) and Shennong 265(SN) presumed to be the carriers of the target genes were searched and downloaded from public databases such as NCBI; for the convenience of sequence alignment analysis, 4 genome sequences corresponding to the sequencing reference varieties Nipponbare (NPB), Suijing 18 (SJ 18), Onyhan (Hitomebore, HTM) and Tetep (Tetep) which are presumed to be carriers of non-target genes were added.
The range of the individual genes ATG-TAG is referenced to the NCBI notes.
Sequence comparison analysis was performed by conventional bioinformatics methods.
Second, experimental results
The sequence comparison results are shown in FIGS. 2-6, and the results show that:
(1) in the sequencing reference variety of the Pib disease-resistant gene family, there are two copies of Minghui 63 and Shuhui 498, which is consistent with the previous report (Wang et al 1999). In this case, the double copies of the gene were compared and detected together (13 reference sequences in total);
(2) the Pib disease-resistant gene family has obvious functional haplotype (9 reference sequences of the 7 disease-resistant reference varieties) and non-functional haplotype (4 reference sequences of the 4 disease-sensitive reference varieties) (the typical positions are shown as the marks # 1 and #2 in figure 3);
(3) the alleles of the Pib disease-resistant gene family have individual function-specific SNPs (typical positions are shown by markers # 3 to #5 in marker diagrams 4 to 6);
in particular, Shennong 265 has a serious error in sequencing and should be a functional haplotype variety (see examples 2 and 7 for details);
in addition, since the above-mentioned 13 reference sequences are already disclosed, the figure shows only the first one in the following "drawings of the specification" in order to fully understand the specific sequences of the Pib disease-resistant gene family and their marker information in conjunction with FIGS. 3 to 8.
Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pib disease-resistant gene family (FIG. 3)
First, experiment method
The experimental procedures of this example are described in the papers published by the Applicant (Yuan et al 2011, the or Applied Genet 122: 1017-.
The following references are the same as those described above and need not be repeated.
Briefly described, the following steps:
(1) design of haplotype-specific molecular markers: according to the comparison result of the Pib disease-resistant gene family sequences, P/A (presence/absence) markers (for the convenience of description, named as #1 and #2 markers, the same below) are respectively designed for 2 genome regions with clear functional/non-functional haplotype differentiation by using Primer design software Primer 5.0. The primer sequences are as follows:
for the #1 marker (band, with functional gene; no band, without functional gene):
SEQ ID NO.1(Pib-F/N P/A(1451～1600) -F；5’-3’)：
AACATTTTAAGATTACAGCCAAAATATATG；
SEQ ID NO.2(Pib-F/N P/A(1451～1600) -R；5’-3’)：
AATATGTTTTTAGTTGCCCTT。
for the #2 marker (band, with functional gene; no band, without functional gene):
SEQ ID NO.3(Pib-F/N P/A(2070～2242) -F；5’-3’)：
AAAAGTCGAAACGACTTATAATATGAA；
SEQ ID NO.4(Pib-F/N P/A(2070～2242) -R；5’-3’)：
TGGCCTATAATTGGATTTGCGG。
the labeling instructions are as described above.
(2) Detection of haplotype-specific molecular markers: and carrying out PCR amplification on the 14 rice reference varieties by using the 2 groups of primers. The PCR amplification system (20.0. mu.L) was as follows:
[ the following PCR amplification System is the same as that described above, and is not repeated therein ]
The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, then PCR amplification for 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate according to the object to be detected) [ 94 ℃ denaturation for 30sec, annealing for 30sec (#1/56 ℃, #2/58 ℃), extension at 72 ℃ for 25-30 sec (which can be adjusted as appropriate according to the object to be detected) ], and finally extension at 72 ℃ for 5min, and the PCR product is stored in a refrigerator at 4 ℃ for later use.
[ except for the annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated
Take 0.25. mu.L of PCR product, add 0.25. mu.L of ddH 2 And mixing O and 5 mu L of 10x loading, performing electrophoresis (250V for 20-120 min) on 10-12% modified polyacrylamide gel by using a microsyringe for 1.5-2.0 mu L of product, and then performing photographing and recording of molecular markers according to a conventional detection method.
[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]
Second, experimental results
The size of each molecular marker is shown in fig. 3, and the results show that the 14 first set of reference varieties present clear genotypes (haplotypes):
functional haplotype variety: CK1(BL1), CK2(IR8), CK3(IR64), CK4(Shennong 265), CK5(Zhenshan 97), CK6(93-11), CK7(Minghui 63), CK8(Shuhui 498), CK9(CO 39);
non-functional haplotype variety: CK10(Tetep), CK11(Tadukan), CK12(Nipponbare), CK13(Suijing 18), CK14 (K59); m, DL-500.
Specification of test varieties: the information of the 14 first reference varieties is as described above, and is not repeated herein if not necessary.
In particular, 2 specific genomic regions (sequences) of CK4(Shennong 265) were all severely misleading and not belonging to non-functional haplotype varieties but to functional haplotype varieties (see example 7 for details).
Example 3: development and application of disease-resistant allele Pib-BL function-specific molecular marker of functional haplotype of Pib disease-resistant gene family (figure 4)
First, experiment method
(1) Designing a Pib-BL function specific molecular marker: according to the comparison result of the Pib disease-resistant gene family sequences, selecting 1 optimal SNP (A5817T) to design a Pib-BL function specific molecular marker Pib-BL A5817T (#3 marker). Briefly, according to the design principle of CAPS and dCAPS (derived dclearamplification and polymorphism sequences; Neff et al 2002, Trends in Genetics 18: 613-; then, the Primer design software Primer 5.0 is used for confirming the mark design;
the following molecular markers and primer design procedures are the same as those described above and are not repeated herein.
The primer sequences are as follows:
for the #3 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.5(Pib-BL A5817T -F；5’-3’)：
AATTCGAGGGCATAGTGGAC；
SEQ ID NO.6(Pib-BL A5817T -R；5’-3’)：
CAGTAAATCTGGCAGTAGATCAA。
(2) detection of Pib-BL function-specific molecular markers: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #3/55 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
The PCR product was taken out and digested with restriction enzyme Mse I, and the reaction system (10.0. mu.L) was as follows:
and (3) after enzyme digestion is carried out for 5 hours at 37 ℃, 10 mu L of 10x loading is added into each tube of enzyme digestion product and is mixed uniformly, and electrophoresis detection, photographing and recording are carried out on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedure.
[ the enzyme digestion system of PCR amplification products is the same as that described above, and will not be repeated here ]
Second, experimental results
The sizes of the molecular markers are shown in FIG. 4, and the results show that the Pib-BL function specific molecular marker can distinguish the target gene from all known functional genes of the gene family and non-functional genes:
the target gene variety: CK1, BL1 (Pib-BL); CK2, IR8 (Pib-BL); CK3, IR64 (Pib-BL); CK4, Shennong 265 (Pib-BL);
non-target gene variety: the remaining 10 first set of reference varieties;
in particular, #5817T from Shennong 265 is a sequencing error and should be # 5817A.
Example 4: development and application of disease-resistant allele Pib-ZS function-specific molecular marker of functional haplotype of Pib disease-resistant gene family (figure 5)
First, experiment method
(1) Designing a Pib-ZS function specific molecular marker: according to the alignment result of the Pib disease-resistant gene family sequences, selecting the optimal 1 SNP (T4098C) to be designed into a Pib-ZS function specific molecular marker Pib-ZS T4098C (#4 marker);
the primer sequences are as follows:
for the #4 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.7(Pib-ZS T4098C -F；5’-3’)：
AGAGCACAATAAAGCTTAAATTGT；
SEQ ID NO.8(Pib-ZS T4098C -R；5’-3’)：
TGCCAAGAATCCACCTATGACA。
(2) detection of Pib-ZS function-specific molecular markers: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #4/54 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental program by using the restriction enzyme Bfa I, and carrying out electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the molecular markers are shown in FIG. 5, and the results show that the Pib-BL function specific molecular marker can distinguish the target gene from all known functional genes of the gene family and non-functional genes:
the target gene variety: CK5, ZHENHAN 97 (Pib-ZS); CK6,93-11 (Pib-ZS);
non-target gene variety: the remaining 12 first reference varieties.
Example 5: development and application of disease-resistant allele Pib-MH functional specific molecular marker of functional haplotype of Pib disease-resistant gene family (FIG. 6)
First, experiment method
(1) Design of Pib-MH function-specific molecular markers: according to the alignment result of the Pib disease-resistant gene family sequences, selecting the optimal 1 SNP (C2856T) to design as a Pib-MH function specific molecular marker Pib-MH C2856T (#5 marker);
the primer sequences are as follows:
for the #5 marker (upper and double bands, non-target gene; lower band, target gene):
SEQ ID NO.9(Pib-MH C2856T -F；5’-3’)：
TCCAAAACTAAGGTTTATACTAGACTGCAAATTA；
SEQ ID NO.10(Pib-MH C2856T -R；5’-3’)：
AATGATTAAGAACAACTTTTAGCCTTAAA。
(2) detection of Pib-MH function-specific molecular markers: using the above pair of primers, 14 first reference varieties were subjected to PCR amplification according to the above PCR amplification system (annealing temperature: #5/52 ℃ C.), and the products thereof were stored in a 4 ℃ refrigerator for later use.
And taking out the PCR product, carrying out enzyme digestion according to the experimental procedure by using the restriction enzyme Hinf I, and carrying out electrophoresis detection, photographing and recording.
Second, experimental results
The sizes of the molecular markers are shown in FIG. 5, and the results show that the Pib-BL function specific molecular marker can distinguish the target gene from all known functional genes of the gene family and non-functional genes:
the target gene variety: CK7, Minghui 63 (Pib-MH); CK8, Shuhui 498 (Pib-MH);
non-target gene variety: the remaining 12 first reference varieties.
Example 6: the application and the example of the novel disease-resistant allele Pib-CO are identified and excavated from the reference variety with incomplete sequencing by utilizing the technical system which has the advantages of inclusion, accurate identification and excavation of the disease-resistant gene family allele of the rice blast Pib (figure 7)
Unlike the general molecular marker technology, the technology system of the present invention is composed of secondary detection markers such as "functional haplotype-disease resistance allele", which are only used for detecting the DNA polymorphism of the specific genome region of the target gene. The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. Therefore, the novel disease-resistant allele Pib-CO is identified and mined from the reference variety CO39 with incomplete sequencing. Specifically, the method comprises the following steps:
(1) as shown in fig. 7a, reference variety CO39(CK9, a commonly used rice blast indica susceptible variety) has 4 sequence gaps (gap) in its target gene region, which is the largest one; from the sequence as a whole, CO39 appears to belong to a non-functional haplotype variety;
in particular, the gap in the target gene sequence of CO39 causes the position of the base in the alignment chart after adding CO39 to be slightly different from that in FIG. 2, but the position of the mark is still based on the mark in FIG. 2;
(2) however, when the functional/non-functional haplotype-specific molecular markers of the technical system of the present invention were tested, it was found that 2 markers all showed CO39 as functional haplotype varieties, thus indicating that the target gene sequences of the varieties had serious errors (FIG. 7b 1);
(3) when the functional specific molecular markers of 3 disease-resistant alleles (Pib-BL, Pib-ZS and Pib-MH) of the functional haplotype of the technical system are further used for detection, the genotype of CO39(CK9) is different from that of 3 target genes, and therefore, the fact that the variety contains the novel Pib disease-resistant allele Pib-CO is inferred. The genotypes of the 14 first set of reference varieties were as follows:
the target gene variety: CK9, CO39 (Pib-CO);
non-target gene variety: the remaining 13 first set of reference varieties.
In summary, the technology system has systematic and strict inclusion, comparability and error correction capability. Therefore, the novel disease-resistant allele of the reference variety with incomplete sequencing is accurately identified and mined.
Example 7: the application and example of screening true and false specific genome differentiation region (sequence) and target gene by using the technical system with the advantages of inclusion, accurate identification and excavation of rice blast Pib disease-resistant gene family allele (figure 8)
As the Pib disease-resistant gene family is located in the long-arm telomere region of the 6 th chromosome of rice, the overall sequencing quality is not high, and a large number of sequencing errors exist in the whole gene family. Specifically, the method comprises the following steps:
(1) the results of the reference sequences of the 2 haplotype-specific optimally differentiated genomic regions show that the japonica rice sequencing reference variety Shennong 265(CK4) appears to be completely identical to the sequences of 4 non-functional haplotype reference varieties such as Nipponbare (CK12), Suijing 18(CK13) (FIG. 8 a; see FIG. 3 for further details);
(2) however, the identification results of the 14 first sets of reference varieties by the 2 optimal haplotype-specific markers show that the haplotypes of 4 non-functional haplotype reference varieties such as Shennong 265(CK4), Nipponbare (CK12), Suijing 18(CK13) and the like are not consistent, but are consistent with the functional haplotype varieties such as CK 1-9 and the like, thereby indicating that the specific genomic region (sequence) of the Shennong 265 is wrong (FIG. 8 b);
(3) the results of 1 optimal SNP specific to the Pib-BL function show that the sequences of 3 functional haplotype varieties such as Shennong 265 and Zhenshan 97(CK5), Minghui 63(CK7), Shuhui 498(CK8) and 4 non-functional haplotype reference varieties such as Nipponbare, Suijing 18 are completely consistent (FIG. 8 c);
(4) however, the identification of 14 first reference varieties by the Pib-BL function-specific marker developed by this SNP revealed that shennon 265 did not correspond to the sequences of 3 functional haplotype varieties such as Zhenshan 97, Minghui 63, Shuhui 498 and 4 non-functional haplotype reference varieties such as Nipponbare, Suijing 18, but to the genotypes of 3 Pib-BL carriers [ BL1(CK1), IR8(CK2) and IR64(CK3) ]. This indicates that Shennong 265 is also wrong in the sequence of this SNP, and #5817T of Shennong 265 is a sequencing error and should be #5817A (fig. 8 d);
(5) furthermore, the identification results of the optimal gene specific markers of the 2 additional Pib disease-resistant gene families on 14 first reference varieties show that the genotype of the Shennong 265 is consistent with that of the Pib-BL carriers such as CK 1-3, thereby indicating that the Shennong 265 does contain Pib-BL (FIG. 8 d).
In conclusion, the technical system of the invention not only discriminates and corrects the specific genome differentiation region and SNP of the japonica rice sequencing reference variety Shennong 265(CK4), but also confirms the target gene carried by the japonica rice sequencing reference variety Shennong 265(CK 4).
Example 8: an example of identifying and mining new and old disease-resistant alleles from Guangdong province rice resource groups with unknown target genes by using the technical system with inclusion and accurate identification and mining of rice blast Pib disease-resistant gene family alleles (figure 9)
First, experiment method
(1) The technical system of the invention consists of 5 basic specific markers of secondary detection markers such as 'functional haplotype-disease resistance allele'. Wherein, the functional/non-functional haplotype detection needs to be advanced preferentially, and the subsequent detection of each disease-resistant allele has no precedence. The detection procedures and schemes of the whole technical system are as described above (fig. 3-6; examples 2-5), which are not repeated.
In particular, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the number of non-functional haplotype test varieties is too small, the disease resistance allele is detected by retaining the whole population of the test varieties in order to maintain the uniformity and comparability of the detection effect.
(2) Utilizing the technical system to randomly select 44 Guangdong province rice seed resources (CV 1-44); ZHai et al.2011, New Phytologist,189: 321-; hua et al.2012, the scientific and Applied Genetics,125: 1047-; leaf snow plum, 2021, master paper of southern agriculture university (no public mark related core information) ], identification and excavation of Pib disease-resistant gene family functional genes are carried out;
a second set of reference varieties identified by the above 5 genes of interest was also used as controls in the experiment.
(3) Separating and cloning novel disease-resistant alleles by using a conventional homologous gene cloning technology based on a PCR technology (Zhai et al 2011, New Phytologist,189: 321-334; Hua et al 2012, the or Appl Genet 125:1047-1055), sequencing and logging in GenBank;
in particular, according to the rules of GenBank, all the registered gene sequences are subjected to gene annotation (annotation) to ensure their integrity and readability and are thus functional genes.
Second, experimental results
(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 44 test varieties were classified as (FIG. 9 a; red marker, functional haplotype; black marker, non-functional haplotype):
non-functional haplotype variety: 4 varieties of CV3, CV10, CV15 and CV41
Functional haplotype variety: 40 varieties other than the 4 non-functional haplotype varieties described above.
(2) In the secondary marker-based detection of disease-resistant alleles, 40 functional haplotype test varieties were further identified as:
the target gene Pib-BL carries the variety (FIG. 9 b; red label): 21 varieties of CV 11-14, CV19, CV 22-23, CV25, CV 27-32, CV 34-35, CV37, CV 39-40, CV42, CV44 and the like;
the target gene Pib-ZS carries the variety (FIG. 9 c; blue designation): 7 varieties of CV2, CV 6-8, CV17, CV 20-21 and the like;
the target gene Pib-MH carried variety (FIG. 9 d; green designation): 5 varieties CV1, CV9, CV18, CV36, CV38 and the like;
the target gene Pib-CO carried variety (FIGS. 9 b-d; light red designation): none;
unknown novel disease-resistant allele Pib-GLA carrying varieties (fig. 9 b-d; purple designation): 7 varieties (with the same genotype) such as CV 4-5, CV16, CV24, CV26, CV33 and CV 43.
In particular, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by separate color systems.
(3)1 novel disease-resistant alleles such as Pib-GLA (GenBank MZ846152) are isolated and cloned by using a conventional homologous gene cloning method based on a PCR technology and taking CV5(Guangluai 4) as a representative.
This example demonstrates that the present technology system has strong compatibility and comparability, since 40 functional haplotype varieties are first identified in 44 rice resource populations of Guangdong province with unknown target genes; then 3 identified target genes Pib-BL, Pib-ZS, Pib-MH, plus 1 novel disease resistance allele Pib-GLA were further identified.
Example 9: an example of identifying and mining new and old disease-resistant alleles from Guangxi autonomous region rice seed resource groups with unknown target genes by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of rice blast Pib disease-resistant gene family alleles (figure 10)
First, experiment method
(1) As described above, the technical system of the present invention comprises 5 basic specific markers of secondary detection markers such as "functional haplotype-disease resistance allele".
Similarly, in principle non-functional haplotype test varieties can be excluded from subsequent detection of disease-resistant alleles. In this case, since the number of non-functional haplotype test varieties is too small, the test varieties are integrally retained to detect the disease-resistant allele in order to maintain the uniformity of the detection effect.
(2) Utilizing the technical system to randomly select 52 Guangxi autonomous region rice seed resources (CV 45-96); leaf snow plum, 2021, master paper of southern agriculture university (no public mark related core information) ], identification and excavation of Pib disease-resistant gene family functional genes are carried out;
reference varieties of 5 second varieties were also included in the trial as controls.
(3) The novel disease-resistant allele is separated and cloned by utilizing the conventional homologous gene cloning technology based on the PCR technology and sequenced.
Second, experimental results
(1) In the primary marker-based functional haplotype/non-functional haplotype assay, 52 test varieties were classified (FIG. 10 a; red marker, functional haplotype; black marker, non-functional haplotype):
non-functional haplotype variety: 1 variety CV95, etc
Functional haplotype variety: 51 varieties except CV 95.
(2) In the secondary marker-based detection of disease-resistant alleles, 51 functional haplotype test varieties were further identified as:
the target gene Pib-BL carries the variety (FIG. 10 b; red indication): 30 varieties of CV 45-49, CV 52-56, CV58, CV60, CV 62-63, CV 65-70, CV 74-75, CV77, CV84, CV 86-88, CV90, CV 93-94 and the like;
the target gene Pib-ZS carries the variety (FIG. 10 c; blue designation): 7 varieties of CV59, CV61, CV73, CV81, CV89, CV 91-92 and the like;
the target gene Pib-MH carried variety (FIG. 10 d; green designation): 1 variety, CV82, etc.;
the target gene Pib-CO carried variety (FIGS. 10 b-d; light red designation): 5 varieties CV51, CV57, CV64, CV 71-72 and the like;
unknown novel disease-resistant allele Pib-F029 carrying variety (FIGS. 10 b-d; purple designation): 2 varieties of CV50, CV79 and the like;
unknown novel disease-resistant allele Pib-GLA carrying varieties (fig. 10 b-d; purple designation): 6 varieties such as CV76, CV78, CV80, CV83, CV85 and CV96 (the genotype is the same as that of the varieties such as CV4 to 5 in example 8).
In particular, the results of the detection of secondary markers such as "functional haplotype-resistance allele" are indicated by separate color systems.
(3)1 novel disease-resistant allele such as Pib-F029(GenBank MZ846155) is separated and cloned by using a conventional PCR-based homologous gene cloning method and taking CV50(F029) as a representative
This example further demonstrates that the present technology system has strong compatibility and comparability, since 51 functional haplotype varieties are identified first in 55 Guangxi rice seed resource populations with unknown target genes; then, 4 determined target genes Pib-BL, Pib-ZS, Pib-MH and Pib-CO are identified in 51 functional haplotype varieties, and 2 novel disease-resistant alleles Pib-F029 and Pib-GLA are added.
Example 10: one set of the invention has the advantages of compatibility, accurate identification and comparative example of the identification capability of the technical system for identifying and mining the rice blast Pib disease-resistant gene family functional genes and other marking technologies (figure 11)
(1) Although the rice blast Pib disease-resistant gene family is one of the most widely applied broad-spectrum persistent resistance sources in the global rice disease-resistant breeding program, the molecular markers developed and applied to date are not many, and the molecular markers are only aiming at the first Pib-BL (the first Pib-BL) which is separated and clonedPibdom,Lys145(Fjellstrom et al 2004, Crop Science,44: 1790-;Pibdom,Lys145(Houke et al, 2009, proceedings of plant genetic resources, 10: 21-26);Pibdom(Yangjie et al, 2011, North China agricultural bulletin, 26: 1-6);Pibdom(Dai Xiao Jun et al, 2012, Life sciences research, 16: 340-;Pibdom(Fjellstrom et al.2004,Crop Science,44:1790-1798)；b2,b28,b213,b3989(Hayashi et al 2006, thermal and Applied Genetics,113: 251-260); underlined is a mark ];
(2) from the above main references, 2 sets of most representative other marker technologies I (Liuyang et al, 2008, Chinese agricultural science, 41:9-14) and II (Hayashi et al 2006, Theoretical and Applied Genetics,113: 251-. The results show that compared with 2 sets of other mark systems, the technical system of the invention has the following outstanding and definite innovativeness and beneficial effects (the two-level mark is shown in figure 12):
(a) functional/non-functional haplotype analysis using the primary markers marked clear functional haplotype boundaries for subsequent functional gene mining and identification (FIG. 11a 1). In this example, CK 1-9 were identified as functional haplotype varieties and CK 10-14 were non-functional haplotype varieties in the 14 first set of reference varieties tested. The method is one of the incomparable beneficial effects of 2 sets of other marking technologies;
(b) on the basis, the disease-resistant allele analysis is carried out by using the secondary marker, and clear and comparable functional gene boundaries are marked for the identification of each disease-resistant allele (FIG. 11a 2-4). In this example, 1 optimal functional specific marker was selected for each of the 3 disease resistance alleles (Pib-BL, Pib-ZS, Pib-MH), and each marker was independent of each other and aligned to form a precise identification system. This is one of the incomparable benefits of 2 sets of other marking techniques. Specifically, the method comprises the following steps:
as mentioned above, the technical system of the invention is composed of a set of 5 secondary detection markers such as 'functional haplotype-disease resistance allele', and 3 disease resistance alleles (Pib-BL, Pib-ZS, Pib-MH) can be accurately identified on the basis of clearly identifying functional/non-functional haplotypes. Furthermore, 1 novel disease-resistant allele (Pib-CO) is precisely excavated through comprehensive comparison of 5 detection marker genotypes.
The other-party marking technology I is that the most commonly used marker Pibdom so far can only identify the existence of a target gene Pib-BL from the aspect of disease-resistant genes (the specificity is not strong, and the genotype is fuzzy); the complementary marker developed later infers the existence of the target gene Pib-BL from the perspective of the disease-sensitive gene (strong specificity, clear genotype). The problem that arises from this is that (i) all of the 3 disease-resistant alleles (Pib-ZS, Pib-MH, Pib-CO; CK 5-9) are misjudged as disease-sensitive genes; (ii) the 2 markers are only specific to a target gene Pib-BL, so that an inclusive, logical and comparable technical system cannot be formed to identify and mine more disease-resistant alleles.
The other party marking technology II is characterized in that the marking technology is composed of a set of 4 groups of 8 marks, but the marks do not have inclusion, logic and comparability, and the repeated identification results only show that CK 1-9 is a functional haplotype variety (a carrier of Pib). The problems that arise from this are (i) the inability to accurately identify the 4 disease-resistant alleles (Pib-BL, Pib-ZS, Pib-MH, Pib-CO) described above, leading to serious "homonymic heterogenes", and "false positive markers" (#9 and #10 markers misidentify CK 10-11 as carriers of Pib); (ii) since only #9 marker of 8 markers is developed in coding region, a technical system with compatibility, logicality and comparability cannot be formed to identify and mine more disease-resistant alleles of the gene family.
And (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with other marking technologies.
The above examples demonstrate from different angles that the technical system of the present invention has the remarkable ability and effect of inclusively and precisely identifying and mining the functional genes of the Pib disease-resistant gene family.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.
SEQUENCE LISTING
<110> southern China university of agriculture
<120> a set of technical bodies with inclusion and accurate identification and excavation of rice blast Pib disease-resistant gene family functional genes
Is a system
<130>
<160> 30
<170> PatentIn version 3.3
<210> 1
<211> 30
<212> DNA
<213> tag Pib-F/NP/A (1451-1600) -F
<400> 1
aacattttaa gattacagcc aaaatatatg 30
<210> 2
<211> 21
<212> DNA
<213> tag Pib-F/NP/A (1451-1600) -R
<400> 2
aatatgtttt tagttgccct t 21
<210> 3
<211> 27
<212> DNA
<213> tag Pib-F/NP/A (2070-2242) -F
<400> 3
aaaagtcgaa acgacttata atatgaa 27
<210> 4
<211> 22
<212> DNA
<213> Label Pib-F/NP/A (2070-2242) -R
<400> 4
tggcctataa ttggatttgc gg 22
<210> 5
<211> 20
<212> DNA
<213> marker Pib-BLA5817T-F
<400> 5
aattcgaggg catagtggac 20
<210> 6
<211> 23
<212> DNA
<213> marker Pib-BLA5817T-R
<400> 6
cagtaaatct ggcagtagat caa 23
<210> 7
<211> 24
<212> DNA
<213> Mark Pib-ZST4098C-F
<400> 7
agagcacaat aaagcttaaa ttgt 24
<210> 8
<211> 22
<212> DNA
<213> Mark Pib-ZST4098C-R
<400> 8
tgccaagaat ccacctatga ca 22
<210> 9
<211> 34
<212> DNA
<213> marker Pib-MHC2856T-F
<400> 9
tccaaaacta aggtttatac tagactgcaa atta 34
<210> 10
<211> 29
<212> DNA
<213> marker Pib-MHC2856T-R
<400> 10
aatgattaag aacaactttt agccttaaa 29
<210> 11
<211> 21
<212> DNA
<213> marks Pibdom 6741-7117-F
<400> 11
gaacaatgcc caaacttgag a 21
<210> 12
<211> 20
<212> DNA
<213> marks Pibdom 6741-7117-R
<400> 12
gggtccacat gtcagtgagc 20
<210> 13
<211> 20
<212> DNA
<213> Label Lys 145-3678-2934-F
<400> 13
tcggtgcctc ggtagtcagt 20
<210> 14
<211> 20
<212> DNA
<213> Label Lys 145-3678-2934-R
<400> 14
gggaagcgga tcctaggtct 20
<210> 15
<211> 24
<212> DNA
<213> Label b2(BL1) -1054- < 840-F
<400> 15
gcattagata gtgatgaaag ccgg 24
<210> 16
<211> 23
<212> DNA
<213> marker b2(BL1) -1054- < 840-R
<400> 16
aatggactgg tgttcatcca ggc 23
<210> 17
<211> 24
<212> DNA
<213> tag b2(KSH) -1054- < 840-F
<400> 17
gcattagata gtgatgaaag cata 24
<210> 18
<211> 23
<212> DNA
<213> tag b2(KSH) -1054 to-840-R
<400> 18
aatggactgg tgttcatcca ggc 23
<210> 19
<211> 21
<212> DNA
<213> tag b28(BL1)34372 to 34760-F
<400> 19
gactcggtcg accaattcgc c 21
<210> 20
<211> 20
<212> DNA
<213> tag b28(BL1)34372 to 34760-R
<400> 20
atcaggccag gccagatttg 20
<210> 21
<211> 21
<212> DNA
<213> markers b28(KSH)34372~34760-F
<400> 21
gactcggtcg accaattcgc a 21
<210> 22
<211> 20
<212> DNA
<213> markers b28(KSH)34372~34760-R
<400> 22
atcaggccag gccagatttg 20
<210> 23
<211> 24
<212> DNA
<213> marker b213(BL1) -1054-850-F
<400> 23
gcattagata gtgatgaaag ccgg 24
<210> 24
<211> 20
<212> DNA
<213> marker b213(BL1) -1054-850-R
<400> 24
tgttcatcca ggcaattggc 20
<210> 25
<211> 24
<212> DNA
<213> tag b213(KSH) -1054-850-F
<400> 25
gcattagata gtgatgaaag ccga 24
<210> 26
<211> 20
<212> DNA
<213> tag b213(KSH) -1054 to-850-R
<400> 26
tgttcatcca ggcaattggc 20
<210> 27
<211> 20
<212> DNA
<213> marker b3989(BL1) -318677-318216-F
<400> 27
tgtaagcgcg ggatatccgg 20
<210> 28
<211> 21
<212> DNA
<213> marker b3989(BL1) -318677-, -318216-R
<400> 28
ttgtgagctt tgccactcca c 21
<210> 29
<211> 20
<212> DNA
<213> flags b3989(KSH) -318677-318216-F
<400> 29
tgtaagcgcg ggatatccga 20
<210> 30
<211> 21
<212> DNA
<213> flags b3989(KSH) -318677-318216-R
<400> 30
ttgtgagctt tgccactcca c 21
Claims (5)
1. A method for identifying and excavating rice blast Pib disease-resistant gene family functional genes with compatibility and precision is characterized in that the method consists of functional haplotype-disease-resistant allele secondary detection markers and is advanced step by step, and whether a test variety carries a target gene or not is determined by the integrated result of the test variety;
specifically, the method comprises the following steps:
(1) the functional haplotype/non-functional haplotype detection process of the gene family:
defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in families; designing 2 haplotype specific molecular markers and carrying out haplotype analysis of functional gene/non-functional gene reference varieties based on PCR technology to confirm the reliability; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety; in subsequent tests, non-functional varieties were excluded;
(2) the detection process of disease-resistant allele Pib-BL of functional haplotype of the gene family:
defining SNP specific to a target gene by sequence comparison of functional genes in a family, and designing 1 optimal functional specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability; the Pib-BL gene carrier belongs to functional haplotype of Pib disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of the Pib-BL reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pib-BL;
(3) the detection procedure of disease-resistant allele Pib-ZS of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in a family, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the Pib-ZS gene carrier belongs to functional haplotype of Pib disease-resistant gene family, and the genotype of the function specific molecular marker is the same as that of the Pib-ZS reference variety; on the contrary, the detection result that any detection mark does not meet the method is not the target gene Pib-ZS;
(4) the detection procedure of disease-resistant allele Pib-MH of functional haplotype of the gene family:
defining SNP specific to a target gene through sequence comparison of functional genes in families, and designing 1 optimal specific molecular marker; performing a specific genotype analysis of the target gene of the functional haplotype variety based on the PCR technique to confirm the reliability thereof; the carrier of the Pib-MH gene belongs to functional haplotype of Pib disease-resistant gene family, and the genotype of the functional specific molecular marker is the same as that of a Pib-MH reference variety; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Pib-MH;
specifically, in the above method:
(1) the optimal and simplest haplotype-specific molecular marker combination is Pib-F/N P/A(1451～1600) And Pib-F/N P /A(2070～2242) (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;
wherein, the Pib-F/N P/A(1451～1600) And Pib-F/N P/A(2070～2242) The notation in (1):
F/N, functional/non-functional;
P/A, presence of presence, target genotype/absence of absence, non-target genotype;
1451 to 1600, means #1451 to 1600 genome segment;
2070-2242, meaning # 2070-2242 genome segment;
(2) the optimal target gene specific molecular marker is Pib-BL A5817T (ii) a The sequence is shown in SEQ ID NO. 5-6;
wherein, the first and the second end of the pipe are connected with each other,the Pib-BL A5817T Means a function-specific marker for the functional gene Pib-BL, and the upper marker is its specific SNP;
(3) the optimal target gene specific molecular marker is Pib-ZS T4098C (ii) a The sequence is shown as SEQ ID NO. 7-8;
(4) the optimal target gene specific molecular marker is Pib-MH C2856T (ii) a The sequence is shown in SEQ ID NO. 9-10.
2. The method of claim 1, wherein the method is applied to systematic and accurate inclusion identification and mining of functional genes in the complex rice blast Pib disease-resistant gene family, and comprises the following 3 target genes:
the functional haplotype of the rice blast Pib disease-resistant gene family has the disease-resistant allele Pib-BL with the sequence shown in GenBank AB 013448.1;
the functional haplotype disease-resistant allele Pib-ZS of the rice blast Pib disease-resistant gene family has the sequence shown in GenBank MZ 846154;
the functional haplotype disease-resistant allele Pib-MH of the rice blast Pib disease-resistant gene family has the sequence shown in GenBank MZ 846153.
3. The method of claim 1, wherein the method is used for identifying known functional genes of the gene family in a reference variety with incomplete sequencing, and mining the following target genes: a novel disease-resistant allele Pib-CO of a functional haplotype of the rice blast Pib disease-resistant gene family; the sequence of the disease resistance allele Pib-CO is shown in GenBank MZ 846151.
4. The method of claim 1, wherein the method is used for identifying known functional genes of the gene family in germplasm resources of unknown target genes, and mining the following target genes: novel disease-resistant alleles Pib-GLA, Pib-F029 of functional haplotypes of the rice blast Pib disease-resistant gene family;
the sequence of the disease-resistant allele Pib-GLA is shown in GenBank MZ 846152;
the sequence of the disease resistance allele Pib-F029 is shown in GenBank MZ 846155.
5. The method of claim 1, wherein the method is used to accurately screen true and false genomic differentiation regions and SNPs and true and false target genes that are prevalent in the gene family due to sequencing errors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110971011.4A CN113903397B (en) | 2021-08-23 | 2021-08-23 | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110971011.4A CN113903397B (en) | 2021-08-23 | 2021-08-23 | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113903397A CN113903397A (en) | 2022-01-07 |
| CN113903397B true CN113903397B (en) | 2022-09-02 |
Family
ID=79188197
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110971011.4A Active CN113903397B (en) | 2021-08-23 | 2021-08-23 | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113903397B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755475A (en) * | 2017-01-17 | 2017-05-31 | 中国水稻研究所 | A kind of method of early 39 rice blast resistance genes in identification super early rice |
| CN108018371A (en) * | 2017-12-21 | 2018-05-11 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character |
| CN111218521A (en) * | 2020-01-13 | 2020-06-02 | 福建农林大学 | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040060081A1 (en) * | 2001-10-19 | 2004-03-25 | Leong Sally A. | Plant genes that confer resistance to strains of magnaporthe grisea having avri co39 cultivar specificity gene |
| US20040006788A1 (en) * | 2002-01-25 | 2004-01-08 | Guo-Liang Wang | Procedures and materials for conferring disease resistance in plants |
| CN102676512B (en) * | 2012-05-23 | 2013-12-25 | 华南农业大学 | Rice blast resistant gene Pia-C functional specificity molecular marker and method and application thereof |
-
2021
- 2021-08-23 CN CN202110971011.4A patent/CN113903397B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755475A (en) * | 2017-01-17 | 2017-05-31 | 中国水稻研究所 | A kind of method of early 39 rice blast resistance genes in identification super early rice |
| CN108018371A (en) * | 2017-12-21 | 2018-05-11 | 辽宁省盐碱地利用研究所 | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character |
| CN111218521A (en) * | 2020-01-13 | 2020-06-02 | 福建农林大学 | Functional specificity molecular marker of rice blast resistance gene Pib and detection method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Molecular analysis of five rice blast resistant genes in landraces from Myanmar and Laos;Jiqiong Ma et.al;《PLANT GENETIC RESOURCES-CHARACTERIZATION AND UTILIZATION》;20200801;第1-7页 * |
| 水稻主栽品种空育131抗稻瘟病位点的扫描及其基因组重构建;张晓慧 等;《植物学报》;20171231;第52卷(第1期);第30-42页 * |
| 源于广8A杂交稻组合的稻瘟病菌无毒基因型分析;汪文娟 等;《中国农业科学》;20181231;第51卷(第24期);第4633-4646页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113903397A (en) | 2022-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113789403B (en) | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems | |
| CN116814673A (en) | Genomic structural variation for regulating and controlling content of soluble solids in tomato fruits, related products and application | |
| CN110452969A (en) | A kind of rat quality of heredity monitoring SNP marker classifying method and kit based on KASP | |
| CN114480704A (en) | SNP combined marker for identifying eggplant seed resources | |
| CN113903397B (en) | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof | |
| CN108456740A (en) | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113744800B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker | |
| CN113981121B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| KR101907825B1 (en) | Molecular marker for selecting tomato plants resistant to powdery mildew disease | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| JP2013000066A (en) | Method for identifying tree species of interspecific hybrid of eucalyptus | |
| CN114292937B (en) | One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families | |
| CN114622027B (en) | One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families | |
| CN113981122B (en) | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy | |
| CN108315435A (en) | With the relevant SNP marker of sheep litter size character and application | |
| CN115976248A (en) | Method for uniquely identifying populus diversifolia pie plants and kit used in method | |
| CN116219048A (en) | Pea core SNP molecular marker set developed based on KASP technology and application thereof | |
| CN113774160B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster | |
| CN113736907A (en) | SNP locus combination for detecting tomato gray leaf spot resistance and application thereof | |
| CN113736908B (en) | SNP locus combination for detecting tomato leaf mold resistance and application thereof | |
| CN116751887B (en) | Application of GhEIF A gene associated with cotton fiber strength character |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |