CN113774160B - Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster - Google Patents
Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster Download PDFInfo
- Publication number
- CN113774160B CN113774160B CN202110815869.1A CN202110815869A CN113774160B CN 113774160 B CN113774160 B CN 113774160B CN 202110815869 A CN202110815869 A CN 202110815869A CN 113774160 B CN113774160 B CN 113774160B
- Authority
- CN
- China
- Prior art keywords
- functional
- haplotype
- gene
- piz
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 108091008053 gene clusters Proteins 0.000 title claims abstract description 198
- 201000010099 disease Diseases 0.000 title claims abstract description 167
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 title claims abstract description 167
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 114
- 235000009566 rice Nutrition 0.000 title claims abstract description 114
- 230000002085 persistent effect Effects 0.000 title claims description 32
- 238000009412 basement excavation Methods 0.000 title abstract description 21
- 240000007594 Oryza sativa Species 0.000 title 1
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 476
- 241000209094 Oryza Species 0.000 claims abstract description 114
- 239000003550 marker Substances 0.000 claims abstract description 104
- 238000001514 detection method Methods 0.000 claims abstract description 95
- 230000009897 systematic effect Effects 0.000 claims abstract description 13
- 102000054766 genetic haplotypes Human genes 0.000 claims description 216
- 101150050192 PIGM gene Proteins 0.000 claims description 100
- 239000003147 molecular marker Substances 0.000 claims description 78
- 238000000034 method Methods 0.000 claims description 48
- 238000012163 sequencing technique Methods 0.000 claims description 46
- 238000012360 testing method Methods 0.000 claims description 36
- 238000005065 mining Methods 0.000 claims description 26
- 238000005516 engineering process Methods 0.000 claims description 23
- 238000004458 analytical method Methods 0.000 claims description 22
- 238000012216 screening Methods 0.000 claims description 16
- 108700028369 Alleles Proteins 0.000 claims description 15
- 239000002773 nucleotide Substances 0.000 claims description 4
- 125000003729 nucleotide group Chemical group 0.000 claims description 4
- 241000196324 Embryophyta Species 0.000 abstract description 14
- 238000009395 breeding Methods 0.000 abstract description 14
- 230000001488 breeding effect Effects 0.000 abstract description 14
- 230000004069 differentiation Effects 0.000 abstract description 13
- 208000035240 Disease Resistance Diseases 0.000 abstract description 5
- 108020004414 DNA Proteins 0.000 description 41
- 102100023972 Keratin, type II cytoskeletal 8 Human genes 0.000 description 29
- 101000975474 Homo sapiens Keratin, type I cytoskeletal 10 Proteins 0.000 description 25
- 102100023970 Keratin, type I cytoskeletal 10 Human genes 0.000 description 25
- 230000008901 benefit Effects 0.000 description 25
- 238000002474 experimental method Methods 0.000 description 24
- 238000011161 development Methods 0.000 description 19
- 238000012408 PCR amplification Methods 0.000 description 18
- 238000001976 enzyme digestion Methods 0.000 description 18
- 238000013461 design Methods 0.000 description 14
- 238000012937 correction Methods 0.000 description 13
- 239000000969 carrier Substances 0.000 description 12
- 230000000052 comparative effect Effects 0.000 description 9
- 238000000137 annealing Methods 0.000 description 8
- 108091008146 restriction endonucleases Proteins 0.000 description 8
- 239000000463 material Substances 0.000 description 7
- 229920002401 polyacrylamide Polymers 0.000 description 7
- 238000010586 diagram Methods 0.000 description 6
- 238000001962 electrophoresis Methods 0.000 description 6
- 241000894007 species Species 0.000 description 6
- 230000003321 amplification Effects 0.000 description 5
- 238000003556 assay Methods 0.000 description 5
- 210000000349 chromosome Anatomy 0.000 description 5
- 238000002372 labelling Methods 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 5
- 108091026890 Coding region Proteins 0.000 description 4
- 230000002068 genetic effect Effects 0.000 description 4
- 102000054765 polymorphisms of proteins Human genes 0.000 description 4
- 238000011160 research Methods 0.000 description 4
- 101000614627 Homo sapiens Keratin, type I cytoskeletal 13 Proteins 0.000 description 3
- 101000614439 Homo sapiens Keratin, type I cytoskeletal 15 Proteins 0.000 description 3
- 102100040487 Keratin, type I cytoskeletal 13 Human genes 0.000 description 3
- 102100040443 Keratin, type I cytoskeletal 15 Human genes 0.000 description 3
- 241001330975 Magnaporthe oryzae Species 0.000 description 3
- 101001077374 Oryza sativa subsp. japonica UMP-CMP kinase 3 Proteins 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000010367 cloning Methods 0.000 description 3
- 238000012217 deletion Methods 0.000 description 3
- 230000037430 deletion Effects 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 230000003993 interaction Effects 0.000 description 3
- 230000008659 phytopathology Effects 0.000 description 3
- 238000002864 sequence alignment Methods 0.000 description 3
- 101150084750 1 gene Proteins 0.000 description 2
- 240000002582 Oryza sativa Indica Group Species 0.000 description 2
- 240000008467 Oryza sativa Japonica Group Species 0.000 description 2
- 150000001413 amino acids Chemical class 0.000 description 2
- 239000000427 antigen Substances 0.000 description 2
- 108091007433 antigens Proteins 0.000 description 2
- 102000036639 antigens Human genes 0.000 description 2
- 208000027697 autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency Diseases 0.000 description 2
- 230000000680 avirulence Effects 0.000 description 2
- 238000003766 bioinformatics method Methods 0.000 description 2
- 239000003153 chemical reaction reagent Substances 0.000 description 2
- 235000013305 food Nutrition 0.000 description 2
- 238000012215 gene cloning Methods 0.000 description 2
- 238000011081 inoculation Methods 0.000 description 2
- 230000007774 longterm Effects 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 244000052769 pathogen Species 0.000 description 2
- 230000001717 pathogenic effect Effects 0.000 description 2
- 238000012552 review Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 108010054576 Deoxyribonuclease EcoRI Proteins 0.000 description 1
- 241000282326 Felis catus Species 0.000 description 1
- 230000002776 aggregation Effects 0.000 description 1
- 238000004220 aggregation Methods 0.000 description 1
- 244000052616 bacterial pathogen Species 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000011109 contamination Methods 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000010429 evolutionary process Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000003780 insertion Methods 0.000 description 1
- 230000037431 insertion Effects 0.000 description 1
- 238000011835 investigation Methods 0.000 description 1
- 230000001788 irregular Effects 0.000 description 1
- 238000003976 plant breeding Methods 0.000 description 1
- 108091033319 polynucleotide Proteins 0.000 description 1
- 239000002157 polynucleotide Substances 0.000 description 1
- 102000040430 polynucleotide Human genes 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a technical system with inclusion and accurate identification and excavation of a functional gene of a broad-spectrum durable disease-resistant gene cluster of rice blast Pi2/Pi 9. The technical system sets a three-level detection marker according to the clear three-level differentiation of 'haplotype-sub-haplotype-functional gene' and the like in the gene family. The technical system can be used for identifying and excavating the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster, and has systematic and strict inclusion and comparability. But also is suitable for the identification and excavation of disease-resistant genes of other various plant disease systems in the condition of ubiquitous disease-resistant gene clusters, and has remarkable openness and universality. Can be widely applied to improving the purpose and efficiency of the utilization of the germplasm resources of gramineous crops including but not limited to rice, improving the purpose and efficiency of the work of breeding for disease resistance, improving the reasonable layout of disease-resistant varieties and prolonging the service life of the disease-resistant varieties.
Description
Technical Field
The invention belongs to the technical field of agricultural biology, and particularly relates to a technical system which has inclusiveness and can accurately identify and mine a disease-resistant gene cluster of rice blast Pi2/Pi 9.
Background
Rice is one of the most important food crops in the world, and rice blast caused by Pyricularia oryzae (Pyricularia oryzae) is one of the most serious obstacles to rice production, and a large amount of food loss is caused every year. From the viewpoint of environmental protection and sustainable agricultural development, the breeding and utilization of disease-resistant varieties are the safest and effective methods for preventing and treating rice blast. Traditional rice breeding for disease resistance relies on direct identification of resistance phenotype of breeding materials, which not only requires that breeders have abundant inoculation and investigation experiences, but also is easily influenced by environment and human factors, the identification result is easy to cause errors, and the selection efficiency of target genes, especially the aggregation of similar target genes, is very low or even impossible. With the development of molecular marker identification technology, the application value and the prospect of the technology are more and more concerned due to the advantages of accuracy, reliability, no influence of environment and the like. In plant breeding, by developing molecular markers closely linked with target genes, particularly developing molecular markers with functional specificity in genes, the reliability of selection of the target genes is high, and the purposiveness and efficiency of breeding work are greatly accelerated.
Generally, in the course of 'arms race' where host plant disease-resistant genes and pathogen avirulence genes are long, the disease-resistant genes generate new disease-resistant specificities in the form of 'multiple allele families' or 'gene clusters' (gene clusters) with the lowest evolution cost to keep pace with the rapid variation of avirulence genes. That is, under long-term and strong selective pressure of pathogenic bacteria, the above-mentioned 'gene cluster' generally causes functional/non-functional haplotype (haplotype) differentiation; if the gene cluster is a broad-spectrum durable resistance gene cluster which is used for a long time in a breeding plan, the gene cluster can be further differentiated into different sub-haplotypes (sub-haplotypes) in the functional haplotypes; in the sub-haplotype, the gene was further differentiated into functional genes (functional resistance genes) with different disease resistance specificities (Zhai et al 2011, new Phytologist, 189.
Significant and clear nucleotide polymorphisms, including Single Nucleotide Polymorphisms (SNPs) and polynucleotide polymorphisms (i.e., insertions/deletions, indels), are present in the three-stage evolutionary processes of "haplotype-sub-haplotype-functional genes", etc. Herein, SNPs and InDel within functional genes are collectively referred to as functional nucleotide polymorphisms. Therefore, on one hand, the disease-resistant genes identified by different antigen varieties are often gathered in the same gene cluster, and on the other hand, the broad-spectrum persistent antigen varieties usually have functional disease-resistant genes in a plurality of gene clusters at the same time. Taking the rice blast resistance gene as an example, among more than 100 major genes reported so far, at least 40% are believed to be alleles of known genes or even the same gene; these genes mainly cluster in gene clusters of rice chromosomes 1 (Pi 37 cluster), 2 (Pib cluster), 6 (Pi 2/Pi9 cluster), 8 (Pi 36 cluster), 9 (Pii cluster), 11 (Pik cluster) and 12 (Pita cluster), wherein the gene clusters of chromosomes 6, 11 and 12 are the main sources of broad-spectrum persistent resistance genes (Sharma et al 2012, agricultural Research 1-37 and Wang 2016, national Science Review 3.
As described above, the Pi2/Pi9 gene cluster located in the juxtamellar region of chromosome 6 is a broad spectrum persistent source of resistance for broad applications in global rice breeding programs (Liu and Wang 2016, national Science Review 3, 295-308, wu et al 2016, molecular Breeding, 36. So far, 6 disease-resistant genes are sequentially separated and cloned in the gene cluster: pi9 (Qu et al.2006, genetics, 172; pi2, piz-t (Zhou et al 2006, molecular Plant-Microbe Interactions, 19; pi50 (Su et al 2015, the clinical and Applied Genetics, 128; pigm (Deng et al 2017, science, 355; pizh (actually Piz-t; xie et al 2019, philophilal Transactions of The Royal Society B Biological Sciences, 374. In order to utilize the broad-spectrum persistent source gene in rice breeding programs, researchers developed a series of molecular markers [ Pi2 (Alam et al 2015, proceedings of the National Academy of Science of India, section B, biological Science, 9; pi9 (Scheuermann and Jia 2016, phytopathology, 106; pi2, pi9 (Tian et al 2016, rice, 9; pi9, pi2, piz-t, pigm (Tian et al 2020, plant Disease,104: 1932-1938) to improve its utilization efficiency.
Since the Pi2/Pi9 gene cluster is an important broad-spectrum source of resistance in rice breeding programs for Disease resistance subsequent to the Pik allele family, and is being widely used (Tian et al 2020, plant Disease,104:1932-1938, xiao et al 2020, rice,13, 6, zhou et al 2020, rice, 13), under the continuous and strong selective pressure of Magnaporthe oryzae, complex and diverse variations are generated at the level of three-level evolution such as "haplotype-sub-haplotype-functional gene". However, none of these research results has resulted in a workable technical system that can be widely applied in production practice. In other words, the research results of the disease-resistant gene molecular marker are almost developed in a scattered way aiming at specific sites of specific genes, and have no clear comparability and logicality. For complex genomic regions, complex gene clusters, the 3 outstanding and realistic problems that arise from this are: (1) Any molecular marker which is not designed based on the evolution hierarchy is difficult to identify in a complex genome region, a complex gene cluster is easy to generate sequencing errors and the like; (2) Any molecular marker which is not designed based on the evolution level is difficult to avoid the problem of false positive of the marker due to the technical limitation of the molecular marker (the same specific fragment/site does not represent that the test variety contains the gene completely consistent with the target gene); (3) Any molecular marker which is not designed based on the evolution hierarchy is difficult to form a technical system with inclusion and comparability, so that new genes are continuously mined, identified and named in a complex gene cluster, and the problems of 'allele', 'heteronym homonym', 'homonym heterogene' and 'true and false target gene' which are easily generated in the complex gene cluster are identified.
Disclosure of Invention
The object of the present invention is to overcome the above mentioned prior artThe method has the defects of providing a set of technical system which has inclusiveness and can accurately identify and mine the disease-resistant gene cluster of the rice blast Pi2/Pi 9. The technical system sets a three-level detection marker according to the clear three-level differentiation of 'haplotype-sub-haplotype-functional gene' and the like in the gene family; the optimal haplotype specific molecular marker combination for functional haplotype/non-functional haplotype detection is Pi2/9-F/N P/A(933～1239) And Pi2/9-F/N P /A(3808～4033) (ii) a The optimal sub-haplotype specific molecular marker combination detected by the sub-haplotype (Pi 2/zt, pi50/gm, pi9, piz) of the functional haplotype is Pi2/zt/z-SubH A2726G/T ,Pi2/zt/50/gm-SubH C6739A ,Pi9/z-SubH C7793T (ii) a The optimal target gene specific molecular marker combination detected by the broad spectrum persistent resistance gene Pi2 of the functional haplotype Pi2/zt sub-haplotype is Pi2 CAG7902TGT/CGT And Pi2 T7992G (ii) a The optimal target gene specific molecular marker for detecting the broad-spectrum durable resistance gene Piz-t of the Pi2/zt sub-haplotype of the functional haplotype is Pi2/zt GAC7905TTC/TTA And Pizt/50/gm TG8028CT (ii) a The optimal target gene specific molecular marker combination for the Pi50/gm detection of the resistance gene Pi50/Pigm of the functional haplotype sub-haplotype is Pi50/gm A7746G And Pi50/gm G8626C (ii) a The optimal target gene specific molecular marker combination for detecting the broad spectrum persistent resistance gene Pi9 of Pi9 sub-haplotype of functional haplotype is Pi9 T7257C And Pi9/z T6709G (ii) a Pi9/z is the optimal target gene specific molecular marker combination for Piz detection of the novel resistance gene Piz of the functional haplotype Piz sub-haplotype T6709G And Piz A7099G (ii) a The identification result of any detection mark which is not qualified by the technical system is not the corresponding target gene, so that the detection mark is inferred to be a possible new gene of the gene cluster.
The second purpose of the invention is to provide a method for comparing the sequences of the disease-resistant gene clusters of rice blast Pi2/Pi9 and identifying the specific sequences thereof.
The third objective of the invention is to provide a functional/non-functional haplotype-specific molecular marker of a rice blast Pi2/Pi9 disease-resistant gene cluster and an identification method thereof.
The fourth object of the present invention is to provide a sub-haplotype (Pi 2/zt, pi50/gm, pi9, piz) specific molecular marker of the functional haplotype of the Pi2/Pi9 disease-resistant gene cluster and a method for identifying the same.
The fifth object of the present invention is to provide a specific molecular marker for the broad-spectrum persistent resistance gene Pi2 of Pi2/zt sub-haplotype which is a functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster and a method for identifying the same.
The sixth object of the present invention is to provide a specific molecular marker for the broad-spectrum persistent resistance gene Piz-t of Pi2/zt sub-haplotype which is a functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster and a method for identifying the same.
The seventh object of the present invention is to provide a specific molecular marker for the broad-spectrum persistent resistance gene Pi50/Pigm which is a Pi50/gm sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster described above and a method for identifying the same.
An eighth object of the present invention is to provide a molecular marker specific to the Pi9 sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster, and a method for identifying the gene.
The ninth purpose of the present invention is to provide the development and application of the specific molecular markers for identifying the unclosed broad-spectrum durable resistance gene Piz from the rice blast Pi2/Pi9 disease-resistant gene cluster by using the technical system which has the advantages of inclusiveness, accurate identification and excavation of the functional genes of the gene cluster
The tenth purpose of the present invention is to provide the application and examples of the above-mentioned technical system for identifying and mining functional genes of pesti-rice Pi2/Pi9 disease-resistant gene cluster by screening true and false specific genomic regions and SNPs from the gene cluster.
The eleventh purpose of the invention is to provide the application and the example for identifying and mining the new and old functional genes from the unknown rice seed resource population by utilizing the technical system which has the advantages of compatibility and accurate identification and mining of the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster.
The twelfth object of the present invention is to provide the application and examples of the above-mentioned technical system for screening "alleles" (Pi 2/Piz-t) of rice seed resources from rice seed resources by using the functional genes of Pi2/Pi9 disease-resistant gene cluster.
The thirteenth purpose of the present invention is to provide the application and examples of the above-mentioned technical system for screening the rice blast Pi2/Pi9 disease-resistant gene cluster from rice seed resources by using the "synonym syngeneic gene" (Pi 50/Pigm) existing in the gene cluster.
The fourteenth purpose of the invention is to provide application and an example of screening the homologous heterogenous gene [ Piz (Fukunishiki)/Piz (IRBLz-Fu) ] existing in the rice plant source by utilizing the technical system which has the advantages of inclusion and accurate identification and excavation of the functional gene of the rice blast Pi2/Pi9 disease-resistant gene cluster.
The fifteenth aim of the invention is to provide an example for comparing the identification capability of the technical system which has the advantages of compatibility and accurate identification and mining of the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster with that of other marker systems.
The purpose of the invention is realized by the following technical scheme (a technical route diagram is shown in figure 1):
the invention provides a method for comparing the sequences of rice blast Pi2/Pi9 disease-resistant gene clusters and identifying specific sequences (figures 2-10). Wherein,
the sequences of the rice blast Pi2/Pi9 disease-resistant gene cluster of 9 sequencing reference varieties were retrieved and downloaded from public databases such as the National Center of Biotechnology Information (NCBI; http:// www.ncbi.nlm.nih.gov), wherein the NCBI accession numbers of the genomic sequences (between ATG-TGA; the same throughout) of the 5 rice blast Pi2/Pi9 disease-resistant gene cluster functional genes that have been isolated and cloned are:
Pi2:DQ352453.1；
Piz-t:DQ352040.1；
Pi50:KP985761.1；
Pigm:KU904633.2；
Pi9:DQ285630.1。
for the convenience of sequence alignment analysis, 4 genome sequences corresponding to sequencing reference susceptible varieties Nipponbare (NPB), yongqing (Hitomebore, HTM), shennong265 (Shennong 265, SN265) and Suijing18 (Suijing 18, SJ 18) are added;
sequence comparison analysis is carried out by a bioinformatics method, and the result shows that,
(1) In the Pi2/Pi9 disease-resistant gene cluster, there is great sequence diversity among varieties/members, but there is still clear haplotype (also called haplotype) differentiation between functional genes/non-functional genes (typical positions are shown as markers # 1 and #2, and additional markers #17 and # 18);
(2) In the functional haplotypes of the Pi2/Pi9 disease-resistant gene cluster, there is further obvious sub-haplotype differentiation (typical positions are shown as marks # 3 to # 5);
(3) All 5 functional family members of the Pi2/Pi9 disease-resistant gene cluster have function-specific SNPs (typical positions are shown as markers # 6 to # 14).
The present invention provides a specific molecular marker of functional/non-functional haplotype of Pi2/Pi9 disease-resistant gene cluster and its identification method (FIG. 3). Wherein,
(1) Design of haplotype-specific molecular markers: according to the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, aiming at the genome region with clear functional/non-functional haplotype differentiation, a pair of P/A markers with optimal haplotype specificity is developed: #1, pi2/9-F/N P/A(933～1239) And #2, pi2/9-F/N P/A(3808～4033) ；
Description of the labeling: #1 and #2, the numbering of the markers; F/N, functional/non-functional; P/A, presence (presence; target genotype)/absence (absence; non-target genotype); 933-1239, meaning # 933-1239 genome segment, and so on;
(2) 18 different types of test varieties were examined, and thus they were classified into 2 types of genotypes (haplotypes) as follows:
functional haplotype variety: CK1, C101a51; CK2, IRBLz5-CA; CK3, tide 1; CK4, IRBLzt-T; CK5, nib-e1; CK6, gumeiiao 4; CK7,75-1-127; CK8, IRBL9-M; CK9, fukunishiki;
non-functional haplotype variety: CK10, IRBLz-Fu; CK11, nipponbare; CK12, shennong 265; CK13, suijing 18; CK14, sasanishiki; CK15, koshihikari; CK16, shin 2; CK17, aichi Asahi; CK18, fujisaka 5;
in particular, the sequence of CK7 and CK8 containing Pi9 is seriously incorrect and should be a functional haplotype variety completely different from a non-functional haplotype variety such as Nipponbare; while non-functional haplotype varieties can be excluded from subsequent testing.
Specification of test varieties: the information of the 18 reference varieties is as described above, and if necessary, the details of the following information are omitted.
The present invention provides specific molecular markers of sub-haplotypes of functional haplotypes of the Pi2/Pi9 disease-resistant gene cluster and methods for their identification (FIG. 4). Wherein,
(1) Designing a sub-haplotype specific molecular marker: based on the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, the optimal 3 SNPs (A2726G/T, C6739A, C7793T) are selected to be designed as a sub-haplotype specific molecular marker combination, namely #3, pi2/zt/z-SubH A2726G/T ；#4,Pi2/zt/50/gm-SubH C6739A ； #5,Pi9/z-SubH C7793T ；
Description of the labeling: the gene symbol is italicized and represents a functional gene; the gene symbol is a body, and represents a haplotype or a sub-haplotype; with Pi2/zt/z-SubH A2726G/T For example, a common sub-haplotype-specific SNP for Pi2/Piz-t/Piz is meant; subH, sub-haplotype; and so on;
(2) The 9 functional haplotype test varieties were tested using the marker combinations described above, and all the known 6 functional genes (Piz containing an unclosed gene; the same applies throughout) in the gene cluster were classified into the following 4 types of genotypes (sub-haplotypes):
pi2/zt sub-haplotype variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
pi50/gm sub-haplotype variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
pi9 sub-haplotype variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
piz sub-haplotype variety: CK9, fukunishiki (Piz);
in particular, piz is an uncloneable gene with the same SNP #2726A as Pi 2/Piz-t; pi50/Pigm #6739A is a sequencing error, which should be #6739C; pi50/Pigm #7793T is a sequencing error and should be #7793C.
The present invention provides a specific molecular marker of Pi2/zt sub-haplotype broad-spectrum persistent resistance gene Pi2 of functional haplotype of Pi2/Pi9 disease-resistant gene cluster and its identification method (FIG. 5). Wherein,
(1) Design of Pi 2-specific molecular markers: according to the comparison result of the Pi2/Pi9 disease-resistant gene cluster sequences, selecting the optimal 2 SNPs to be designed as a Pi2 functional specificity molecular marker combination: #6, pi2 CAG7902TGT/CGT (upper band, non-target gene; lower band, target gene) and #7,Pi2 T7992G (upper band, non-target gene; lower band, target gene);
(2) The results of the tests on the 9 functional haplotype samples indicated that all of the 2 Pi 2-specific molecular markers could distinguish Pi2 from all known functional genes in the gene cluster:
the target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2);
non-target gene variety: CK3, tolide 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeiiao 4 (PigmR); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz);
in particular, #7992T from Piz-T is a sequencing error and should be #7992G.
The present invention provides specific molecular markers of Pi2/zt sub-haplotype broad-spectrum persistent resistance gene Piz-t of functional haplotype of Pi2/Pi9 disease-resistant gene cluster and its identification method (FIG. 6). Wherein,
(1) Design of Piz-t specific molecular markers: according to the result of the alignment of the Pi2/Pi9 disease-resistant gene cluster sequences, no SNP specific to the target gene Piz-t is found, but an optimal combination is obtained(GAC 7905TTC/TTA, TG8028 CT) but can distinguish the target gene Piz-t from all functional genes in the gene cluster; the two are combined into a specific molecular marker of Piz-t: #8, pi2/zt GAC7905TTC/TTA (upper band, non-target gene; lower band, target gene); #9, pizt/50/gm TG8028CT (upper band, non-target gene; lower band, target gene);
(2) The results of the detection of the 9 functional haplotype test varieties show that the Piz-t specific molecular marker combination can distinguish the Piz-t from all known functional genes in the gene cluster:
the target gene variety: CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz);
in particular, #7905TTC from Piz-t is a sequencing error and should be #7905GTC; pi50/Pigm, #8028CT, is a sequencing error and should be #8028TG.
The present invention provides specific molecular markers of Pi50/gm sub-haplotype broad-spectrum persistent resistance gene Pi50/Pigm of functional haplotype of Pi2/Pi9 disease-resistant gene cluster and its identification method (FIG. 7). Wherein,
(1) Design of Pi50/Pigm specific molecular marker: according to the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, 2 optimal SNPs (A7746G, G8626C) are selected and designed into a Pi50/Pigm functional specific molecular marker combination: #10, pi50/gm A7746G (upper band, target gene; lower band, non-target gene) and #11, pi50/gm G8626C (upper band, target gene; lower band, non-target gene);
(2) The results of the tests on the 9 functional haplotype test varieties show that the 2 Pi50/Pigm specific molecular markers can distinguish the Pi50/Pigm from all known functional genes in the gene cluster:
the target gene variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz);
in particular, pi50/Pigm is a "synonym" (see example 12 below for details).
The present invention provides specific molecular markers of Pi9 sub-haplotype of functional haplotype of Pi2/Pi9 disease-resistant gene cluster and the identification method thereof (FIG. 8). Wherein,
(1) Design of Pi 9-specific molecular markers: based on the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, the optimal 2 SNPs (T6709G, T7257C) are selected and designed as Pi9 specific molecular marker combination: #12,Pi9 T7257C (upper band, non-target gene; lower band, target gene) and #13,Pi9/z T6709G (upper band, non-target gene; lower band, target gene);
(2) The results of the tests on the 9 functional haplotype samples indicated that the Pi9 specific molecular marker combination can distinguish Pi9 from all known functional genes in the gene family:
the target gene variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK9, fukunishiki (Piz).
The invention provides development and application of a specific molecular marker for identifying an unclosed broad-spectrum durable resistance gene Piz from a gene cluster by utilizing the technical system which has the advantages of inclusiveness, accurate identification and excavation of the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster (figure 9). Wherein,
(1) Design of Piz-specific molecular markers: because the target gene Piz is not separated and cloned, the Pi2/Pi9 disease-resistant gene cluster sequence can not be compared. But according to the identification result of the technical system on the haplotype and the sub-haplotype of the Pi2/Pi9 disease-resistant gene cluster and 5 known functional genes, piz is found to belong to the Piz sub-haplotype of the functional haplotype; among them, 2 SNPs related to the target gene Piz (T6709G, A709)9G) (ii) a It was designed as Piz-specific molecular marker combination: pi9/z T6709G (upper band, non-target gene; lower band, target gene) and Piz A7099G (upper band, target gene; lower band, non-target gene);
(2) The results of the detection of the 9 functional haplotype test varieties show that the Piz specific molecular marker combination can distinguish the Piz from all known functional genes of the gene family:
a target gene: CK9, fukunishiki (Piz);
non-target genes: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9).
In particular, piz is an uncloneable gene, with the same SNP #6709T as Pi9; piz A7099G For its specific molecular marker, but still needs to be related to haplotype, sub-haplotype and function-specific marker Pi9/z T6709G And (5) making comprehensive judgment.
The invention provides an example of screening true and false specific genome regions and SNPs from a rice blast Pi2/Pi9 disease-resistant gene cluster by utilizing the technical system which is inclusive and can accurately identify and mine the functional genes of the gene cluster (figure 10). Wherein,
(1) In the detection of functional haplotype/non-functional haplotype, it was found that there was a serious error in the sequence of CK7 and CK8 containing Pi9, both of which were functional haplotype varieties completely different from non-functional haplotype varieties such as Nipponbare;
(2) In the detection of the target gene Piz-t, the #7905TTC of the Piz-t is found to be sequencing error and should be #7905GTC; pi50/Pigm, #8028CT, is also a sequencing error and should be #8028TG.
In particular, since the Pi2/Pi9 disease-resistant gene cluster is located in the near-centromere region of the rice chromosome 6, the overall sequencing quality is not high, resulting in a large number of sequencing errors in the whole gene cluster (see the example analysis below for details).
This example demonstrates the rigorous comparability and error correction capability of the present technology system, which is one of the advantages over the conventional marking technology.
The invention provides an example of identifying and mining new and old functional genes from unknown rice seed resource groups by utilizing the technical system which has the advantages of compatibility, accurate identification and mining of the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster (figure 11). Wherein,
(1) The test varieties comprise: 8 Pi2/Pi9 disease-resistant gene cluster functional gene carriers serve as a control variety (CK 1-8); CK1, C101a51 (Pi 2); CK2, tolide 1 (Piz-t); CK3, nib-e1 (Pi 50); CK4, gumeizao 4 (Pigm = Pi 50); CK5,75-1-127 (Pi 9); CK6, IRBL9-M (Pi 9); CK7, fukunishiki (Piz); CK8,2561 (Piz); CV1-15 is old indica rice variety; CV16-30 is a modern indica rice variety; CV31-45 is an ancient japonica rice variety; CV46-60 is a modern japonica rice variety (ZHai et al 2011, new phytologist,189, 321-334, hua et al 2012, theor Appl Genet 125:1047-1055, chai et al.2012, rice, in press);
(2) Identification of functional/non-functional haplotypes of the Pi2/Pi9 disease-resistant gene cluster (FIG. 11 a): of the 60 test varieties, 12 functional haplotype varieties (red marker): CV14, CV18, CV21, CV22, CV27, CV28, CV29, CV30, CV49, CV52, CV59, CV60; the remaining 48 were non-functional haplotype varieties (black markers) and were excluded from the subsequent assays.
(3) Identification of the sub-haplotype of the Pi2/Pi9 disease-resistant gene cluster (FIG. 11 b): of the 12 functional haplotype test varieties,
5 were Pi2/zt sub-haplotype varieties (red marker): CV28, CV29, CV30, CV52, CV59;
1 were Pi50/gm sub-haplotype varieties (blue marker): CV60;
pi9 sub-haplotype variety (green marker): none;
6 were Piz sub-haplotype varieties (light blue indication): CV14, CV18, CV21, CV22, CV27, CV49;
(4) Identification of Pi2/Pi9 disease-resistant gene cluster functional genes: among the 12 functional haplotype test varieties,
the target gene Pi2 carries the breed (red designation; FIG. 11 c): CV28, CV29, CV30;
the target gene Piz-t carries the variety (blue designation; FIG. 11 d): CV52, CV59;
the target gene Pi50/Pigm carrying variety (green designation; FIG. 11 e): CV60;
the gene of interest Pi9 carries the breed (light blue designation; FIG. 11 f): none;
the target gene Piz carries the variety (light red mark; FIG. 11 g): none;
the unknown novel gene Piz-MWZ carries a variety (purple designation; fig. 11 a-g): CV14;
the new gene Piz-TFB is unknown for carrying varieties (purple designation; fig. 11 a-g): CV18, CV21, CV22, CV27, CV49.
Specifically, the results of the detection of tertiary markers such as haplotype-sub-haplotype-functional genes are individually labeled with independent color series.
Since the genotypes of the newly discovered 2 unknown new genes are different from those of the known 6 functional genes (containing Piz), they are also different from each other, and thus, they are named as Piz-MWZ (Maweizhan, CV 14) and Piz-TFB (tianfeng b, CV 27), respectively.
The example demonstrates that the technical system has strong inclusion and comparability, because 6 Piz sub-haplotype varieties are excavated through haplotype and sub-haplotype analysis under the condition that Piz is not separated from clone; then, by comparing a series of genotypes of known functional gene specific markers in the system, the 6 Piz sub-haplotype varieties are identified to contain no known functional gene Piz and belong to 2 types of new genes Piz-MWZ and Piz-TFB of the Piz sub-haplotype.
The invention provides an example of screening alleles (Pi 2/Piz-t) of rice seed resources by utilizing the technical system which has the advantages of inclusiveness, accurate identification and mining of rice blast Pi2/Pi9 disease-resistant gene cluster functional genes (figure 5,6,12). Wherein,
(1) Previous cloning studies showed that Pi2/Piz-t is the allele of this gene cluster, both [ Pi2 (CK 1, 2); piz-t (CK 3, 4) ] differs by only 8 amino acids (Zhou et al.2006, molecular Plant-Microbe Interactions,19, 1216-1228) and is concentrated within genomic regions #7902 to #8029 (fig. 5,6);
(2) In the technical system, 2 haplotype-specific markers are used for identifying 18 reference varieties, and the results show that the two carried varieties have no difference and are functional haplotype varieties (figure 12 a);
(3) In the technical system, 3 sub-haplotype specific markers are used for identifying 9 functional haplotype reference varieties, and the result shows that the two carried varieties have no difference (figure 12 b);
(4) In the technical system, the identification example of 9 functional haplotype reference varieties based on a marker developed by Pi2 specific SNP shows that the #7905TTC of Piz-t is sequencing error and should be #7905GTC (FIG. 6; FIG. 12 c);
(5) In the technical system, the identification example of 9 functional haplotype reference varieties based on a marker developed by Piz-t specific related SNP shows that the #8028CT of Pi50/Pigm is sequencing error and is #8028TG, and the Piz-t is not different from Pi50/Pigm but is different from Pi2 (FIG. 6; FIG. 12 d);
(6) In this technical system, the identification of 9 functional haplotype reference varieties based on markers developed for Pi2/Pi50/Pigm specific SNP showed that the SNP of Pi2 (CAG) with Piz-t (TGT) and Pi50/Pigm (CGT) was true at the #7902 site, which is the Pi2 specific SNP (FIG. 5; FIG. 12 e);
(7) In the technical system, the identification example of 9 functional haplotype reference varieties based on a marker developed by Pi2/Piz-T specific SNP indicates that #7992T of Piz-T is sequencing error and should be #7992G, and Pi2 is different from Pi50/Pigm and Piz-T, and the site is actually Pi2 specific SNP (FIG. 5; FIG. 12 f);
(8) In particular, the identification of 5 functional genes and 3 non-functional genes with markers developed for Pi2/Piz-t specific Indel (7919) revealed that the Indel (7919) for Pi2 was a sequencing error, was identical and was not deleted, but differed from the other functional and non-functional genes (deletion; FIG. 12 f);
in summary, the technical system has systematic and strict inclusion, comparability and error correction capability, and avoids the problem of original dataOr a false positive made with reference to a sequence error. In particular, what really enables to identify Pi2/Piz-t is a specific molecular marker developed on the basis of 1 correct and 2 incorrect original data or reference sequence SNPs: pi2 CAG7902TGT /CGT ,Pi2 T7992G ,Pizt/50/gm TG8028CT (FIG. 12).
The present invention provides an example of screening the rice seed source for the existence of "synonym homogenes" (Pi 50/Pigm) of rice blast disease Pi2/Pi9 disease-resistant gene cluster by using the above-mentioned technical system which has the advantages of compatibility and accurate identification and mining of functional genes of the gene cluster (FIG. 13). Wherein,
(1) A set of technical systems with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 disease-resistant gene cluster functional genes are provided, and the comprehensive results show that the two [ Pi50 (CK 5)/Pigm (CK 6) ] in the technical system have no difference, but can be combined through the common specific molecular markers (Pi 50/gm) A7746G , Pi50/gm G8626C ) Clearly distinguished from other functional genes of the gene cluster (FIGS. 13 a-g);
(2) Molecular markers developed based on unique specific sequences between Pi50/Pigm (Pi 50/Pigm) Indel(5031) ) The identification of 6 known functional genes of the Pi2/Pi9 disease-resistant gene cluster revealed no differences between all functional genes of the gene cluster, and the specific sequence was due to sequencing errors (FIG. 13 h).
In conclusion, the technical system has systematic and strict inclusion, comparability and error correction capability. Specifically, the results of a series of specific molecular marker tests show that the two are really 'heteronymous syngeneic genes'.
The invention provides an example of screening the rice seed resources for the existence of the homologous heterogeneous gene [ Piz (Fukunishiki)/Piz (IRBLz-Fu) ] of the rice blast Pi2/Pi9 disease-resistant gene cluster by utilizing the technical system which has the advantages of compatibility and accurate identification and excavation of the functional genes of the gene cluster (FIG. 14). Wherein,
(1) As described above, piz is a functional gene in the gene cluster that has not been isolated and cloned. Of the 18 reference cultivars, CK9 (Fukunishiki, piz donor cultivar) has an affinity pedigree relationship with CK10 (IRBLz-Fu; piz monogenic line developed by Fukunishiki), both carriers of Piz (Tsunematsu et al 2000, breeding Sci, 50.
(2) However, the results of identifying 18 reference varieties by using 2 haplotype specific markers show that CK9 is the same as other functional genes of the gene cluster and belongs to functional haplotype varieties; CK10 is different from other functional genes in the gene cluster and belongs to a non-functional haplotype variety (FIG. 14 a);
(3) To confirm the above results, 2 haplotype-specific additional markers were selected to identify 18 reference varieties, which showed that there was still a difference between them, CK9 still belongs to functional haplotype varieties and the latter are still confirmed as non-functional haplotype varieties (FIG. 14 b);
(4) To further confirm whether CK9 is a carrier of Piz, 9 functional haplotype varieties were identified using 2 Piz function-specific molecular markers, and the results showed that CK9 indeed contains the functional gene Piz of this gene cluster (FIG. 9.
(5) To further confirm whether the test material was contaminated, CK9 was compared with CK10 from 2 different sources and the results showed that CK9 was indeed the same as "CK10 stock" but different from the contaminated CK10 (fig. 14 d).
In summary, the technology system has systematic and strict inclusion, comparability and error correction capability. Specifically, the results of a series of specific molecular marker tests indicate that CK9 and "CK10 protospecies" are carriers of Piz, and "CK10 promiscuous" is not a carrier of Piz (may contain other disease-resistant genes). In conclusion, both carry indeed "homonymous foreign genes".
The present invention provides an example of comparison of the discrimination ability of the above-mentioned technical system with other marker systems, which has the advantages of inclusion, accurate discrimination and excavation of functional genes of rice blast Pi2/Pi9 disease-resistant gene cluster (FIGS. 11 and 15). Wherein,
(1) As described above, the rice blast Pi2/Pi9 resistance gene cluster is the most important broad-spectrum persistent resistance source, and scientists develop specific markers for 1-2, and at most 4 functional genes to improve their utilization efficiency [ Pi2 (Alam et al 2015, proceedings of the National Academy of Science of India, section B, biological Science, 9; pi9 (Scheuuermann and Jia 2016, phytopathology,106:871-876, zhou et al 2020, rice, 13; pi2, pi9 (Tian et al.2016, rice, 9; pi9, pi2, piz-t, pigm (Tian et al 2020, plant Disease, 104;
(2) From the above-mentioned main references, the most recent and discriminative other marker system (Tian et al 2020, plant Disease, 104. The results show that compared with other marking systems (including other marking systems, the same applies below), the technical system of the invention has the following outstanding and definite innovation and beneficial effects:
(a) Functional/non-functional haplotype analysis is carried out by utilizing the primary marker, and clear functional haplotype boundaries are marked for the subsequent excavation and identification of functional genes. In this example, 48 non-functional haplotype varieties were removed from 60 rice resources to be tested, and only 12 functional haplotype varieties were subsequently detected and analyzed (FIG. 11), thereby greatly improving the efficiency of the work (5 times), and greatly reducing the interference of genetic background caused by the drastic differentiation of functional/non-functional haplotype sequences, so that the detection effect is clearer. This is one of the incomparable benefits of any other marker detection system;
(b) The secondary marker is used for carrying out the sub-haplotype analysis of the functional haplotype variety, and further, clear sub-haplotype boundaries are marked for the subsequent identification of each functional gene. In this example, the 12 functional haplotype varieties were further divided into 4 sub-haplotypes, with CV 28-30, CV52, CV59 divided into Pi2/zt sub-haplotype varieties; CV60 is Pi50/gm sub-haplotype variety; CV14,18,21,22,27,49 is a Piz sub-haplotype variety; no Pi9 sub-haplotype variety was present (FIG. 15-a 1). This is also one of the incomparable benefits of any other marker detection system.
(c) The pair of tertiary markers is used for functional gene analysis of the sub-haplotypes of the functional haplotype varieties, and clear functional gene boundaries are marked for the identification of each functional gene. In this example, a pair of optimal functional specificity marker combinations were selected for each of 5 functional genes (Pi 50= Pigm, as described above, for 1 gene), and were aligned independently of each other to constitute a set of stringent discrimination systems. This is also one of the incomparable benefits of any other marker detection system.
Comparative example 1 (type of assay System) As described above, the technical system of the present invention consists of three-stage assay markers such as "haplotype-submonoid-functional gene". Because the gene is matched with the evolution track and the mode of a target gene family, and openly comprises the function specific genome region and SNP of a main functional gene, each mark is independent and has strong inclusion, strict logic and accurate comparability. This enables the discrimination of true and false specific genomic regions and SNPs resulting from the sequencing errors, and "synonym genes", "homonym heterogenous genes", or "true and false genes" resulting from the lack of stringency of the marker detection system. In other marker systems, only known and few target genes are detected, and the method has no inclusiveness, logicality and comparability and is not used for carrying out mining and identification work except the target genes. Therefore, the technical system of the present invention has systematic and strict discrimination capability and error correction capability. Undoubtedly, the technology system of the present invention has more powerful, wide and accurate detection capability.
Comparative example 2 (type of marker) in the technical system of the present invention, all markers were function-specific molecular markers developed in the coding regions of the respective reference functional genes; in other marker systems, only one marker is of the same type, and the other 2 markers are molecular markers developed outside the coding region. Undoubtedly, our labels are more function specific and accurate. In addition, in order to improve the reliability of the detection of the target gene with severe differentiation of the genome region, the technical system of the present invention constructs a multi-primer PCR detection system (# 7 marker; FIG. 15-a 2) to avoid the situation that the individual sample cannot be detected as in the other marker systems (FIG. 15-b 2).
Comparative example 3 (excavation of novel Gene) in the technical system of the present invention, 6 species such as CV14 were classified into Piz sub-haplotype (FIG. 15-b 1); however, the results of a series of functional gene analyses showed that none of the 6 varieties was a carrier of Piz, but rather a carrier of its alleles [ Piz-MWZ (CV 14); piz-TFB ( CV 18,21,22,27,49); FIGS. 15-a 2-6. On the other hand, in the other marker system, since the system is not inclusive and comparable, the target genes detected in the original literature do not include Piz and Pi50, and thus, the 6 varieties similar to the CK7 and CK8 genotypes were neither inferred to be carriers of functional genes nor identified to be carriers of 2 Piz alleles, unlike the 4 established target genes (Pigm, pi9, pi2, piz-t) (fig. 15-b1 to 3). Undoubtedly, our detection results are more inclusive, comparable, and accurate.
Comparative example 4 (identification of known genes) CV52,59 was inferred to be the carrier of Piz-t gene of Pi2/zt subploidy in the technical system of the present invention, and the results of 2-level detection were clear and consistent (FIGS. 15-a 1-6). In the other marker system, CV52 was judged to be a carrier of Piz-t and CV59 was judged to be a carrier of unknown genes, because the detection markers were not hierarchical and logical (FIGS. 15-b1 to 3). Undoubtedly, the results of our detection are more logical and rigorous.
And (4) conclusion: the present invention has the above-mentioned innovations and advantages that are not comparable to any other mark detection system.
The technical system which has the advantages of inclusion and can accurately identify and mine the functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster has important application value: the technology system can realize the accurate identification of Pi2/Pi9 disease-resistant gene cluster functional genes of a large number of gramineous plants including but not limited to rice germplasm resources and breeding materials thereof without any genome sequence information and inoculation identification information, and simultaneously excavate novel functional genes with higher application value. Therefore, the method plays an irreplaceable role in the application aspects of improving the purpose and the efficiency of the utilization of plant germplasm resources, improving the purpose and the efficiency of disease-resistant breeding work, improving the reasonable layout of disease-resistant varieties, prolonging the service life of the disease-resistant varieties and the like.
Compared with the prior art, the invention has the following outstanding innovations and beneficial effects:
(1) Different from the general molecular marker patent technology, the technical system of the invention is only aimed at the detection of specific target genes, and consists of three-level detection markers such as 'haplotype-sub-haplotype-functional genes' and the like, so that clear 'functional haplotype limit-sub-haplotype limit-functional gene limit' is respectively marked for the excavation and identification of subsequent functional genes, and each detected object is defined in clear and logical layers and limits. Therefore, the method realizes the open full coverage of the detection object, and further realizes the excavation, identification and utilization of the unknown germplasm resource group under the conditions of no genome sequence information, no resistance identification information and no genetic transformation. In the case described in the examples of the present invention, 12 varieties were selected from only 60 randomly selected rice germplasm resources, each of which contained a functional target gene, and 6 varieties contained 2 new types of Piz alleles (Piz-MWZ, piz-TFB). Thus, the technical system of the present invention has definite openness and inclusiveness.
(2) Unlike the general molecular marker patent technology, the technology system of the present invention is composed of three-level detection markers, i.e., "haplotype-sub-haplotype-functional gene", and the like, and is used for detecting only the DNA polymorphism of the specific genomic region of the target gene. The marker is fit with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNPs, and each marker is independent and has strict logicality. This enables the discrimination of true and false specific genomic regions and SNPs resulting from the sequencing errors. In the cases described in the examples of the present invention, most of the functional specific markers were developed and identified from the specific genomic regions and SNPs that were sequenced incorrectly. Therefore, the technical system of the present invention has systematic and strict sequence error correction capability.
(3) Different from the general molecular marker patent technology, the invention only aims at the detection of one or a few SNPs in the specific genome region of a target gene, and the technical system of the invention consists of three-level detection markers of 'haplotype-sub-haplotype-functional gene' and the like. The marker is matched with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. Therefore, the accurate discrimination of the 'synonym isogene', 'homonym heterogene' or 'true and false gene' generated by the marker detection system in an irregular and non-strict way is realized. Therefore, the technical system of the present invention has strict and powerful identification and error correction capability.
(4) The complex disease-resistant cluster is a result of long-term co-evolution of host plants and pathogens which commonly exist in various plant disease systems, so that the idea and the technical means which are composed of three-level detection markers such as haplotype-sub-haplotype-functional genes are also suitable for the excavation and identification of disease-resistant genes of other plant disease systems, and have remarkable openness and universality even in the metagenome era of massive information. In other words, even if the genome has huge amount of genome information, any ordinary molecular marker patent technology does not have the capability of inclusively and accurately identifying and mining complex disease-resistant cluster functional genes without the idea and technical means of the technical system of the present invention.
Drawings
FIG. 1 is a set of schematic diagrams for the development and application of a technical system for the accurate identification and mining of functional genes of Pi2/Pi9 disease-resistant gene clusters.
FIG. 2. Sequence comparison of Pi2/Pi9 disease-resistant gene cluster and identification of its specific sequence. Wherein,
the gene accession numbers of 5 cloned functional genes such as Pi2, piz-t, pi50, pigm, pi9 and the like at NCBI are respectively as follows: DQ352453.1, DQ352040.1, KP985761.1, KU904633.2, DQ285630.1; for the convenience of sequence alignment analysis, 4 genome sequences corresponding to sequencing reference susceptible varieties Nipponbare (NPB), yongqing (Hitomebore, HTM), shennong265 (Shennong 265, SN265) and Suijing18 (Suijing 18, SJ 18) are added;
all validated haplotypes, sub-haplotypes and specific genomic regions or SNPs of functional genes have been numbered (in order of marker usage) and are labeled in green (see FIGS. 2-10 for details).
In particular, since the above 9 reference sequences have been disclosed, the figure shows only the first one thereof in the following "drawings of the specification" in order to fully understand the specific sequence of the Pi2/Pi9 disease-resistant gene cluster and its marker information in conjunction with FIGS. 3 to 10.
FIG. 3 development and application of functional/non-functional haplotype-specific molecular markers of Pi2/Pi9 disease-resistant gene cluster family
3a-b 2 haplotype-specific optimal genomic regions;
functional haplotype variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz);
non-functional haplotype variety: CK10, IRBLz-Fu (Pi 2/9 null); CK11, nipponbare (Pi 2/9 null); CK12, shennong265 (Pi 2/9 null); CK13, suijing18 (Pi 2/9 null); CK14, sasanishiki (Pi 2/9 null); CK15, koshihikari (Pi 2/9 null); CK16, shin 2 (Pi 2/9 null); CK17, aichi Asahi (Pi 2/9 null); CK18, fujisaka 5 (Pi 2/9 null); m, DL-500;
description of the symbols I: #1 and #2, the numbering of the markers; F/N, functional/non-functional; P/A, presence (presence; target genotype)/absence (absence; non-target genotype); 933-1239, means # 933-1239 genome segment, and so on (same below).
Description of varieties to be tested: the information of the 18 reference varieties is as described above, and if not necessary, it is not repeated herein.
In particular, the sequence of CK7 and CK8 containing Pi9 should be a functional haplotype sequence completely different from the non-functional haplotype sequence such as Nipponbare due to a serious error; whereas non-functional haplotype varieties were excluded from the subsequent tests.
FIG. 4 development and application of sub-haplotype specific molecular markers for functional haplotypes of Pi2/Pi9 disease-resistant gene cluster
4 a-c, 3 sub-haplotype specific optimal SNPs;
4d a set of sub-haplotype specific markers [ 3, pi2/zt/z-SubH A2726G/T (lower band is target genotype); #4, pi2/zt/50/gm-SubH C6739A (lower band is the target genotype); #5, pi9/z-SubH C7793T (upper band is the target genotype) identification of 9 functional haplotype reference varieties, wherein,
pi2/zt sub-haplotype variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
pi50/gm sub-haplotype variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
pi9 sub-haplotype variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
piz sub-haplotype variety: CK9, fukunishiki (Piz).
Description of the symbols II: the gene symbol is italicized and represents a functional gene; the gene symbol is a body, and represents a haplotype or a sub-haplotype; with Pi2/zt/z-SubH A2726G/T For example, a common sub-haplotype-specific SNP for Pi2/Piz-t/Piz is meant; subH, sub-haplotype; so on (the same below);
in particular, piz is an uncloneable gene with the same SNP #2726A as Pi 2/Piz-t; pi50/Pigm #6739A is a sequencing error, which should be #6739C; pi50/Pigm #7793T is a sequencing error and should be #7793C.
FIG. 5 development and application of functional specific molecular markers of Pi2/zt sub-haplotype broad-spectrum persistent resistance gene Pi2 of functional haplotype of Pi2/Pi9 disease-resistant gene cluster
5a, 2 optimal SNPs with Pi2 function specificity;
5b CAG7902TGT/CGT (upper band, non-target gene; lower band, target gene) and #7,Pi2 T7992G (upper band, non-target gene; lower band, target gene) identification examples of 9 functional haplotype reference varieties, wherein,
the target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2);
non-target gene variety: CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
In particular, #7992T from Piz-T is a sequencing error and should be #7992G.
FIG. 6 development and application of broad-spectrum durable resistance gene Piz-t specific molecular marker of Pi2/zt sub-haplotype of functional haplotype of Pi2/Pi9 disease-resistant gene cluster
6a, 1 optimal SNP functionally specific to Pi 2/zt;
6b, 1 optimal SNP with Pizt/Pi50/gm functional specificity;
6c GAC7905TTC/TTA (upper band, non-target gene; lower band, target gene) and #9, pizt/50/gm TG8028CT (upper band, non-target gene; lower band, target gene) 9 examples of the identification of functional reference varieties, in which,
the target gene variety: CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
In particular, #7905TTC from Piz-t is a sequencing error, which should be #7905GTC; pi50/Pigm, #8028CT, is a sequencing error and should be #8028TG.
FIG. 7 is the development and application of Pi50/Pigm specific molecular markers for the functional haplotype of the Pi2/Pi9 disease-resistant gene cluster and the Pi50/gm sub-haplotype of the disease-resistant gene
7 a;
7b A7746G (upper band, target gene; lower band, non-target gene) and #11, pi50/gm G8626C (upper band, target gene; lower band, non-target gene) 9 examples of the identification of functional reference varieties, wherein,
the target gene variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
Specifically, both are "heterologous syngeneic genes" (see example 12 below for details).
FIG. 8 development and application of broad-spectrum persistent resistance gene Pi 9-specific molecular markers for Pi9 sub-haplotype of functional haplotypes of Pi2/Pi9 disease-resistant gene clusters
8b, 1 optimal SNP with Pi9/Piz function specificity;
the target gene variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK9, fukunishiki (Piz).
FIG. 9 development and application of specific molecular marker for identifying unclosed broad spectrum persistent resistance gene Piz from rice blast Pi2/Pi9 disease-resistant gene cluster by using the technical system with inclusiveness, accurate identification and excavation of functional genes of the gene cluster
a target gene: CK9, fukunishiki (Piz);
non-target genes: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9).
Specifically, piz is an uncloneable gene, with SNP #6709T identical to Pi9; piz A7099G Is a specific molecular marker.
FIG. 10 is a diagram showing an example of screening true and false specific genomic regions and SNPs from a rice blast Pi2/Pi9 disease-resistant gene cluster using the above-mentioned system for identifying and mining functional genes of the gene cluster
10a of the optimal genome region with haplotype specificity of 1 Pi2/Pi9 disease-resistant gene cluster;
10b haplotype-specific markers [ 1, pi2/9-F/N ] developed based on the optimal genomic region P /A(933～1239) (ii) a A banding, target genotype; no band, non-target genotype ] identifies 18 reference species, and the result shows that the CK7 and CK8 sequences containing Pi9 are seriously wrong and are functional haplotype sequences completely different from non-functional haplotype sequences such as Nipponbare and the like;
10c, 1 Pi2/Pizt function-specific optimal SNP;
10d, 1 optimal SNP of Pizt/Pi50/Pigm function specificity;
10e functional specific markers developed based on the 2 SNPs described above [ 8,Pi2/zt ] GAC7905TTC/TTA (upper band, non-target gene; lower band, target gene) and #9, pizt/50/gm TG8028CT (upper band, non-target gene; lower band, target gene) results of the identification examples of 9 functional haplotype reference varieties indicate that the #7905TTC of Piz-t is sequencing error and should be #7905GTC; pi50/Pigm #8028CT is alsoSequencing error, should be #8028TG.
FIG. 11 is a diagram showing an example of identifying and mining new and old functional genes from an unknown rice seed resource population by using the above-mentioned technical system for identifying and mining functional genes of Pi2/Pi9 disease-resistant gene cluster with inclusion and precision
11a, identification of functional/non-functional haplotypes of the Pi2/Pi9 disease-resistant gene cluster, wherein,
CK1,C101A51(Pi2)；CK2,Toride 1(Piz-t)；CK3,Nib-e1(Pi50)；CK4, Gumeizao 4(Pigm＝Pi50)；CK5,75-1-127(Pi9)；CK6,IRBL9-M(Pi9)；CK7, Fukunishiki(Piz)；CK8,2561(Piz)；
CV1-60 is conventional rice germplasm resources (Zhai et al 2011, new Phytologist, 189; hua et al 2012, the or Appl Genet 125, chai et al 2012, rice, in press). Wherein, the 12 functional haplotype varieties are: CV14, maweizhan (MWZ); CV18, shufeng 101; CV21, xianhui 297; CV22, lu28S; CV27, tianfeng B (TFB); CV28, R217; CV29, gui R215; CV30, gui R231; CV49, jinghu B; CV52, pino.4; CV59, NPB-Pizt; CV60, NPB-Pita2;
11b, identification of a sub-haplotype of a functional haplotype of the Pi2/Pi9 disease-resistant gene cluster, wherein,
pi2/zt sub-haplotypes: CV28 to 30, CV52,59;
pi50/gm haplotypes: CV60;
pi9 sub-haplotype: none;
piz sub-haplotype: CV14,18,21,22,27,49;
11c-g identification of 3 known disease-resistant genes of 3 sub-haplotypes of the functional haplotype of the Pi2/Pi9 disease-resistant gene cluster and 2 novel disease-resistant genes,
pi2 carries the breed: CV28 to 30;
piz-t carrying variety: CVs 52,59;
pi50/Pigm carries the breed: CV60;
novel Piz-MWZ carries cultivars: CV14;
novel Piz-TFB carries the species: CV18,21,22,27,49;
particularly, under the condition that Piz is not separated and cloned, 6 Piz sub-haplotype varieties are excavated through haplotype and sub-haplotype analysis; however, by comparing a series of genotypes with known functional gene specificity markers in the system, it was identified that none of the 6 Piz sub-haplotype varieties contains the known functional gene Piz, but belongs to the 2 types of new genes Piz-MWZ and Piz-TFB of the Piz sub-haplotype.
FIG. 12 is an example of identifying alleles (Pi 2/Piz-t) present in rice seed resources by using the above-described system for identifying and mining functional genes of rice blast Pi2/Pi9 disease-resistant gene clusters with inclusion. Wherein,
12a for the identification examples of 18 reference varieties with 2 haplotype-specific markers, the results indicated that both [ Pi2 (CK 1, 2); piz-t (CK 3, 4) ] is not different;
12c identification example of 9 functional haplotype reference varieties based on marker developed by Pi2 specific SNP, the result shows that the #7905TTC of Piz-t is sequencing error and should be #7905GTC;
12d identification example of 9 functional haplotype reference varieties based on marker developed by Piz-t specific SNP, the result shows that #8028CT of Pi50/Pigm is sequencing error, should be #8028TG, piz-t has no difference with Pi50/Pigm, but has difference with Pi2;
12e identification example of 9 functional haplotype reference varieties based on markers developed for Pi2/Pi50/Pigm specific SNP, which indicates that Pi2 (CAG) differs from Piz-t (TGT) and Pi50/Pigm (CGT) at the #7902 site, which is Pi2 specific SNP;
12f, identification examples of 9 functional haplotype reference varieties based on markers developed by Pi2/Piz-T specific SNP, wherein the results show that #7992T of Piz-T is sequencing error and should be #7992G, and the difference between Pi2 and Pi50/Pigm as well as Piz-T is actually Pi2 specific SNP;
12g identification of 5 functional genes and 3 non-functional genes, in particular, by markers developed for Pi2/Piz-t specific Indel (7919), showed that the Pi2 Indel (7919) was a sequencing error, was identical and was not deleted, but differed from the other functional and non-functional genes. And (4) conclusion:
(a) In a complex gene cluster or gene family, judgment cannot be made only by depending on 1 or a few specific markers, particularly under the condition of low sequencing quality;
(b) Accurate judgment can be made according to the comprehensive results through a set of technical system which has inclusiveness and accurately identifies and excavates the rice blast Pi2/Pi9 disease-resistant gene cluster functional genes.
FIG. 13 is an example of screening rice seed resources for the presence of "heteronymous and homogeneous genes" (Pi 50/Pigm) of a rice blast disease Pi2/Pi9 disease-resistant gene cluster using the above-described system for identifying and mining functional genes of the gene cluster. Wherein,
13a-g, a technical system which has inclusiveness and accurately identifies and excavates disease-resistant gene clusters of the rice blast Pi2/Pi9, and the result shows that the two [ Pi50 (CK 5)/Pigm (CK 6) ] have no difference in the technical system;
13h identification of 6 known functional genes of Pi2/Pi9 disease-resistant gene cluster based on molecular markers developed based on unique specific sequences between Pi2/Pigm, which indicates that the specific sequences are sequencing errors, i.e. there is no difference between all functional genes of the gene cluster.
And (4) conclusion: both are indeed "heterologous syngeneic" (Pi 50= Pigm).
FIG. 14 is a diagram showing an example of screening a rice seed source for the presence of a "homonymous foreign gene" [ Piz (Fukunishiki)/Piz (IRBLz-Fu) ] of a rice blast Pi2/Pi9 disease-resistant gene cluster using the above-mentioned system for identifying and exploring functional genes of the gene cluster. Wherein,
14a, 2 haplotype-specific markers, and the results show that the two (CK 9/CK 10) are different from each other, wherein the former is a functional haplotype variety, and the latter is a non-functional haplotype variety;
14b, 2 haplotype-specific additional markers for 18 reference varieties, the results show that the two varieties still have difference, wherein the former is a functional haplotype variety, and the latter is a non-functional haplotype variety. That is, the latter does not contain functional genes of Pi2/Pi9 disease-resistant gene cluster;
14c and 2 Piz function-specific molecular markers identify 6 known functional genes of a Pi2/Pi9 disease-resistant gene cluster, and the result shows that CK9 really contains the functional genes Piz of the gene cluster.
14d to further confirm whether the test material was contaminated, CK9 was compared with CK10 from 2 different sources, and the results showed that CK9 was indeed the same as "CK10 stock" but different from "CK10 contaminated" (FIG. 14 d).
In summary, the technology system has systematic and strict inclusion, comparability and error correction capability. Specifically, the results of a series of specific molecular marker tests indicate that CK9 and "CK10 protospecies" are carriers of Piz, and "CK10 promiscuous" is not a carrier of Piz (may contain other disease-resistant genes). In summary, the CK9 and CK10 confounders tested carried indeed "homonymous foreign genes".
FIG. 15 is an example of comparison of the discrimination ability of the technical system for identifying and mining functional genes of rice blast Pi2/Pi9 disease-resistant gene cluster with other marker systems by using the above-mentioned set of systems. Wherein,
15a 1-6, the technical system of the invention identifies the sub-haplotypes of 12 functional haplotype varieties (as shown in FIG. 4) of 60 rice seed resources and 6 functional genes;
15b 1-3 identification of 12 functional haplotype varieties ( CV 14,18,21,22,27-30,49,52,59,60) of 60 rice seed resources by a Square marker system (Tian et al.2020, plant Disease, 104; novel disease resistance genes, purple marker.
In particular, the target genes detected by the other marker system in the original literature do not include Piz and Pi50, and thus, the 6 varieties similar to CK7 and CK8 genotypes are all different from the 4 established target genes (Pigm, pi9, pi2, piz-t), and therefore, it cannot be inferred that they are carriers of functional genes, nor identified as carriers of 2 Piz functional genes (strikethrough designation).
The breed information is as described above with reference to fig. 11.
Detailed Description
The invention is further described in the following description with reference to the figures and specific examples, which are intended to illustrate the invention and are not intended to limit the scope of the invention. Unless otherwise specified, the test methods used in the following examples are conventional methods; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
All rice varieties used in the examples: CK 1-18 (as described above); and CV1-60 are collected, stored, and commonly used in the research field and have been disclosed in, including but not limited to, the above-mentioned documents [ ZHai et al 2011, new Phytologist 189, 321-334, https:// nph.onlinezoliry.willey.com; hua et al.2012, the or Appl Genet 125:1047-1055, https:// www.springer.com/journal/122; chai et al 2021, rice, https:// thericejournal. Springopen. Com (published); annex charts are available at the respective magazine web sites.
The technical route diagram developed and applied by the patent is shown in figure 1.
Example 1 sequence comparison of the Rice blast Pi2/Pi9 disease-resistant Gene Cluster and identification of its specific sequence (FIGS. 2 to 10)
1. Experimental method
5 genomic sequences of the cloned functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster are searched and downloaded from the public databases of the national center for biotechnology information and the like,
the NCBI accession number for Pi2 is: DQ352453.1;
the NCBI accession number for Piz-t is: DQ352040.1;
the NCBI accession number for Pi50 is: KP985761.1;
the NCBI accession number for Pigm is: KU904633.2;
pi9 has NCBI accession number: DQ285630.1.
For the convenience of sequence alignment analysis, 4 genome sequences corresponding to the reference pathogenic strains Nipponbare (NPB), shennong265 (Shennong 265, SN265) and Suijing18 (SJ 18) were added.
The range of the individual genes ATG-TAG is annotated with reference to NCBI.
Sequence comparison analysis was performed by conventional bioinformatics methods.
2. Results of the experiment
The results of the sequence comparison are shown in FIGS. 2 to 10, and show that:
(1) Genomic differentiation of the Pi2/Pi9 disease-resistant gene cluster with obvious functional haplotypes (Pi 2, piz-t, pi50, pigm, pi 9) and non-functional haplotypes (NPB, HTM, SN265, SJ 18) in sequence (typical positions are shown as markers # 1 and #2, and additional markers #17 and #18 in FIG. 3);
(2) The sequence of the Pi2/Pi9 disease-resistant gene cluster further shows the differentiation of obvious sub-haplotypes (Pi 2/zt, pi50/gm, pi9, piz) in the functional haplotype (typical positions are shown as the marks # 3-5 in FIG. 4);
(3) Functional genes (including not-yet-cloned Piz) of the Pi2/Pi9 disease-resistant gene cluster all have functional specific SNPs and combinations thereof (typical positions are shown as markers # 6 to #14 in the marker maps 5 to 9).
In particular, the sequence of the Pi2/Pi9 disease-resistant gene cluster has serious genome-specific regions and SNP errors (described below).
In addition, since the above 9 reference sequences have been disclosed, FIG. 2 shows only the first one thereof in the "drawings of the specification" in order to fully understand the specific sequences of the Pi2/Pi9 disease-resistant gene cluster and the labeling information thereof in conjunction with FIGS. 3 to 10.
Example 2: development and application of functional/non-functional haplotype specific molecular markers of Pi2/Pi9 disease-resistant gene cluster (FIG. 3)
1. Experimental methods
The experimental procedure of this example is mainly described in the papers published by the applicant (Yuan et al 2011, the door Appl Genet 122.
The following references are the same as those described above and need not be repeated.
Briefly described, the following steps:
(1) Design of haplotype-specific molecular markers: according to the comparison result of the Pi2/Pi9 disease-resistant gene cluster sequences, aiming at the genome region with clear functional/non-functional haplotype differentiation, a Primer design software Primer 5.0 is used for designing a P/A (presence/absence) mark. The primer sequences are as follows:
for the #1 marker (band, with functional gene; no band, without functional gene):
SEQ ID NO.1(Pi2/9-F/N P/A(933～1239) -F；5’-3’)：
GCTGCTGCCGACGAGACCAG；
SEQ ID NO.2(Pi2/9-F/N P/A(933～1239) -R；5’-3’)：
AGGGGCTTTGTTGCTTAACATAT。
for the #2 marker (band, with functional gene; no band, without functional gene):
SEQ ID NO.3(Pi2/9-F/N P/A(3808～4033) -F；5’-3’)：
GGTCAAAATTAACATCAAACTGGG；
SEQ ID NO.4(Pi2/9-F/N P/A(3808～4033) -R；5’-3’)：
GATAGTGTTTATTTTACGTCTGTTT。
the labeling instructions are as described above.
(2) Detection of haplotype-specific molecular markers: and carrying out PCR amplification on the 18 rice reference varieties by using the group of primers. The PCR amplification system (20.0. Mu.L) was as follows:
[ the following PCR amplification System is the same as that described above, and is not repeated therein ]
The PCR amplification conditions were: pre-denaturation at 94 ℃ for 3min, followed by 30-40 cycles (generally 35 cycles, which can be adjusted as appropriate depending on the subject of detection) of PCR amplification [94 ℃ for 30sec for denaturation, annealing for 30sec (# 1/62 ℃, #2/55 ℃), extension at 72 ℃ for 30sec ], and finally extension at 72 ℃ for 5min, the PCR product being stored in a refrigerator at 4 ℃ for further use.
[ except for the annealing temperature, the following PCR amplification conditions are the same as those described above, and are not repeated
0.25. Mu.L of the PCR product was added with 0.25. Mu.L of ddH 2 O and 5 mu L of 10x loading are mixed evenly, 1.5 to 2 mu L of product is taken by a microsyringe and electrophoresed on 8 to 12 percent modified polyacrylamide gel (250V, 20 to 120 min), and then the molecular marker is photographed and recorded according to the conventional detection method.
[ the following molecular marker detection procedures are the same as those described above, and are not repeated therein ]
2. Results of the experiment
The sizes of the molecular markers are shown in FIG. 3, and the results show that 18 tested varieties present clear genotypes (haplotypes):
functional haplotype variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz);
non-functional haplotype variety: CK10, IRBLz-Fu (Pi 2/9 null); CK11, nipponbare (Pi 2/9 null); CK12, shennong265 (Pi 2/9 null); CK13, suijing18 (Pi 2/9 null); CK14, sasanishiki (Pi 2/9 null); CK15, koshihikari (Pi 2/9 null); CK16, shin 2 (Pi 2/9 null); CK17, aichi Asahi (Pi 2/9 null); CK18, fujisaka 5 (Pi 2/9 null); m, DL-500.
In particular, the sequence of CK7 and CK8 containing Pi9 is seriously incorrect and should be a functional haplotype completely different from the non-functional haplotype such as Nipponbare (see example 10 below for details). While CK10 with Piz originally belongs to a functional haplotype as its donor CK9 (Fukunishiki), the detection result is a non-functional haplotype, and thus the error of "homonymy" may be caused by seed contamination (see example 13 below).
In the subsequent detection and identification, the test varieties CK 10-18 having non-functional haplotypes are deleted.
Example 3 development and application of sub-haplotype specific molecular markers for functional haplotypes of the Pi2/Pi9 disease-resistant Gene Cluster (FIG. 4)
1. Experimental methods
(1) Designing a sub-haplotype specific molecular marker: according to the comparison result of the Pi2/Pi9 disease-resistant gene cluster sequences, aiming at the SNP with clear sub-haplotype of functional haplotype, according to the design principle of CAPS and dCAPS (derived decentralized acquired and aggregated genetic sequences; neff et al 2002, trends in Genetics 18; then, the marker design was confirmed by using Primer design software Primer 5.0.
The following molecular markers and primer design procedures are the same as those described above and are not repeated herein.
The primer sequences are as follows:
for the #3 marker (upper band, pi50/gm/9; lower band, pi 2/zt/z):
SEQ ID NO.5(Pi2/zt/z-SubH A2726G/T -F；5’-3’)：
CAGAATATGCCATCGAATACGCGCTGCTTT；
SEQ ID NO.6(Pi2/zt/z-SubH A2726G/T -R；5’-3’)：
CGGACGGATGACGACGGCACGACTGA。
for the #4 marker (upper band, pi9; double band, pi 2/zt/50/gm/z):
SEQ ID NO.7(Pi2/zt/50/gm-SubH C6739A -F；5’-3’)：
TGTCAGAATGGGAGAAATTCTATGTGCA；
SEQ ID NO.8(Pi2/zt/50/gm-SubH C6739A -R；5’-3’)：
TACCTACTAGACGATTCCTTTTGATTTCAA。
for the #5 marker (upper band, pi9/z; double band, pi 2/zt/50/gm):
SEQ ID NO.9(Pi9/z-SubH C7793T -F；5’-3’)：
GCAATCAAAGAGCTGGGGCAGTTAAGCATG；
SEQ ID NO.10(Pi9/z-SubH C7793T -R；5’-3’)：
GAGGGAAGAGAGCTTCTCAATGGCTGCAT。
(2) Detection of sub-haplotype specific molecular markers: using the 3 sets of primers, 9 functional haplotype rice samples were PCR amplified according to the PCR amplification system (annealing temperature: #3/64 ℃, #4/56 ℃, #5/60 ℃) and the products were stored in a 4 ℃ refrigerator for future use.
The PCR product was taken out and cleaved with restriction enzymes Nla III (# 3), apa LI (# 4), and Sph I (# 5), respectively, in the following reaction system (10.0. Mu.L):
and (3) after enzyme digestion is carried out for 5 hours at 37 ℃,10 mu L of 10x loading is added into each tube of enzyme digestion product and is mixed uniformly, and the enzyme digestion sample is subjected to electrophoresis detection, photographing and recording based on polyacrylamide gel according to the experimental procedures.
The following restriction enzyme system of PCR amplification product (except the restriction enzyme temperature of Taq I is 65 ℃ and the other is 37 ℃), which is not repeated herein
2. Results of the experiment
The sizes of the molecular markers are shown in FIG. 4, and the results show that 9 test varieties present 4 clear genotypes (sub-haplotypes):
pi2/zt sub-haplotype variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
pi50/gm sub-haplotype variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
pi9 sub-haplotype variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
piz sub-haplotype variety: CK9, fukunishiki (Piz).
The labeling instructions are as described above;
in particular, piz is an uncloneable gene with the same SNP #2726A as Pi 2/Piz-t; pi50/Pigm #6739A is a sequencing error, which should be #6739C; pi50/Pigm #7793T is a sequencing error and should be #7793C.
Example 4: development and application of broad-spectrum persistent resistance gene Pi 2-specific molecular marker of Pi2/zt sub-haplotype of functional haplotype of Pi2/Pi9 disease-resistant gene cluster (FIG. 5)
1. Experimental methods
(1) Design of Pi 2-specific molecular markers: according to the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, the optimal 2 SNPs (CAG 7902TGT/CGT, T7992G) are selected to be designed into a Pi2 functional specific molecular marker Pi2 CAG7902TGT/CGT And Pi2 T7992G The primer sequences are as follows:
for the #6 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.11(Pi2 CAG7902TGT/CGT -F；5’-3’)：
TCGACAAAGGAAAAATGTAAGATACTT；
SEQ ID NO.12(Pi2 CAG7902TGT/CGT -R；5’-3’)：
AGTAGGGGAGGAGGAGATGAA。
for the #7 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.13(Pi2 T7992G -F1；5’-3’)：
TCTCCATGTGGATGCTGCAGA；
SEQ ID NO.14(Pi2 T7992G -F2；5’-3’)：
TCTCCATGTGGATGCTGTGGA；
SEQ ID NO.15(Pi2 T7992G -F3；5’-3’)：
TCTCTATGTGAATGCTGCGGA；
SEQ ID NO.16(Pi2 T7992G -R；5’-3’)：
GTTTTGAATACTAGCTTCTCCCCAAG。
in particular, since the #7 marker is located in a heavily differentiated region of the genome sequence, in order to ensure the stability and reliability of the detection result, the marker is subjected to PCR detection by combining 3 forward primers and 1 reverse primer.
(2) Detection of Pi 2-specific molecular markers: using the 2 sets of primers, PCR amplification was performed on 9 functional haplotype rice cultivars according to the PCR amplification system and the amplification conditions (annealing temperature: #6/62 ℃ and #7/50 ℃) and the products were stored in a refrigerator at 4 ℃ for future use.
Taking out the PCR product, and performing enzyme digestion by using restriction enzymes PstI (# 6) and Eco RI (# 7) respectively according to the enzyme digestion system; and performing electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedures.
2. Results of the experiment
The size of each molecular marker is shown in fig. 5, and the results show that 2 Pi 2-specific molecular markers can distinguish the target gene from all known functional genes in the gene family:
the target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2);
non-target gene variety: CK3, tolide 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
In particular, #7992T from Piz-T is a sequencing error and should be #7992G.
Example 5: development and application of broad-spectrum durable resistance gene Piz-t specific molecular marker of Pi2/zt sub-haplotype of functional haplotype of Pi2/Pi9 disease-resistant gene cluster (FIG. 6)
1. Experimental methods
(1) Design of Piz-t specific molecular markers: based on the results of the above comparison of the Pi2/Pi9 disease-resistant gene cluster family sequences, no SNP specific to the target gene was found, but 2 optimal SNP combinations (GAC 7905TTC/TTA, TG8028 CT) were selected, and the Piz-t specific molecular marker Pi2/zt was designed according to the above-mentioned procedure GAC7905TTC/TTA And Pizt/50/gm TG8028CT . The primer sequences are as follows:
for the #8 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.17(Pi2/zt GAC7905TTC/TTA -F；5’-3’)：
GATACTTTATGCAGCCATTGAG；
SEQ ID NO.18(Pi2/zt GAC7905TTC/TTA -R；5’-3’)：
TAGAATCTAGGCACTCAAGTGT。
for the #9 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.19(Pizt/50/gm TG8028CT -F；5’-3’)：
ATGCCTAACTGGATTGAGCAGCTCG；
SEQ ID NO.20(Pizt/50/gm TG8028CT -R；5’-3’)：
AGATGAAGGACCATGAGGTTGGGCAGT。
(2) Detection of Piz-t specific molecular markers: using the above 2 sets of primers, PCR amplification was performed on 9 functional haplotype rice test varieties according to the above PCR amplification system and amplification conditions (annealing temperature: #8/56 ℃ and #9/62 ℃) and the products were stored in a 4 ℃ refrigerator for future use.
Taking out the PCR product, and performing enzyme digestion by using restriction enzymes HinfI (# 8) and Apa LI (# 9) according to the enzyme digestion system; and carrying out electrophoresis detection, photographing and recording on the enzyme digestion sample based on polyacrylamide gel according to the experimental procedures.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 6, and the results show that the specific molecular marker combination can distinguish the target gene from all known functional genes in the gene family:
the target gene variety: CK3, tolide 1 (Piz-t); CK4, IRBLzt-T (Piz-T);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
In particular, #7905TTC from Piz-t is a sequencing error, which should be #7905GTC; pi50/Pigm, #8028CT, is a sequencing error and should be #8028TG.
Example 6: development and application of Pi50/Pigm specific molecular marker for resistance gene Pi50/gm of functional haplotype of Pi2/Pi9 disease-resistant gene cluster (FIG. 7)
1. Experimental method
(1) Pi50/Pigm specificDesigning the anisotropic molecular marker: according to the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, the optimal 2 SNPs (A7746G, G8626C) are selected to be designed as Pi50/Pigm specific molecular marker Pi50/gm A7746G And Pi50/gm G8626C . The primer sequences are as follows:
for the #10 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.21(Pi50/gm A7746G -F；5’-3’)：
TGCAGGTTCTAGAGTATGTAGATATCC；
SEQ ID NO.22(Pi50/gm A7746G -R；5’-3’)：
GAAGAGAGCTTCTCAATGGCTG。
for the #11 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.23(Pi50/gm G8626C -F；5’-3’)：
CGAATGATAGGTCAGTCACTCTCTA；
SEQ ID NO.24(Pi50/gm G8626C -R；5’-3’)：
AGCTTGAGCTGTGCCTATCTCTT。
(2) Detection of Pi50/Pigm specific molecular markers: the above 2 sets of primers were used to perform PCR amplification on 9 functional haplotype rice cultivars according to the above PCR amplification system and amplification conditions (annealing temperature: #10/52 ℃ and #11/58 ℃) and the products were stored in a refrigerator at 4 ℃ for further use.
Taking out the PCR product, performing enzyme digestion by using restriction enzymes Hpa II (# 10) and Nla III (# 11) according to the enzyme digestion system, performing electrophoresis detection, photographing and recording on an enzyme digestion sample based on polyacrylamide gel according to the experimental program
2. Results of the experiment
The size of each molecular marker is shown in fig. 7, and the result shows that the specific molecular marker combination can distinguish the target gene from all known functional genes in the gene family:
the target gene variety: CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, tolide 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9); CK9, fukunishiki (Piz).
In particular, pi50/Pigm is a "synonym gene" (see example 13, below for details).
Example 7: development and application of broad-spectrum persistent resistance gene Pi 9-specific molecular marker of Pi9 sub-haplotype of functional haplotype of Pi2/Pi9 disease-resistant gene cluster (FIG. 8)
1. Experimental methods
(1) Design of Pi 9-specific molecular markers: according to the alignment result of the Pi2/Pi9 disease-resistant gene cluster sequences, the optimal 2 SNPs (T7257C, T6709G) are selected to be designed into a Pi9 specific molecular marker combination: pi9 T7257C And Pi9/z T6709G (ii) a The primer sequences are as follows:
for the #12 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.25(Pi9 T7257C -F；5’-3’)：
ATGGGAGATGGCTCTGATTTAGTT；
SEQ ID NO.26(Pi9 T7257C -R；5’-3’)：
GCACAACAATGCAATACGGTCG。
for the #13 marker (upper band, non-target gene; lower band, target gene):
SEQ ID NO.27(Pi9/z T6709G -F；5’-3’)：
ATGTGGTCGTCTACCATTAGCAA；
SEQ ID NO.28(Pi9/z T6709G -R；5’-3’)：
TCCAGGCTTGGGTTTATTTCTAGT。
(2) Detection of Pi 9-specific molecular markers: using the above 2 sets of primers, PCR amplification was performed on 9 functional haplotype rice samples according to the above PCR amplification system and amplification conditions (annealing temperature: #12/62 ℃ and #13/60 ℃) and the products were stored in a 4 ℃ refrigerator for future use.
Taking out the PCR product, performing enzyme digestion by using restriction enzymes XbaI (# 12) and Nla III (# 13) according to the enzyme digestion system, and performing electrophoresis detection, photographing and recording on an enzyme digestion sample based on polyacrylamide gel according to the experimental program.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 8, and the results show that the specific molecular marker combination can distinguish the target gene from all known functional genes in the gene family:
the target gene variety: CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9);
non-target gene variety: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, toride 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK9, fukunishiki (Piz).
Specifically, piz is an uncloneable functional gene, but has the same SNP as the Pi9 gene (# 6709T).
Example 8: the development and application of the specific molecular marker for identifying the uncloned broad-spectrum persistent resistance gene Piz from the rice blast Pi2/Pi9 disease-resistant gene cluster by utilizing the technical system which has the advantages of inclusion and accurate identification and excavation of the functional genes of the gene cluster (figure 9)
1. Experimental method
(1) Design of Piz-specific molecular markers: piz is a functional gene with unknown sequence which is not separated and cloned in a Pi2/Pi9 disease-resistant gene cluster. However, 2 SNP combinations (T6709G, A7099G) which are specifically related to the target gene Piz are still found in the technical system of the invention; it was designed as a Piz-specific molecular marker Pi9/z following the procedure described above T6709G And Piz A7099G . The primer sequences are as follows:
for #13 marker (as described above):
for the #14 marker (upper band, target gene; lower band, non-target gene):
SEQ ID NO.29(Piz A7099G -F；5’-3’)：
ATCAACCGAAGTATGATTCAACGA；
SEQ ID NO.30(Piz A7099G -R；5’-3’)：
TCAGAGCCATCTCCCATTGGTAC。
(2) Detection of Piz-specific molecular markers: using the above 2 sets of primers, PCR amplification was performed on 9 functional haplotype rice samples according to the above PCR amplification system and amplification conditions (annealing temperature: #13/60 ℃ and #14/57 ℃) and the products were stored in a 4 ℃ refrigerator for future use.
Taking out the PCR product, performing enzyme digestion by using restriction enzymes Nla III (# 13) and KpnI (# 14) according to the enzyme digestion system, and performing electrophoresis detection, photographing and recording on an enzyme digestion sample based on polyacrylamide gel according to the experimental program.
2. Results of the experiment
The sizes of the individual molecular markers are shown in FIG. 9, and the results show that the above-mentioned Piz-specific molecular marker combination can distinguish the target gene from all known functional genes of the gene family:
a target gene: CK9, fukunishiki (Piz);
non-target genes: CK1, C101a51 (Pi 2); CK2, IRBLz5-CA (Pi 2); CK3, tolide 1 (Piz-t); CK4, IRBLzt-T (Piz-T); CK5, nib-e1 (Pi 50); CK6, gumeizao 4 (Pigm); CK7,75-1-127 (Pi 9); CK8, IRBL9-M (Pi 9).
Specifically, piz is an uncloneable gene, with SNP #6709T identical to Pi9; piz A7099G Is a specific molecular marker.
Example 9: screening true and false specific genomic regions and SNP from the rice blast Pi2/Pi9 disease-resistant gene cluster by using the technical system with inclusion and accurate identification and mining of functional genes of the gene cluster (figures 3-10)
Because the Pi2/Pi9 disease-resistant gene cluster is located in the near-centromere region of the 6 th chromosome of rice, the overall sequencing quality is not high, so that a great number of sequencing errors exist in the whole gene cluster
1. Experimental methods
The technical system of the invention consists of 14 basic specific markers, which were developed and tested as described above (FIGS. 3 to 9; examples 2 to 8).
2. Results of the experiment
Specific genomic regions and true and false SNPs screened by the respective molecular markers are as described above, and a typical case is shown in fig. 10. As a result, it was revealed that the genomic regions of CK7 and CK8 containing Pi9 were significantly different from the functional haplotype sequence of Nipponbare and the like (FIGS. 10a to b); and #7905TTC of Piz-t is SNP error, should be #7905GTC; pi50/Pigm, #8028CT, also known as SNP error, should be #8028TG (FIGS. 10 c-e).
And (4) conclusion: the technical system of the invention consists of three-level detection markers of 'haplotype-sub-haplotype-functional gene' and the like. The gene is fit for the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNP, so that each marker is independent and has strict logicality. Therefore, the technology system of the present invention has systematic and strict sequence error correction capability.
Example 10: an example of identifying and mining new and old functional genes from an unknown rice seed resource population by using the technical system which has the advantages of inclusion and accurate identification and mining of functional genes of rice blast Pi2/Pi9 disease-resistant gene clusters (figure 11)
1. Experimental methods
(1) The technical system of the invention comprises 14 basic specific markers of three-level detection markers, such as 'haplotype-sub-haplotype-functional gene'. Wherein, the functional/non-functional haplotype and the sub-haplotype detection of the functional haplotype are advanced according to the sequence, and the subsequent detection of each functional gene has no sequence. The detection procedures and schemes of the whole technical system are as described above (fig. 3-9; examples 2-8), which are not repeated herein.
(2) Identifying and excavating Pi2/Pi9 disease-resistant gene cluster functional genes of 60 randomly selected rice seed resources (CV 1-60, zhai et al.2011, new phytologist,189, hua et al.2012, theor Appl Genet 125:1047-1055, chai et al.2012, rice, in press); the 8 functional gene-carrying varieties were used as reference varieties (as described above).
(3) The novel functional genes were isolated and cloned and sequenced using conventional PCR-based homologous gene cloning techniques (Zhai et al 2011, new Phytologist,189, hua et al 2012, the theor Appl Genet 125.
2. Results of the experiment
(1) In the primary marker-based functional haplotype/non-functional haplotype detection, 60 test species were classified as:
functional haplotype variety: 12 (as mentioned above)
Non-functional haplotype variety: 48 are provided
In particular, 48 non-functional haplotype varieties were excluded in the subsequent tests.
(2) In the secondary marker-based functional haplotype/non-functional haplotype detection, 12 functional haplotype varieties were further classified as:
5 Pi2/zt sub-haplotype varieties (red marker): CV28, CV29, CV30, CV52, CV59;
1 Pi50/gm sub-haplotype variety (blue marker): CV60;
6 Piz sub-haplotype varieties (light blue markers): CV14, CV18, CV21, CV22, CV27, CV49;
there is no Pi9 sub-haplotype variety (green marker).
(3) In the functional gene detection based on the tertiary marker, 12 functional haplotype test varieties are further identified as follows:
the target gene Pi2 carries the breed (red designation; FIG. 11 c): CV28, CV29, CV30;
the target gene Piz-t carries the variety (blue designation; FIG. 11 d): CV52, CV59;
the target gene Pi50/Pigm carrying variety (green designation; FIG. 11 e): CV60;
the gene of interest Pi9 carries the cultivar (light blue marker; FIG. 11 f): none;
the target gene Piz carries the variety (light red; FIG. 11 g): none;
the unknown novel gene Piz-MWZ carries a variety (purple designation; FIGS. 11 a-g): CV14;
the new gene Piz-TFB is unknown for carrying varieties (purple designation; fig. 11 a-g): CV18, CV21, CV22, CV27, CV49.
Specifically, the results of the three-level marker detection such as "haplotype-sub-haplotype-functional gene" are marked with independent color systems.
(4) 3 novel functional genes such as Piz (GenBank MZ 570866), piz-MWZ (GenBank MZ 570867), piz-TFB (GenBank MZ 570868) and the like are separated and cloned by utilizing a conventional homologous gene cloning method based on PCR technology
In particular, since the genotypes of the newly discovered 2 unknown new genes are different from those of the known 6 functional genes (containing Piz), they are also different from each other, and thus, they are named Piz-MWZ (Maweizhan, CV 14), piz-TFB (tianfeng b, CV 27), respectively.
This example demonstrates that the present technology system has strong inclusion and comparability, since 6 Piz sub-haplotype varieties were mined by haplotype and sub-haplotype analysis under the condition of Piz not segregating clones; then, through comparing a series of genotypes of known functional gene specific markers in the system, 6 Piz sub-haplotype varieties are identified and proved to contain no known functional gene Piz but belong to 2 types of new genes Piz-MWZ and Piz-TFB of the Piz sub-haplotype.
Example 11: an example of identifying alleles (Pi 2/Piz-t) of the disease-resistant gene cluster from rice seed resources by using the technical system which has the advantages of compatibility, accurate identification and excavation of the functional genes of the gene cluster of the rice blast Pi2/Pi9 disease-resistant gene cluster (FIGS. 3-6,12)
(1) Early cloning studies showed that Pi2/Piz-t is a functional gene of the gene cluster, and the two [ Pi2 (CK 1, 2); piz-t (CK 3, 4) differs by only 8 amino acids (Zhou et al 2006, molecular Plant-Microbe Interactions,19, 1216-1228) and is concentrated in genomic regions #7902 to #8029 (FIG. 5,6).
(2) The test cultivars consisted of 18 reference cultivars (CK 1-18) (FIG. 3; example 2).
(3) In the primary marker-based functional haplotype/non-functional haplotype detection, the two have no difference in the species carried by the two, and are both functional haplotype varieties (FIG. 12 a);
(4) In the secondary marker-based sub-haplotype detection, the two carrier varieties still have no difference, and are Pi2/zt sub-haplotype varieties (FIG. 12 b);
(5) In the identification of 9 functional haplotype reference varieties based on the tertiary marker developed by Pi 2-specific SNP, #7905TTC of Piz-t was found to be sequencing error and should be #7905GTC (FIG. 6; FIG. 12 c);
(6) In the identification of 9 functional haplotype reference varieties based on a tertiary marker developed by Piz-t specific SNP, the #8028CT of Pi50/Pigm is a sequencing error and should be #8028TG, and Piz-t has no difference with Pi50/Pigm but has a difference with Pi2 (FIG. 6; FIG. 12 d);
(7) In the identification of 9 functional haplotype reference varieties based on the tertiary markers developed for Pi2/Pi50/Pigm specific SNPs, it was found that the SNPs of Pi2 (CAG) with Piz-t (TGT) and Pi50/Pigm (CGT) were true at the #7902 site, which was actually the Pi2 specific SNP (FIG. 5; FIG. 12 e);
(8) In the identification of 9 functional haplotype reference varieties based on a tertiary marker developed by Pi2/Piz-T specific SNP, it is found that #7992T of Piz-T is sequencing error and should be #7992G, and Pi2 is different from Pi50/Pigm and Piz-T, and the site is actually Pi2 specific SNP (FIG. 5; FIG. 12 f);
(9) In particular, the identification of 5 functional genes and 3 non-functional genes by the tertiary marker (# 15 additional marker) developed for Pi2/Piz-t specific Indel (7919) revealed that Indel (7919) of Pi2 was a sequencing error, was identical to both, and was not deleted, but differed from other functional and non-functional genes (deletion; FIG. 12 g);
for #15 additional markers (upper band, target gene; lower band, non-target gene):
SEQ ID NO.31(Pi2/zt Indel(7919) -F；5’-3’)：
ATGTGGATGCTGCAGGAATCTC；
SEQ ID NO.32(Pi2/zt Indel(7919) -R；5’-3’)：
GATGAAATAGAATCTAGGCACTCA。
in summary, the technical system has systematic and strict inclusion, comparability and error correction capability, and avoids making a result due to errors of original data or reference sequenceThe misjudgment of (2). In particular, what really enables to identify Pi2/Piz-t is a specific molecular marker developed on the basis of 1 correct and 2 incorrect original data or reference sequence SNPs: pi2 CAG7902TGT /CGT ,Pi2 T7992G ,Pizt/50/gm TG8028CT (FIG. 12).
Example 12: an example of screening the rice seed resource for the existence of a "synonymy syngen" (Pi 50/Pigm) of a rice blast Pi2/Pi9 disease-resistant gene cluster by using the technical system which has the advantages of inclusiveness, accurate identification and mining of the functional genes of the gene cluster (FIGS. 3-4,13)
Unlike the general molecular marker patent technology, the technology system of the present invention is composed of three-level detection markers, i.e., "haplotype-sub-haplotype-functional gene", and the like, and is used for detecting only the DNA polymorphism of the specific genomic region of the target gene. The marker is fit with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNPs, and each marker is independent and has strict logicality. Therefore, the precise identification of functional genes in the cluster is realized.
(1) Previous work on cloning studies showed that Pi50 (Su et al 2015, theoretical and Applied Genetics, 128.
(2) Similarly, the test cultivars consisted of 18 reference cultivars (CK 1-18) (FIG. 3; example 2).
(3) The results of 14 specific marker tests in one of the above technical systems all prove that the two [ Pi50 (CK 5)/Pigm (CK 6) ] have no difference, but the two can pass through the common specific molecular marker combination (Pi 50/gm) A7746G ,Pi50/gm G8626C ) Clearly distinguished from other functional genes of the gene cluster (FIGS. 13 a-g);
(4) Three-stage markers developed based on unique specific sequences between Pi50/Pigm (# 16 additional markers; pi 50/Pigm) Indel(5031) ) The 6 known functional genes of the Pi2/Pi9 disease-resistant gene cluster are identified, and the result table showsNo differences were found between all functional genes in this cluster, indicating that this specific sequence was due to sequencing errors (FIG. 13 h).
Additional markers for #16 (no difference in any of the test varieties):
SEQ ID NO.33(Pi50/Pigm Indel(5031) -F；5’-3’)：
TGGTGGTGTGCTTTTTCTTT；
SEQ ID NO.34(Pi50/Pigm Indel(5031) -R；5’-3’)：
TAGCCCTATGAGATTATTATCCG。
in conclusion, the technical system has systematic and strict inclusion, comparability and error correction capability. Specifically, the results of a series of specific molecular marker tests show that the two are really 'heteronymous syngeneic genes'.
Example 13: an example of screening the "homologous foreign Gene" [ Piz (Fukunishiki)/Piz (IRBLz-Fu) ] existing in a rice seed gene cluster from rice seed resources by using the technical system which has the advantages of inclusion and accurate identification and mining of functional genes of the rice blast Pi2/Pi9 disease-resistant gene cluster (FIG. 3,9,14)
Unlike the general molecular marker patent technology, the technology system of the present invention is composed of three-level detection markers, i.e., "haplotype-sub-haplotype-functional gene", and the like, and is used for detecting only the DNA polymorphism of the specific genomic region of the target gene. The marker is fit with the evolution track and the mode of a target gene family, and openly comprises main functional specific genome regions and SNPs, and each marker is independent and has strict logicality. Therefore, the accurate identification of the homologous heterogeneous genes generated by the germplasm resources from different sources is realized.
(1) As described above, piz is a functional gene in the gene cluster that has not been isolated and cloned. Of the 18 reference cultivars, CK9 (Fukunishiki, piz donor cultivar) has an affinity pedigree relationship with CK10 (IRBLz-Fu; piz monogenic line developed by Fukunishiki), both carriers of Piz (Tsunematsu et al 2000, breeding Sci, 50.
(2) However, the results of identifying 18 reference varieties by using 2 haplotype-specific markers indicate that CK9 is the same as other functional genes of the gene cluster and belongs to functional haplotype varieties; CK10 is different from other functional genes in the gene cluster and belongs to a non-functional haplotype variety (FIG. 3, 14a);
(3) In order to confirm the above results, 2 haplotype-specific additional markers (# 17,18 additional marker) were selected to identify 18 reference varieties, and the results showed that the difference still existed between them, CK9 still belongs to functional haplotype variety, while the latter was still confirmed as non-functional pseudovariety (fig. 14 b);
for the #17 reference marker (upper band, non-functional haplotype; lower band and double band, functional haplotype):
SEQ ID NO.35(Pi2/9-F/N G7720A -F；5’-3’)：
GGAATAGGTAAGTTGCGAGACAT；
SEQ ID NO.36(Pi2/9-F/N G7720A -R；5’-3’)：
ATTGGAGGGAAGAGAGCTTCTCA。
for the #18 reference marker (upper band, functional haplotype; double band, non-functional haplotype):
SEQ ID NO.37(Pi2/9-F/N T8045G -F；5’-3’)：
GATGCCTAACTGGATTGAGCA；
SEQ ID NO.38(Pi2/9-F/N T8045G -R；5’-3’)：
GCCCCAAGTATCAGCATGGTT。
(4) To further confirm whether CK9 is a carrier of Piz, 9 functional haplotype varieties were identified using 2 Piz function-specific molecular markers, indicating that CK9 indeed contains the functional gene Piz of this gene cluster (fig. 9;
(5) To further confirm whether the test material was contaminated, CK9 was compared with CK10 from 2 different sources, and the results showed that CK9 was indeed the same as "CK10 stock" and different from "CK10 contaminated" (fig. 14 d).
In summary, the technology system has systematic and strict inclusion, comparability and error correction capability. Specifically, the results of a series of specific molecular marker tests indicate that CK9 and "CK10 protospecies" are carriers of Piz, and "CK10 promiscuous" is not a carrier of Piz (may contain other disease-resistant genes). In summary, CK9 and "CK10 promiscuous" carry "a foreign gene of the same name.
Example 14: an example of comparison of the discrimination ability of the technical system with the other marker systems (FIG. 11,15) for the accurate identification and mining of rice blast Pi2/Pi9 disease-resistant gene cluster functional genes with the inclusion
(1) As mentioned above, the rice blast Pi2/Pi9 disease-resistant gene cluster is the most important broad-spectrum persistent source of resistance, and scientists developed specific markers for 1-2, and at most 4, functional genes to improve their utilization efficiency [ Pi2 (Alam et al 2015, proceedings of the National Academy of Science of India, section B, biological Science, 9; pi9 (Scheuuermann and Jia 2016, phytopathology,106:871-876, zhou et al 2020, rice, 13; pi2, pi9 (tianan et al.2016, rice, 9; pi9, pi2, piz-t, pigm (Tian et al 2020, plant Disease, 104;
(2) From the above main references, the latest and most discriminative other marker system (Tian et al.2020, plant Disease,104:
(a) Functional/non-functional haplotype analysis is carried out by utilizing the primary marker, and clear functional haplotype boundaries are marked for the subsequent excavation and identification of functional genes. In this example, 48 non-functional haplotype varieties are eliminated from 60 rice resources to be tested, and only 12 functional haplotype varieties are subjected to subsequent detection analysis (FIG. 11), so that on one hand, the working efficiency is greatly improved (by 5 times), and on the other hand, the interference of genetic background caused by the drastic differentiation of functional/non-functional haplotype sequences is greatly reduced, and the detection effect is clearer. This is one of the incomparable benefits of any other marker detection system;
(b) The secondary marker is used for carrying out the sub-haplotype analysis of the functional haplotype variety, and further, clear sub-haplotype boundaries are marked for the subsequent identification of each functional gene. In this example, the 12 functional haplotype varieties are further divided into 4 sub-haplotypes, with CV 28-30, CV52, CV59 divided into Pi2/zt sub-haplotype varieties; CV60 is Pi50/gm sub-haplotype variety; CV14,18,21,22,27,49 is a Piz sub-haplotype variety; no Pi9 sub-haplotype variety was present (FIG. 15-a 1). This is also one of the incomparable benefits of any other marker detection system.
(c) Functional gene analysis is carried out by utilizing paired tertiary markers, and clear and comparable functional gene boundaries are marked for the identification of each functional gene. In this example, a pair of optimal function-specific marker combinations were selected for each of 5 functional genes (Pi 50= Pigm, 1 gene in combination as described above), and were independent of each other and aligned with each other to constitute a strict discrimination system. This is also one of the incomparable benefits of any other marker detection system. Only 4 comparative examples were selected for further description below.
Comparative example 1 (type of assay System) As described above, the technical system of the present invention consists of three-stage assay markers such as "haplotype-submonoid-functional gene". Because the gene is matched with the evolution track and the mode of a target gene family, and openly comprises the function specific genome region and SNP of a main functional gene, each mark is independent and has strong inclusion, strict logic and accurate comparability. This enables the discrimination of true and false specific genomic regions and SNPs resulting from the sequencing errors, and "synonym genes", "homonym heterogenous genes", or "true and false genes" resulting from the lack of stringency of the marker detection system. In the reference marker system, only known and few target genes are detected without inclusion, logic and comparability, and mining and identification work except the target genes is not performed. Therefore, the technical system of the present invention has systematic and strict discrimination capability and error correction capability. Undoubtedly, our technical system has more powerful and broad and accurate detection capability.
Comparative example 2 (type of marker) in the technical system of the present invention, all markers were function-specific molecular markers developed in the coding regions of the respective reference functional genes; in other marker systems, only one marker is of the same type, and the other 2 markers are molecular markers developed outside the coding region. Undoubtedly, our label is more function specific and accurate. In addition, in order to improve the reliability of the detection of the target gene with severe differentiation of the genome region, the technical system of the present invention constructs a multi-primer PCR detection system (# 7 marker; FIG. 15-a 2) to avoid the situation that the individual sample cannot be detected as in the other marker systems (FIG. 15-b 2).
Comparative example 3 (excavation of New Gene) in the technical system of the present invention, 6 species such as CV14 were classified into Piz sub-haplotypes (FIG. 15-b 1); however, the results of a series of functional gene analyses showed that none of the above 6 varieties was a carrier of Piz, but rather its allele [ Piz-MWZ (CV 14); piz-TFB ( CV 18,21,22,27,49); FIGS. 15-a 2-6. On the other hand, in the other marker system, since the system is not inclusive and comparable, the target genes detected in the original literature do not include Piz and Pi50, and thus, the 6 varieties similar to the CK7 and CK8 genotypes were neither inferred to be carriers of functional genes nor identified to be carriers of 2 Piz alleles, unlike the 4 established target genes (Pigm, pi9, pi2, piz-t) (fig. 15-b1 to 3). Undoubtedly, our detection results are more inclusive, comparable, and accurate.
Comparative example 4 (identification of known genes) CV52,59 was inferred to be the Piz-t gene carrier of Pi2/zt sub-haplotype in the technical system of the present invention, and the results of 2-level detection were clear and consistent (FIGS. 15-a 1-6). In the other marker system, CV52 was judged to be a carrier of Piz-t and CV59 was judged to be a carrier of unknown genes, because the detection markers were not hierarchical and logical (FIGS. 15-b1 to 3). Undoubtedly, our test results are more logical and rigorous.
And (4) conclusion: the technical system of the present invention has the innovative and beneficial effects that are incomparable with any other mark detection system.
The above examples demonstrate the remarkable ability and effect of the present invention to identify and extract Pi2/Pi9 disease-resistant gene cluster functional genes.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> a technical system with inclusion and accurate identification and excavation of broad-spectrum durable disease-resistant gene cluster of rice blast Pi2/Pi9
<160> 38
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aggggctttg ttgcttaaca tat 23
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ggtcaaaatt aacatcaaac tggg 24
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gatagtgttt attttacgtc tgttt 25
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cagaatatgc catcgaatac gcgctgcttt 30
<210> 6
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cggacggatg acgacggcac gactga 26
<210> 7
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgtcagaatg ggagaaattc tatgtgca 28
<210> 8
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tacctactag acgattcctt ttgatttcaa 30
<210> 9
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gcaatcaaag agctggggca gttaagcatg 30
<210> 10
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gagggaagag agcttctcaa tggctgcat 29
<210> 11
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
tcgacaaagg aaaaatgtaa gatactt 27
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
agtaggggag gaggagatga a 21
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tctccatgtg gatgctgcag a 21
<210> 14
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tctccatgtg gatgctgtgg a 21
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tctctatgtg aatgctgcgg a 21
<210> 16
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gttttgaata ctagcttctc cccaag 26
<210> 17
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gatactttat gcagccattg ag 22
<210> 18
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
tagaatctag gcactcaagt gt 22
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
atgcctaact ggattgagca gctcg 25
<210> 20
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
agatgaagga ccatgaggtt gggcagt 27
<210> 21
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tgcaggttct agagtatgta gatatcc 27
<210> 22
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
gaagagagct tctcaatggc tg 22
<210> 23
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
cgaatgatag gtcagtcact ctcta 25
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
agcttgagct gtgcctatct ctt 23
<210> 25
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
atgggagatg gctctgattt agtt 24
<210> 26
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
gcacaacaat gcaatacggt cg 22
<210> 27
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
atgtggtcgt ctaccattag caa 23
<210> 28
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
tccaggcttg ggtttatttc tagt 24
<210> 29
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
tccaggcttg ggtttatttc tagt 24
<210> 30
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
tcagagccat ctcccattgg tac 23
<210> 31
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
atgtggatgc tgcaggaatc tc 22
<210> 32
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
gatgaaatag aatctaggca ctca 24
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
<210> 34
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
tagccctatg agattattat ccg 23
<210> 35
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
ggaataggta agttgcgaga cat 23
<210> 36
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
attggaggga agagagcttc tca 23
<210> 37
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
gatgcctaac tggattgagc a 21
<210> 38
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
gccccaagta tcagcatggt t 21
Claims (5)
1. A method for identifying and excavating rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster functional genes with inclusion and precision is characterized in that the method consists of a haplotype-sub-haplotype-functional gene three-level detection marker and is propelled step by step; whether the variety to be tested carries the target gene or not is determined by the integrated result;
specifically, the method comprises the following steps:
(1) The functional haplotype/non-functional haplotype detection program for the gene cluster:
defining a genome region with clearly differentiated haplotypes by sequence comparison of functional genes/non-functional genes in a cluster; 2 haplotype specific molecular markers are designed, and haplotype analysis of functional gene/non-functional gene reference varieties based on a PCR technology is carried out to confirm the reliability of the markers; only the variety which is simultaneously judged to be functional genotype is functional haplotype variety; in subsequent tests, non-functional varieties were excluded;
(2) The detection program of the sub-haplotype of the functional haplotype of the gene cluster is to define the specific single nucleotide polymorphism site SNP of the sub-haplotype through the sequence comparison of functional genes in the cluster, wherein the sub-haplotype is Pi2/zt, pi50/gm, pi9 and Piz; designing 3 sub-haplotype specific molecular markers, and performing PCR-technology-based sub-haplotype analysis on functional haplotype varieties to confirm the reliability of the markers;
(3) The detection procedure of the broad-spectrum persistent resistance gene Pi2 of Pi2/zt sub-haplotype of the functional haplotype of the gene cluster is to define the specific SNP of the target gene by comparing the sequences of the functional genes in the cluster; designing 2 specific molecular markers, and performing PCR-based specific genotype analysis of the target gene of the functional haplotype variety to confirm the reliability; the Pi2 gene carrier belongs to a functional haplotype of a Pi2/Pi9 disease-resistant gene cluster, a Pi2/zt sub-haplotype, and 2 functional specific molecular markers are varieties or individuals with the same genotype as that of a Pi2 reference variety; on the contrary, the detection result that any detection mark does not meet the method is not the target gene Pi2;
(4) The detection procedure of the broad-spectrum persistent resistance gene Piz-t of Pi2/zt sub-haplotype of the functional haplotype of the gene cluster is to define the specific SNP of the target gene by comparing the sequences of the functional genes in the cluster; designing 2 specific molecular markers, and performing PCR-based specific genotype analysis of the target gene of the functional haplotype variety to confirm the reliability; the carrier of the Piz-t gene belongs to functional haplotypes of a Pi2/Pi9 disease-resistant gene cluster, pi2/zt sub-haplotypes, and 2 functional specific molecular markers are all varieties or individuals with the same genotypes as the Piz-t reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Piz-t;
(5) The detection procedure of the broad-spectrum persistent resistance gene Pi50/Pigm of the Pi50/gm sub-haplotype of the functional haplotype of the gene cluster is to define the SNP specific to the target gene by comparing the sequences of the functional genes in the cluster; designing 2 specific molecular markers, and performing PCR-based specific genotype analysis of the target gene of the functional haplotype variety to confirm the reliability; the Pi50/Pigm gene carrier belongs to the functional haplotype of a Pi2/Pi9 disease-resistant gene cluster, a Pi50/gm sub-haplotype, and 2 functional specific molecular markers are all varieties or individuals with the same genotype as a Pi50/Pigm reference variety; otherwise, the detection result that any detection mark does not meet the method is not the target gene Pi50/Pigm;
(6) The detection procedure of the broad-spectrum persistent resistance gene Pi9 of Pi9 sub-haplotype of the functional haplotype of the gene cluster is to define SNP specific to the target gene by comparing the sequences of the functional genes in the cluster; designing 2 specific molecular markers, and performing PCR-based specific genotype analysis of the target gene of the functional haplotype variety to confirm the reliability; the Pi9 gene carrier belongs to functional haplotype of Pi2/Pi9 disease-resistant gene cluster, pi9 sub-haplotype, and 2 functional specificity molecular markers are all varieties or individuals with the same genotype as the Pi9 reference variety; on the contrary, any detection mark which does not meet the detection result of the method is not the target gene Pi9;
(7) The detection procedure of the broad-spectrum persistent resistance gene Piz of Piz sub-haplotype of the functional haplotype of the gene cluster is to define the SNP specific to the target gene by comparing the sequences of functional genes in the cluster; designing 2 specific molecular markers, and performing PCR-based specific genotype analysis of the target gene of the functional haplotype variety to confirm the reliability; the Piz gene carrier belongs to functional haplotypes of Pi2/Pi9 disease-resistant gene clusters, piz sub-haplotypes, and 2 functional specific molecular markers are varieties or individuals with the same genotypes as Piz reference varieties; on the contrary, any detection mark which does not accord with the detection result of the method is not the target gene Piz;
specifically, in the above method:
(1) The haplotype-specific molecular marker of (A) is Pi2/9-F/N P/A(933～1239) And Pi2/9-F/N P/A(3808～4033) (ii) a The sequences are respectively shown in SEQ ID NO. 1-2 and SEQ ID NO. 3-4;
(2) Is marked as Pi2/zt/z-SubH A2726G/T ,Pi2/zt/50/gm-SubH C6739A ,Pi9/z-SubH C7793T (ii) a The sequences are respectively SEQ ID NO. 5-6, SEQ ID NO. 7-8 and SEQ ID NO. 9-10Shown in the specification;
(3) The target gene-specific molecular marker of (b) is Pi2 CAG7902TGT/CGT And Pi2 T7992G (ii) a The sequences are respectively shown in SEQ ID NO. 11-12 and SEQ ID NO. 13-16;
(4) The target gene-specific molecular marker of (b) is Pi2/zt GAC7905TTC/TTA And Pizt/50/gm TG8028CT (ii) a The sequences are respectively shown in SEQ ID NO. 17-18 and SEQ ID NO. 19-20;
(5) The molecular marker specific to the target gene is Pi50/gm A7746G And Pi50/gm G8626C (ii) a The sequences are respectively shown in SEQ ID NO. 21-22 and SEQ ID NO. 23-24;
(6) The target gene-specific molecular marker of (b) is Pi9 T7257C And Pi9/z T6709G (ii) a The sequences are respectively shown in SEQ ID NO. 25-26 and SEQ ID NO. 27-28;
(7) The molecular marker Pi9/z specific to the target gene T6709G And Piz A7099G (ii) a The sequences are respectively shown in SEQ ID NO. 27-28 and SEQ ID NO. 29-30.
2. The method of claim 1, wherein the method is applied to systematic and accurate inclusion identification and mining of functional genes in complex rice blast Pi2/Pi9 disease-resistant gene clusters, and specifically comprises the following 8 target genes:
the sequence of the broad-spectrum persistent resistance gene Pi2 of the Pi2/zt sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster is shown as GenBank DQ352453.1;
the sequence of the broad-spectrum durable resistance gene Piz-t of the Pi2/zt sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster is shown in GenBank DQ352040.1;
the Pi50 sequence of the broad-spectrum persistent resistance gene Pi50/Pigm of the Pi50/gm sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster is shown as GenBank KP985761.1, and the Pigm sequence is shown as GenBank KU904633.2;
a broad-spectrum persistent resistance gene Pi9 of Pi9 sub-haplotype of functional haplotype of rice blast Pi2/Pi9 disease-resistant gene cluster, the sequence is shown in GenBank DQ285630.1;
the sequence of the subcloned broad-spectrum persistent resistance gene Piz of the Piz sub-haplotype of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster is shown in GenBank MZ 570866.
3. The method of claim 1, wherein the method is applied to identify known functional genes of the gene cluster in unknown germplasm resources, and mining 2 novel target genes as follows: novel disease-resistant genes Piz-MWZ and Piz-TFB of the functional haplotype of the rice blast Pi2/Pi9 disease-resistant gene cluster;
the sequence of the disease-resistant gene Piz-MWZ is shown in GenBank MZ 570867;
the sequence of the disease-resistant gene Piz-TFB is shown in GenBank MZ 570868.
4. The method of claim 1, wherein the method is used for accurately screening true and false specific genomic regions and SNPs that are ubiquitous in gene clusters due to sequencing errors, the gene clusters being located in the regions of SEQ ID nos. 1 to 30.
5. The method of claim 1, wherein the method is used for the precise screening of "alleles", "heteronyms", "homonyms", or "true and false target genes" present in a gene cluster located in the region of SEQ ID No.1 to 30.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815869.1A CN113774160B (en) | 2021-07-19 | 2021-07-19 | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110815869.1A CN113774160B (en) | 2021-07-19 | 2021-07-19 | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113774160A CN113774160A (en) | 2021-12-10 |
| CN113774160B true CN113774160B (en) | 2022-10-04 |
Family
ID=78836173
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110815869.1A Active CN113774160B (en) | 2021-07-19 | 2021-07-19 | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113774160B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
| CN103320437A (en) * | 2013-07-10 | 2013-09-25 | 广东省农业科学院植物保护研究所 | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof |
-
2021
- 2021-07-19 CN CN202110815869.1A patent/CN113774160B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103305510A (en) * | 2013-07-10 | 2013-09-18 | 广东省农业科学院植物保护研究所 | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof |
| CN103320437A (en) * | 2013-07-10 | 2013-09-25 | 广东省农业科学院植物保护研究所 | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof |
Non-Patent Citations (7)
| Title |
|---|
| Pigm特异性选择标记的开发及其在粳稻穗颈瘟抗性育种中的利用;曾生元等;《中国水稻科学》;20180910(第05期);41-49页 * |
| The blast resistance gene Pi37 encodes a nucleotide binding site leucine-rich repeat protein and is a member of a resistance gene cluster on rice chromosome 1;LIN,F.等;《Genetics.》;20071018;第177卷(第3期);1871-1880页 * |
| The identification of Pi50(t), a new member of the rice blast resistance Pi2/Pi9 multigene family;ZHU,X.Y.等;《Theor Appl Genet.》;20120122;第124卷(第7期);1295-304页 * |
| 广东地方稻种沾叶独枝抗稻瘟病遗传分析及基因鉴定;张密密等;《分子植物育种》;20171028(第10期);182-189页 * |
| 抗稻瘟病Pi2/9/z-t基因特异性分子标记的开发;华丽霞等;《中国水稻科学》;20150510(第03期);86-91页 * |
| 水稻稻瘟病抗性基因Pi2-InDel标记的开发与评价;杨立明等;《分子植物育种》;20170228(第02期);211-215页 * |
| 稻瘟病广谱抗性基因Pigm特异性分子标记的开发和应用;陈涛等;《中国水稻科学》;20200110(第01期);30-38页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113774160A (en) | 2021-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ambreen et al. | Development of genomic microsatellite markers in Carthamus tinctorius L.(safflower) using next generation sequencing and assessment of their cross-species transferability and utility for diversity analysis | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| Zhang et al. | Genome-wide association analysis identifies resistance loci for bacterial blight in a diverse collection of indica rice germplasm | |
| CN110923352B (en) | KASP marker of wheat powdery mildew resistance gene PmDTM and application thereof | |
| Zhou et al. | Identification of novel alleles of the rice blast-resistance gene Pi9 through sequence-based allele mining | |
| CN114350841B (en) | Polymorphic molecular marker based on whole genome sequencing, preparation method and application | |
| Gao et al. | Fine mapping a clubroot resistance locus in Chinese cabbage | |
| Kuang et al. | Development of a core set of SNP markers for the identification of upland cotton cultivars in China | |
| Li et al. | Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing | |
| CN113789403B (en) | Three sets of compatible and accurate rice blast Pid disease-resistant gene family allele identifying and mining technical systems | |
| CN107541551A (en) | The primer and the application that are used to detect spinach RPF1 genotype based on KASP technological development | |
| Zheng et al. | Specific genes identified in Pathotype 4 of the Clubroot pathogen Plasmodiophora brassicae | |
| CN113774160B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi2/Pi9 broad-spectrum persistent disease-resistant gene cluster | |
| CN113744800B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pik disease-resistant allele family, application and molecular marker | |
| US20230183822A1 (en) | Molecular markers for identifying allele at rice-blast-resistant pik locus of rice and use thereof | |
| KR101907825B1 (en) | Molecular marker for selecting tomato plants resistant to powdery mildew disease | |
| CN114525356B (en) | Haplotype identification marker of rice grain length control gene GS3 and screening method thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113981121B (en) | Technical system with inclusion and accurate identification and excavation of rice blast Pi63 disease-resistant allele family | |
| CN113981122B (en) | Method for identifying, excavating and cloning rice blast Pita disease-resistant gene family alleles with compatibility and accuracy | |
| CN113903397B (en) | Method for identifying and mining rice blast Pib disease-resistant gene family functional genes with inclusion and precision and application thereof | |
| BR112015021478B1 (en) | METHOD TO PRODUCE A COTTON PLANT COMPRISING RESISTANCE TO RENIFORM NEMATOID | |
| CN114292937B (en) | One set of two technical systems with inclusion and accurate identification, excavation and cloning of rice blast Pit and Pi54 disease-resistant gene families | |
| CN108060247B (en) | Haplotype related to upland cotton No. 8 chromosome fiber strength | |
| CN114622027B (en) | One group of two technical systems with inclusion and accurate identification and excavation of rice blast Pia and Pii disease-resistant gene families |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |