CN116219048A - Pea core SNP molecular marker set developed based on KASP technology and application thereof - Google Patents
Pea core SNP molecular marker set developed based on KASP technology and application thereof Download PDFInfo
- Publication number
- CN116219048A CN116219048A CN202111473981.8A CN202111473981A CN116219048A CN 116219048 A CN116219048 A CN 116219048A CN 202111473981 A CN202111473981 A CN 202111473981A CN 116219048 A CN116219048 A CN 116219048A
- Authority
- CN
- China
- Prior art keywords
- pea
- chromosome
- artificial sequence
- bit
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Collating Specific Patterns (AREA)
Abstract
The invention provides a set of pea core molecular marker sets developed based on a KASP technology and application thereof, and belongs to the technical field of molecular detection. The SNP markers based on KSAP comprise 25 core SNP markers which are uniformly distributed on 7 chromosomes of a pea genome, and 3-4 SNP markers of each chromosome. Based on the set of pea core molecular marker sets, high-throughput SNP typing detection can be carried out on pea resources or varieties, and identification and purity detection on pea commercial varieties can be realized; can be used for constructing a pea fingerprint library; the method can be applied to genetic diversity analysis of pea germplasm resources; low cost and high efficiency.
Description
Technical Field
The invention relates to the technical fields of molecular biology and molecular assisted breeding, in particular to a pea core SNP molecular marker set developed based on a KASP technology and application thereof.
Background
Pea is a diploid leguminous plant and is the fourth world soybean crop. Along with shortage of rural labor resources, an important trend in pea breeding is to cultivate high-quality, high-yield, frame-free varieties suitable for mechanized harvesting. Pea whole genome sequencing work was done in 2019. At present, the peas identified or registered in China are more in variety, and the planting area is also continuously increased. However, peas are conventional species, have great difficulty in protecting species rights, and have quality problems such as low purity of seeds and the like under the conditions of homonymous foreign matters and homonymous foreign matters in the market, and various disputes caused by the problems of authenticity of the seeds and quality of the seeds are endlessly generated, so that great economic losses are caused for peasants, breeders and development of peas industry in China. The existing identification and evaluation of pea germplasm resources and variety authenticity identification mainly depend on artificial phenotype judgment, and the working period is long, is easily influenced by human factors and the like, and seriously influences the utilization efficiency of the germplasm resources and the accuracy of identification and evaluation. Therefore, how to apply molecular biology technology to establish the pea variety authenticity, seed purity and germplasm resource identification evaluation detection method has very important significance for protecting breeders' variety rights and guaranteeing farmer benefits.
KASP refers to competitive allele-specific PCR (Kompetitive Allele Specific PCR) that can accurately double allele-type target SNPs and InDels for a wide range of genomic DNA samples, including complex genomic DNA samples. The KASP technology has the advantages of ultrahigh accuracy and conversion rate, unprecedented low cost, simple and quick result analysis and the like, and has been applied to variety identification, seed purity detection and the like of vegetable crops such as peppers, watermelons and the like. Based on this, development of SNP loci with low density, high precision and easy operation and a detection method thereof are needed.
Therefore, providing a pea core SNP molecular marker based on KASP technology and its application are the problems that the skilled person needs to solve.
Disclosure of Invention
In order to meet the requirements of the field, the invention provides a pea core SNP marker set developed based on the KASP technology, and high-throughput SNP typing detection of pea materials can be realized based on the core SNP marker, so that a simpler, efficient and low-cost pea variety authenticity, seed purity and germplasm resource identification, evaluation and detection method is established, the breeder variety right is protected, and the peasant benefit is ensured.
Pea belongs to conventional species, so that problems of disordered genotypes of germplasm materials, difficult distinction and the like exist in production and new species registration, and meanwhile, the heavy sequencing cost is high due to the extremely large genome of pea (about 4.5G), such as the extremely high cost of genotyping identification through heavy sequencing, and great economic burden is brought.
The pea genome is large, and repeated sequences in the genome are very large, which brings great difficulty to the development of pea core SNP marker sets.
The SNP locus selection of the pea core molecular marker set is very critical, and even if a plurality of primers are replaced or specific primers are specially designed, accurate typing still cannot be realized, and the most suitable SNP locus must be selected to be combined into the pea core molecular marker set so as to be used for accurately identifying the pea pure-bred materials. Through a large number of screening and research experiments, the invention finally finds a set of pea core SNP marker sets which are most suitable for high-throughput SNP typing detection of pea materials, and has high sensitivity, good specificity and typing success rate reaching 100 percent.
On one hand, the invention develops a set of pea molecular marker sets based on KASP technology, comprising 25 SNP markers, wherein the number of the 25 SNP markers is SNP 1-SNP 25;
wherein the SNP1 marker is a base A/G and is positioned on a pea chromosome 1, and the position of the SNP1 marker is 3172953 th position of the pea chromosome 1;
the SNP2 marker is a base C/T and is positioned on a pea chromosome 1, and the position is 277489395 th position of the pea chromosome 1;
the SNP3 marker is a base T/A and is positioned on a pea chromosome 1, and the position is 311989395 th position of the pea chromosome 1;
the SNP4 marker is a base T/A and is positioned on a pea chromosome 2, and the position is 1767704 th position of the pea chromosome 2;
the SNP5 marker is a base G/C and is positioned on a pea chromosome 2, and the position is 65837220 th position of the pea chromosome 2;
the SNP6 marker is a base A/C and is positioned on a pea chromosome 2, and the position is 268353837 th position of the pea chromosome 2;
the SNP7 marker is a base A/G and is positioned on a pea chromosome 2, and the position is 421393393 th position of the pea chromosome 2;
the SNP8 marker is a base A/T and is positioned on a pea chromosome 3, and the position is 118983751 th position of the pea chromosome 3;
the SNP9 marker is a base G/C and is positioned on a pea chromosome 3, and the position is 251295825 th position of the pea chromosome 3;
the SNP10 marker is a base A/T and is positioned on a pea chromosome 3, and the position is 295457439 th position of the pea chromosome 3;
the SNP11 marker is a base T/C and is positioned on a pea chromosome 4, and the position is 21190452 th position of the pea chromosome 4;
the SNP12 marker is a base T/C and is positioned on the pea chromosome 4, and the position is 113911433 th position of the pea chromosome 4;
the SNP13 marker is a base C/T and is positioned on a pea chromosome 4, and the position is 297836064 th position of the pea chromosome 4;
the SNP14 marker is a base C/T and is positioned on a pea chromosome 4, and the position is 410691643 th position of the pea chromosome 4;
the SNP15 marker is a base C/T and is positioned on a pea chromosome 5, and the position is 44491766 th position of the pea chromosome 5;
the SNP16 marker is a base C/T and is positioned on a pea chromosome 5, and the position is 104804482 th position of the pea chromosome 5;
the SNP17 marker is a base C/G and is positioned on a pea chromosome 5, and the position is 176342951 th position of the pea chromosome 5;
the SNP18 marker is a base C/G and is positioned on a pea chromosome 5, and the position is 527844249 th position of the pea chromosome 5;
the SNP19 marker is a base C/A and is positioned on a pea chromosome 6, and the position is 150897667 th position of the pea chromosome 6;
the SNP20 marker is a base T/C and is positioned on a pea chromosome 6, and the position is 355057090 th position of the pea chromosome 6;
the SNP21 marker is a base G/A and is positioned on a pea chromosome 6, and the position is 445826212 th position of the pea chromosome 6;
the SNP22 marker is a base C/G and is positioned on the pea chromosome 7, and the position is 115628325 th position of the pea chromosome 7;
the SNP23 marker is a base A/G and is positioned on the pea chromosome 7, and the position is 163788370 th position of the pea chromosome 7;
the SNP24 marker is a base G/C and is positioned on the pea chromosome 7, and the position is 312150050 th position of the pea chromosome 7;
the SNP25 marker is a base T/C and is positioned on the pea chromosome 7, and the position is 460676933 th position of the pea chromosome 7.
The physical location of the SNPs was determined based on Pea genomic sequences, pea genome published in accordance with (https:// ugi. Versailles. Inra. Fr/jbrowse/gmod_jbrowse/, data = myData/Pea/psa_v1a/data).
Further, the sequences of 100bp before and after the SNP1 to the SNP25 are shown in the following table:
| numbering device | The first 100bp | The back 100bp |
| SNP1 | Seq ID NO.76 | Seq ID NO.77 |
| SNP2 | Seq ID NO.78 | Seq ID NO.79 |
| SNP3 | Seq ID NO.80 | Seq ID NO.81 |
| SNP4 | Seq ID NO.82 | Seq ID NO.83 |
| SNP5 | Seq ID NO.84 | Seq ID NO.85 |
| SNP6 | Seq ID NO.86 | Seq ID NO.87 |
| SNP7 | Seq ID NO.88 | Seq ID NO.89 |
| SNP8 | Seq ID NO.90 | Seq ID NO.91 |
| SNP9 | Seq ID NO.92 | Seq ID NO.93 |
| SNP10 | Seq ID NO.94 | Seq ID NO.95 |
| SNP11 | Seq ID NO.96 | Seq ID NO.97 |
| SNP12 | Seq ID NO.98 | Seq ID NO.99 |
| SNP13 | Seq ID NO.100 | Seq ID NO.101 |
| SNP14 | Seq ID NO.102 | Seq ID NO.103 |
| SNP15 | Seq ID NO.104 | Seq ID NO.105 |
| SNP16 | Seq ID NO.106 | Seq ID NO.107 |
| SNP17 | Seq ID NO.108 | Seq ID NO.109 |
| SNP18 | Seq ID NO.110 | Seq ID NO.111 |
| SNP19 | Seq ID NO.112 | Seq ID NO.113 |
| SNP20 | Seq ID NO.114 | Seq ID NO.115 |
| SNP21 | Seq ID NO.116 | Seq ID NO.117 |
| SNP22 | Seq ID NO.118 | Seq ID NO.119 |
| SNP23 | Seq ID NO.120 | Seq ID NO.121 |
| SNP24 | Seq ID NO.122 | Seq ID NO.123 |
| SNP25 | Seq ID NO.124 | Seq ID NO.125 |
In yet another aspect, the present invention provides a KASP primer combination for detecting a pea core molecular marker set as described above, comprising any one or more and all of 25 primer pairs corresponding to SNPs 1-25, respectively, each primer pair comprising a forward primer 1, a forward primer 2 and a reverse primer, in particular as follows:
further, the 5' end of the forward primer 1 is provided with a FAM fluorescent signal label; the 5' end of the forward primer 2 carries HEX fluorescent signal label.
In yet another aspect, the invention provides a reagent, chip or kit comprising any one or more of the primer combinations described above.
In yet another aspect, the invention provides a method for detecting pea genotypes using a primer combination as described above, comprising the steps of:
(1) Extracting DNA of pea varieties to be detected;
(2) Performing PCR amplification by using the DNA obtained in the step (1) as a template, and adding Primer mix and KASP Master mix (LGC, biosearch Technologies); the Primer mix is the Primer set according to claim 3.
(3) And detecting and analyzing the amplification result, and determining the genotype of the pea variety to be detected at the SNP molecular marker locus corresponding to each group of primers.
Further, the PCR reaction system in the step (2) is as follows: 5-10 ng/. Mu.l pea genomic DNA 0.8. Mu.l, KASP Master Mix 0.8. Mu.l, primer Mix 0.05. Mu.l. .
Further, the PCR reaction conditions in the step (2) are as follows: pre-denaturation at 94 ℃ for 15min; denaturation at 94℃for 20S; renaturation/extension at 61 ℃ for 60s, wherein the annealing temperature is reduced by 0.6 ℃ in each cycle, and 10 cycles are taken; denaturation at 94℃for 20s and renaturation/extension at 55℃for 60s were performed for 26 cycles.
Further, the PCR described in the step (2) was performed using a full automatic PCR platform of LGC company.
Further, step 3) was performed by data analysis software Krake or KlumterCaller using LGC.
In a further aspect, the invention provides the use of a molecular marker set as described above or a primer combination as described above or a reagent, chip or kit as described above in pea genotyping, pea variety authenticity identification, pea variety purity identification, pea SNP fingerprinting library construction, pea genetic diversity analysis, or pea molecular marker assisted breeding.
The invention has the beneficial effects that: the invention provides a set of pea core SNP molecular marker sets developed based on KASP technology and application thereof, wherein the SNP molecular marker sets are uniformly distributed on 7 chromosomes of a pea genome, 3-4 SNP markers are respectively arranged on each chromosome, and 25 SNP markers are respectively arranged. Based on the set of pea core SNP molecular marker sets, high-throughput SNP typing detection can be carried out on pea germplasm resources or varieties, and the authenticity identification and purity detection of pea commercial varieties can be realized; can be used for constructing a pea fingerprint library; the method can be applied to genetic diversity analysis of pea germplasm resources. The genetic analysis is carried out by the core SNP molecular marker provided by the invention, so that the cost can be greatly reduced, and the method is very suitable for production and application.
Drawings
FIG. 1 is a diagram of the saturated SNP locus information according to the present invention;
FIG. 2 is a graph showing a cluster analysis of 135 different pea resources using 25 pea core SNP markers according to example 1 of the invention;
FIG. 3 is a diagram showing SNP primer typing in accordance with the present invention;
FIG. 4 is a graph showing a cluster analysis of 142 parts of pea resources detected by 25 pea core SNP markers according to example 2 of the invention;
FIG. 5 is a diagram showing the typing results corresponding to the 234765722 locus of chromosome 1 in example 3 of the present invention;
FIG. 6 is a diagram showing the typing results corresponding to the 14940515 locus of chromosome 2 in example 3 of the present invention;
FIG. 7 is a diagram showing the typing results corresponding to the 436915076 locus of chromosome 4 in example 3 of the present invention.
Detailed Description
The present invention will be described in further detail with reference to the following examples, which are intended to facilitate the understanding of the present invention without any limitation thereto. The specific conditions not noted in the examples were carried out according to the conventional conditions or the conditions suggested by the manufacturer, and the reagents or instruments used, not noted by the manufacturer, were conventional products available commercially.
The KASP Master Mix used in the examples below was purchased from LGC, inc. of England under the trade designation KBS-1016-001.
Example 1 development of Pisum sativum core SNP molecular markers based on KASP technology
Based on the Pea genome published in 2019 (https:// ugi. Versailles. Inra. Fr/jbrowse/gmod_jbrowse/.
Mainly comprises the following steps:
1. screening a preliminary data file according to MAF (minimum allele frequency) >5%, missing data (data deletion rate) < 10%;
2. according to MAF >0.4, MISS rate <0.2, heterozygo <0.2 (heterozygosity less than 0.2), and no other mutation information is screened out from 100bp upstream and downstream of the mutation site;
3. calculating PIC (polymorphic information content), he (expected heterozygosity) and Ho (observed heterozygosity) of each site aiming at the site screened in the step 2;
4. filtering according to LD (linkage disequilibrium), wherein the threshold value of preliminary filtering is 0.2;
5. the filtered loci are further filtered according to the non-synonymous mutation of the coding region, and finally 236 locus information is obtained.
6. The 236 sites were manually screened to remove heterozygous sites and 68 SNP sites were finally obtained in consideration of even distribution on the chromosome, and KASP primers were designed for PCR detection.
7. Genotype detection was performed on 135 parts of pea germplasm material collected using the 68 SNP markers screened above: the marking range is further narrowed by the number of the largest sample number distinguished by the smallest SNP, 5, 10, 15, 20, 25, 30 and 34 sites are randomly selected from 68 KASP detection sites, the number of materials can be distinguished by counting the sites (the difference between any two sites can be distinguished), 50 bootstraps are made, an average value (taking an integer) is taken for drawing, and the smallest 25 SNPs are found to distinguish all sample numbers (figures 1-2). Finally screening and constructing a set of pea core SNP molecular marker sets (table 1) containing 25 SNP markers, and having good stability and high information.
TABLE 1 SNP molecular marker set of pea core
For the pea core SNP molecular marker set as set forth in Table 1, KASP primer combinations of the pea core molecular marker set as set forth in Table 2 were designed, comprising any one or more and all of 25 primer pairs corresponding to SNPs 1-25, respectively, each primer pair comprising forward primer 1, forward primer 2 and reverse primer. The 5' end of the forward primer 1 is provided with a FAM fluorescent signal label; the 5' end of the forward primer 2 carries HEX fluorescent signal label.
TABLE 2 KASP primer combinations for pea core molecular marker sets
Example 2 method for identifying 142 parts of pea resources using 25 pea core SNP markers
1) Extraction of DNA
142 parts of pea leaves, and extracting genome DNA by adopting a CTAB method.
2) SNP genotyping using full-automatic PCR platform from LGC company
Specific KASP Primer mix and universal KASP Master mix composed of SNP markers numbered SNP1 to SNP25 in example 1 were added to a 96-well plate containing DNA samples, and water-bath PCR was performed after sealing the plates. The PCR reaction system comprises: 5-10 ng/. Mu.l pea genomic DNA 0.8. Mu.l, KASP Master Mix 0.8. Mu.l, primer Mix 0.05. Mu.l.
The standardized PCR amplification procedure used was:
pre-denaturation at 94 ℃ for 15min; denaturation at 94℃for 20S; renaturation/extension at 61 ℃ for 60s, wherein the annealing temperature is reduced by 0.6 ℃ in each cycle, and 10 cycles are taken; denaturation at 94℃for 20s and renaturation/extension at 55℃for 60s were performed for 26 cycles. Analysis of experimental results analysis was performed using the data analysis software Krake or KlumsterCaller of LGC, and the assay data was read using SNPviewer. Clicking on each primer name sees the corresponding typing result for each sample at that site (FIG. 3).
3) Analysis of results
142 parts of pea germplasm material were tested with 25 SNPs, of which 23 groups (66 parts) of material were clustered together completely (fig. 4), and genotypes were identical, indicating that these are synonym varieties (or germplasm resources). The result shows that 25 core SNP markers are suitable for constructing the fingerprint spectrum of pea varieties and the specific identification of resources.
Example 3 comparison of different pea core SNP marker sets
The inventors have screened another set of 25 core SNP markers during the screening process according to the method provided in example 1, but found that there are some cases of pea material that are indistinguishable when used for large scale genotyping of pea material.
The other set of pea core SNP marker sets is marked as a No. 2 core marker set, and the difference between the No. 2 core marker set and the pea core SNP marker set (No. 1 core marker set) provided in the embodiment 1 is that SNP2, SNP5 and SNP14 in the No. 2 core marker set are different, wherein SNP2 adopts 234765722 locus of chromosome 1, and allelic variation is A/C; SNP5 adopts 14940515 locus of chromosome 2, allelic variation is A/G; SNP14 adopts 436915076 locus of chromosome 4, and allelic variation is A/G.
The 234765722 locus of chromosome 1 adopts the primers:
forward primer 1: GAAGGTGACCAAGTTCATGCTCCTTAAGATTACCCATTCCAG
Forward primer 2: GAAGGTCGGAGTCAACGGATTCCTTAAGATTACCCATTCCAT
Reverse primer: TACTTAACACTTGTAGACAAAG
The 14940515 locus of chromosome 2 uses the primers:
forward primer 1: GAAGGTGACCAAGTTCATGCTGGTTCCTTTGCTAGAGAATGATA
Forward primer 2: GAAGGTCGGAGTCAACGGATTGGTTCCTTTGCTAGAGAATGATG
Reverse primer: GCTCTTTCTGTTCATTACCATGTGA
The 436915076 locus of chromosome 4 uses the primers:
forward primer 1: GAAGGTGACCAAGTTCATGCTGCCATTACAAGATCCTCTTCCAACA
Forward primer 2: GAAGGTCGGAGTCAACGGATTGCCATTACAAGATCCTCTTCCAACG
Reverse primer: TATGAAAGCAATAAAAGAAGGG
According to the method provided in example 2, when genotype detection is performed on 135 parts of pea germplasm resources by using a No. 1 core marker set, the genotype of 135 parts of pea germplasm resources can be distinguished by the No. 1 core marker set by 100% (fig. 2), which shows that 25 core SNP markers are suitable for constructing fingerprint patterns of pea varieties and specific identification of resources; the part of the materials cannot be distinguished by adopting the core marker set No. 2, and the 234765722 locus of chromosome No. 1, the 14940515 locus of chromosome No. 2 and the 436915076 locus of chromosome No. 4 are checked to have problems, so that genotyping is affected, wherein the genotyping result corresponding to the 234765722 locus of chromosome No. 1 is shown in fig. 5, the genotyping result corresponding to the 14940515 locus of chromosome No. 2 is shown in fig. 6, the genotyping structure corresponding to the 436915076 locus of chromosome No. 4 is shown in fig. 7, samples which are difficult to genotype are all present in the three loci, and gray regions (undetected) are also present among red (homozygous), blue (homozygous) or purple (heterozygous) regions, so that the three loci are not successfully typed.
After that, the primers of the three SNP loci are replaced for many times, but the problem of partial samples which are difficult to genotype cannot be solved all the time. The reason for this is probably that the 234765722 locus of chromosome 1, 14940515 locus of chromosome 2, 436915076 locus of chromosome 4, the presence of a gene having a very high homology with the surrounding, the presence of a highly homologous sequence, the presence of a heterozygous gene locus, and the GC-rich content, may cause the problem that when detecting 234765722 locus of chromosome 1, 14940515 locus of chromosome 2, 436915076 locus of chromosome 4, the absence of a peak at the locus is likely to occur, or the occurrence of an error in the homologous sequence is likely to occur, or both genotype results are likely to occur, and it is difficult to detect all loci at one time.
When the core marker set No. 1 is adopted, namely the 277489395 th site of the chromosome 1 is modified by the SNP2 site, the 65837220 th site of the chromosome 2 is modified by the SNP5 site and the 410691643 th site of the chromosome 4 is modified by the SNP14 site, the problems that the sequence is rich in GC, the homologous sequence is prevented from being amplified or the heterozygous site is prevented from being amplified and the like can be skillfully avoided, so that the problem of difficult typing is solved, and the accuracy of genotyping is greatly improved.
The SNP loci of the pea core molecular marker set are very critical to select, and even if a plurality of primers are replaced or specific primers are specially designed, accurate typing still cannot be realized, and the most suitable SNP loci must be selected to be combined into the pea core molecular marker set so as to be used for accurately identifying pea germplasm materials.
Example 4 detection of whether the pea variety to be tested is ' Zhejiang pea No. 1 ' using the pea core SNP marker set '
Based on 25 pea core SNP marker sets, SNP fingerprints of a pea variety 'ZhePisi No. 1' are constructed, and the fingerprints formed by 25 SNP markers consist of 50 bases because the SNP markers are two-position markers, and the core SNP fingerprints of the pea variety 'ZhePisi No. 1' are: GGGGTTTTGGCCAATTGGTTTTTTCCGGAAGGGGGGCCGGCCCCTTCCAA. The SNP fingerprints are subjected to two-dimensional code conversion by using a bar code online generator, so that SNP fingerprint two-dimensional codes of pea variety Zhejiang pea No. 1 are obtained, as shown in table 2.
Randomly selecting pea varieties to be detected, preparing DNA, and using 25 core SNP marker sets to carry out genotyping detection and obtain SNP fingerprints.
Analysis of results: the SNP fingerprint of the pea variety to be detected is compared with the SNP fingerprint of a real pea variety 'Zhejiang pea No. 1'. If the two types are identical, the pea variety to be detected is pea variety 'Zhejiang pea No. 1', otherwise, the pea variety to be detected is not.
TABLE 2 SNP fingerprint information of pea variety' Zhejiang pea No. 1
Although the present invention is disclosed above, the present invention is not limited thereto. Various changes and modifications may be made by one skilled in the art without departing from the spirit and scope of the invention, and the scope of the invention should be assessed accordingly to that of the appended claims.
Sequence listing
<110> academy of agricultural sciences in Zhejiang province
<120> pea core SNP molecular marker set developed based on KASP technology and application thereof
<160> 125
<170> SIPOSequenceListing 1.0
<210> 1
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gaaggtgacc aagttcatgc taagcctgga agctccaaga ctttca 46
<210> 2
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gaaggtcgga gtcaacggat taagcctgga agctccaaga ctttcg 46
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tcacatgatg gtgatcaata ag 22
<210> 4
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gaaggtgacc aagttcatgc tggtccaaag gactctacat gttga 45
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gaaggtcgga gtcaacggat tggtccaaag gactctacat gttgg 45
<210> 6
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
tgagcattac ctgcaggttt ccc 23
<210> 7
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
gaaggtgacc aagttcatgc tcgaatatgc ttgatagtga gat 43
<210> 8
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gaaggtcgga gtcaacggat tcgaatatgc ttgatagtga gaa 43
<210> 9
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
aggcccagag ctcgatcaat aa 22
<210> 10
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
gaaggtgacc aagttcatgc ttgtactctt atcgggatat at 42
<210> 11
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
gaaggtcgga gtcaacggat ttgtactctt atcgggatat aa 42
<210> 12
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
atgtagtgta tgtttagagg gtgaga 26
<210> 13
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
gaaggtgacc aagttcatgc tcacatcacc aagaacttca tgag 44
<210> 14
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
gaaggtcgga gtcaacggat tcacatcacc aagaacttca tgac 44
<210> 15
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
gaccgcaatt taaaaccacg at 22
<210> 16
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
gaaggtgacc aagttcatgc tggtttcttt ggttttgctt tcta 44
<210> 17
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
gaaggtcgga gtcaacggat tggtttcttt ggttttgctt tctc 44
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
ccataccaaa gcaatgccac ccg 23
<210> 19
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
gaaggtgacc aagttcatgc tggtcgtgga ggttcgataa taaaaa 46
<210> 20
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
gaaggtcgga gtcaacggat tggtcgtgga ggttcgataa taaaag 46
<210> 21
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
catagattcc tttaccatcc tc 22
<210> 22
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
gaaggtgacc aagttcatgc tacacttttc catctgcagg ctgaca 46
<210> 23
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
gaaggtcgga gtcaacggat tacacttttc catctgcagg ctgact 46
<210> 24
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
caacacagaa acaaaaaacc taagattac 29
<210> 25
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
gaaggtgacc aagttcatgc tgccaattga aatctccttc tcctgg 46
<210> 26
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
gaaggtcgga gtcaacggat tgccaattga aatctccttc tcctgc 46
<210> 27
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
ggttttcgaa cagagtaaga tccg 24
<210> 28
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
gaaggtgacc aagttcatgc tcaacccacc atgccatcat ta 42
<210> 29
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
gaaggtcgga gtcaacggat tcaacccacc atgccatcat tt 42
<210> 30
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
ccagcaaaag cagtatctaa gaag 24
<210> 31
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 31
gaaggtgacc aagttcatgc tggaggaaca tgatgtcttt gtct 44
<210> 32
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 32
gaaggtcgga gtcaacggat tggaggaaca tgatgtcttt gtcc 44
<210> 33
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 33
tagagcaatt cctccctcaa ta 22
<210> 34
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 34
gaaggtgacc aagttcatgc tatgtacagg agatgggaaa at 42
<210> 35
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 35
gaaggtcgga gtcaacggat tatgtacagg agatgggaaa ac 42
<210> 36
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 36
gacctcactg ctttcctgga ct 22
<210> 37
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 37
gaaggtgacc aagttcatgc tgactcattt atccaatctt cagcc 45
<210> 38
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 38
gaaggtcgga gtcaacggat tgactcattt atccaatctt cagct 45
<210> 39
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 39
gggtgatgag gggtttgagt tg 22
<210> 40
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 40
gaaggtgacc aagttcatgc tggtccacat tttgaaacat ggaata 46
<210> 41
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 41
gaaggtcgga gtcaacggat tggtccacat tttgaaacat ggaatg 46
<210> 42
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 42
ttaagtctct tctcccctcg tt 22
<210> 43
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 43
gaaggtgacc aagttcatgc tacagattct cctccttgag ca 42
<210> 44
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 44
gaaggtcgga gtcaacggat tacagattct cctccttgag cg 42
<210> 45
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 45
tcaaactact aacaatttta taacaggag 29
<210> 46
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 46
gaaggtgacc aagttcatgc tggcttagaa ggttgaacat cca 43
<210> 47
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 47
gaaggtcgga gtcaacggat tggcttagaa ggttgaacat ccg 43
<210> 48
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 48
tcagtgtcgt gtgagtgtct tg 22
<210> 49
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 49
gaaggtgacc aagttcatgc tagaacactc gaatcggcca ac 42
<210> 50
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 50
gaaggtcgga gtcaacggat tagaacactc gaatcggcca ag 42
<210> 51
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 51
atgaaggaaa aggcatgcgg ttagca 26
<210> 52
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 52
gaaggtgacc aagttcatgc ttcagtgact cctctgcctc 40
<210> 53
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 53
gaaggtcgga gtcaacggat ttcagtgact cctctgcctg 40
<210> 54
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 54
tcttcttcac atgttgcttg caa 23
<210> 55
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 55
gaaggtgacc aagttcatgc tcagtgatac aacacagagg gttgac 46
<210> 56
<211> 46
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 56
gaaggtcgga gtcaacggat tcagtgatac aacacagagg gttgaa 46
<210> 57
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 57
gagtaggaag tatcatcctg caa 23
<210> 58
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 58
gaaggtgacc aagttcatgc tacagcctat tgggtgtttg cctg 44
<210> 59
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 59
gaaggtcgga gtcaacggat tacagcctat tgggtgtttg ccta 44
<210> 60
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 60
gcaactcgtt gtgcttcgtg ac 22
<210> 61
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 61
gaaggtgacc aagttcatgc tcaataatcc ttctttggat ttct 44
<210> 62
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 62
gaaggtcgga gtcaacggat tcaataatcc ttctttggat ttcc 44
<210> 63
<211> 25
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 63
attgtgaaca ttgttctcaa acatg 25
<210> 64
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 64
gaaggtgacc aagttcatgc tgcaattcac tcatcacttc 40
<210> 65
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 65
gaaggtcgga gtcaacggat tgcaattcac tcatcacttg 40
<210> 66
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 66
ggagggtaaa ggtattgcca tg 22
<210> 67
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 67
gaaggtgacc aagttcatgc tgtgggaaag aaatttttgc tgaac 45
<210> 68
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 68
gaaggtcgga gtcaacggat tgtgggaaag aaatttttgc tgaat 45
<210> 69
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 69
ttctactcgg attcggtatg ag 22
<210> 70
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 70
gaaggtgacc aagttcatgc tcttcaatgc catgcttgta ag 42
<210> 71
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 71
gaaggtcgga gtcaacggat tcttcaatgc catgcttgta ac 42
<210> 72
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 72
tgcagcaaga ctcagaaaaa tt 22
<210> 73
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 73
gaaggtgacc aagttcatgc tcggaataat aattcacaac tctag 45
<210> 74
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 74
gaaggtcgga gtcaacggat tcggaataat aattcacaac tctaa 45
<210> 75
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 75
atatttttgc cacggccggc cga 23
<210> 76
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 76
tttaattctc attagcctca ttgccgcatt ccttatcact acatagttat ccatgaattc 60
ctcatccacg acatcgaagc ctggaagctc caagactttc 100
<210> 77
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 77
aaaccaagtc accatatggt atccatgttg ctcccttctt attgatcacc atcatgtgat 60
ggatcacaat actggcccaa tttgtttcaa ttttgttggc 100
<210> 78
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 78
aatttggaag agatactgtg aaaataagta gagatttttg aaaagtttct cttatgagca 60
ttacctgcag gtttcccatt tagcaggctt atgatcagga 100
<210> 79
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 79
caacatgtag agtcctttgg acctcgggta gattgaagta tatagtgctg tgcttctcgg 60
tgcaaggatc atacgcactt ctgagtcttc ggataccctg 100
<210> 80
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 80
tctcaaaata gtttgcctac aacaattaat gccaaaactg atgtctcaga tgatttctct 60
gccaaagatt caagtacaac gaatatgctt gatagtgaga 100
<210> 81
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 81
attatccaac attggtggaa atggcttagc atctgtctcc cctcaacttg aagaacttat 60
tgatcgagct ctgggccttg gatctgttgc caaatcaaat 100
<210> 82
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 82
gtggaggttt gttgaaatca tcttcattta agaatatgtt atcgtaactc gacggaggcg 60
acgatggatc ttcagaattt tgtactctta tcgggatata 100
<210> 83
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 83
tcctggaata gtagaagtta caattagtct caccctctaa acatacacta catgtacatg 60
accgtctttt tattaccgca tatggcccga atatgtggtt 100
<210> 84
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 84
gtgaccgcaa tttaaaagca accgtgaccg caatttaaaa ccacgatata tgtaaataat 60
atacatatat atctaattac atgccttgat gttaggaaga 100
<210> 85
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 85
tcatgaagtt cttggtgatg tgaacaacta gcttgtccat aaaagcagga gcaatgtaaa 60
atccatccat catattgtca aggttgtacc tgaaataacc 100
<210> 86
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 86
gataagagac cagatatctt tattgtaatg taaacttggt ctgaccctaa caatttaatt 60
cgtacttttt ctagattagg tttctttggt tttgctttct 100
<210> 87
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 87
tgaatctcga ggctttgcgg gtggcattgc tttggtatgg gaatctaatt gaatgtaaat 60
gaccatttta aagcaacact tttaattcct tcactctaaa 100
<210> 88
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 88
tttccgatta gtactccgca taatgaagag gttgcaaatg cggttaagat cattgaagaa 60
cacttgaagg ttcatcggtc gtggaggttc gataataaaa 100
<210> 89
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 89
caatgcaagt tgtgaggatg gtaaaggaat ctatgtgtat gatttaccat ctaagtttaa 60
caaggatttg gttggtcagt gcagtgacat gcttccatgg 100
<210> 90
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 90
ttatgaagaa acaaattgta tggaaatttc caacacagaa acaaaaaacc taagattacc 60
tttctccatg gaccagctct tgatgaggaa tgagtctggc 100
<210> 91
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 91
gtcagcctgc agatggaaaa gtgtaaaggg aagataactt agccaagcag aatgaccttg 60
gatgaatagc aatacgaaaa agaaaataaa aaaaatctga 100
<210> 92
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 92
gctaaaatca tgttagtaga tgcttgtttt ttgttagagc ttctcatatc aaaagagtta 60
gatcatgaac taccatgcca attgaaatct ccttctcctg 100
<210> 93
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 93
acctcaactc ctgagagacg aagatgtctt gtcggatctt actctgttcg aaaaccagat 60
cccggttttc gtcctccacg agctttctcg aaagcttttc 100
<210> 94
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 94
tggtgtagga aacagtccaa tcaaagtaaa caaaagggtc accagcaaaa gcagtatcta 60
agaagaaaca tagaagtgtt gtgaagaacc aacaagagga 100
<210> 95
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 95
aatgatggca tggtgggttg aaagtactat cgcttatctt ctcaagatgt atagagagag 60
ggaggaagaa ggtgttgagg tgaatgaaag ttggcagaga 100
<210> 96
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 96
aagtaaacaa agtgttaacc ttcattagga ggtgggtgtg gcagtgtctt ggaagaagaa 60
ccaggtggag atactctagg aggaacatga tgtctttgtc 100
<210> 97
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 97
accagttgtt ggtgatattg agggaggaat tgctctatct agatcaaaaa ttgtaaaatt 60
aaaactactt atatattcag ttgcagccaa gaactttatt 100
<210> 98
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 98
tttcgttaaa ttaataaaac atgattattt gaaaacattg atcacaaaat ttgcaaaaac 60
aaagagtgta ttgaggtgtt atgtacagga gatgggaaaa 100
<210> 99
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 99
tgtgcgtcca gttgacgagt ccaggaaagc agtgaggtca accatgtctt ctacatttaa 60
attgatgccc gtctcttctt caacctgtta gaatcacaac 100
<210> 100
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 100
accacctatt tctcctatcc atttccttga tataagcacc tttattaaca tgcacaatat 60
catagttatt ttcaaatgac tcatttatcc aatcttcagc 100
<210> 101
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 101
attgtcaata tctccaactc aaacccctca tcacccctct tttggtttct attaccgttt 60
agttcttctt tgaaaaattc caacaaaact atacctaaat 100
<210> 102
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 102
gtggtgaatg tgtgaagaac cttgtatgac catttctgcc atgttaagtc tcttctcccc 60
tcgttgagac cattcaacga aattggacca agaacaccag 100
<210> 103
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 103
attccatgtt tcaaaatgtg gaccaacatt ctgcatataa atgcgccaaa tgattagcat 60
ggactaaagt tcatattttt agacacgggg atgcttagag 100
<210> 104
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 104
atcttcttca tctggttatt caaattcaaa ctactaacaa ttttataaca ggagattatg 60
aaatcttgtc caaagaaaga cattgagaat ttcaaagatt 100
<210> 105
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 105
gctcaaggag gagaatctgt atataaatat agaggtaagt ataattaacg aaataattcg 60
atttttctga aatttgaatt ttgaatcgat atttttgtta 100
<210> 106
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 106
aatgaataca ttgtacgtat tcacaggtgt tagtaatcac aagtgtcagt gtcgtgtgag 60
tgtcttgagg atttaacatt agtgatcatc accacgaata 100
<210> 107
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 107
ggatgttcaa ccttctaagc caaatagaat gaatagtcat atggaaaata tcgaacctct 60
ttggtggctc attaggaaca aaatgccttt gaacttgttt 100
<210> 108
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 108
gctggagttg ttcgcgtgtt gcggatcagt gtgccagtat tccgatgaag gaaaaggcat 60
gcggttagca gttgcatgtg ctgtggaatg agttgccccg 100
<210> 109
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 109
ttggccgatt cgagtgttct aaagagaggg acttggtatc gtatgcaccc catgaattgg 60
ttgacagaag agagagagca cggttaacat cttgcgtagc 100
<210> 110
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 110
acaacacctt aaaaaccgtg ttagatcgta ttctcaagca aagaatctct cttcttcttc 60
acatgttgct tgcaaattga aggatgagaa gaaggcaaag 100
<210> 111
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 111
aggcagagga gtcactgagg actgtcatgt acttgagctg ctggggtccc aattgattca 60
ttgctacata tatagtgata caagattaat tatgtctaat 100
<210> 112
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 112
tctcagttaa ttaatttagt aaaatatgca ttgaactatt tcaggaactg catgagaaaa 60
gtggttcgcc aaaggacagt gatacaacac agagggttga 100
<210> 113
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 113
agaaaaacca ttcaaacttc aacaggttca gcaactttta gtattgcagg atgatacttc 60
ctactctact attatgcatc aataaattgt ctattagatg 100
<210> 114
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 114
ttcagatctt gcacagtttt gagaagcaac tcgttgtgct tcgtgacgag catgtttaac 60
gtttcattgc acttagcaaa agaagatggt gtagttatta 100
<210> 115
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 115
aggcaaacac ccaataggct gtaataatcc aactgttatt ttctttattc ctacgctatg 60
aatgcgttta agatttaatg acaattggtt tataagtgaa 100
<210> 116
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 116
tagaaattgt cttggatttg acaattgtga acattgttct caaacatgtt tgcaacattt 60
tttgaggttt ctgaagtttc tagtggctgt gaaaattgga 100
<210> 117
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 117
gaaatccaaa gaaggattat tgaagctggt tgacacatga tttccacttg aagcatctat 60
gaatcctctt tgtgaaggaa cattgaagct tgttgagatt 100
<210> 118
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 118
attagatagc ttagagtttg acatatccat ataaaatata acattcaagc tagcttctcc 60
tcaagtagaa gaaaaaaaag atgcaattca ctcatcactt 100
<210> 119
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 119
ataagatcat tggcaatagg tagtgcttta cacagagcct taaatgggat ctttttaggc 60
atggcaatac ctttaccctc catcatatca agtttctcct 100
<210> 120
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 120
ggcttgttct aacacatttg gacttgttac tggtgcattt ctactcggat tcggtatgag 60
tgaaattcca aagggtattt ggttgaatgc aaattggacc 100
<210> 121
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 121
ttcagcaaaa atttctttcc cacaaagttg caaaaatggc tgtcaaatta gacgacgctc 60
atcaagattt ttcaaatgct atcgttgtaa gttattcata 100
<210> 122
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 122
gttgtattaa aagaccagta gctaaacaga aggtaaataa ccataatcta ggcaacacat 60
aattgtttga tgtactattt cttcaatgcc atgcttgtaa 100
<210> 123
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 123
taaaacccaa atcttttagc ttctttgatg aaatttcaga aggaacctta tcataatttt 60
tctgagtctt gctgcatgta tatgtaggaa taacatcaga 100
<210> 124
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 124
gatagaagtt ttgatgaaaa cggttcttga atatttttgc cacggccggc cgaggtacga 60
cttaaccgag ctagggttta ggtccgacgc ggccgtgacc 100
<210> 125
<211> 100
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 125
tagagttgtg aattattatt ccggtgtttt ggtttggatc ggttcggcct tgagccgtaa 60
cagtgattgt tttttgagga gggtttctcg cgataatgtt 100
Claims (10)
1. The pea core SNP molecular marker set based on KASP is characterized by comprising 25 core SNP markers, wherein the 25 core SNP markers are numbered SNP 1-SNP 25; the SNP1 to SNP25 are shown in the following table:
2. A KASP primer for detecting the pea core SNP molecular markers of claim 1, characterized by comprising any one or more and all of 25 primer pairs corresponding to SNPs 1-25, respectively, each primer pair comprising forward primer 1, forward primer 2 and reverse primer, in particular as set forth in the following table:
3. the primer combination of claim 2, wherein the 5' end of forward primer 1 carries a FAM fluorescent signal tag; the 5' end of the forward primer 2 is provided with HEX fluorescent signal label, and the reverse primer 3.
4. A reagent, chip or kit comprising any one or more of the primer combinations of claim 2 or 3.
5. A method for detecting pea genotypes by using the primer combination as claimed in claim 2 or 3, comprising the steps of:
(1) Extracting DNA of pea varieties to be detected;
(2) Performing PCR amplification by using the DNA obtained in the step (1) as a template, and adding Primer mix and KASP Master mix (LGC, biosearch Technologies); the Primer mix is the Primer set according to claim 3.
(3) And detecting and analyzing the amplification result, and determining the genotype of the pea variety to be detected at the SNP molecular marker locus corresponding to each group of primers.
6. The method of claim 5, wherein the PCR reaction system of step (2) is: 5-10 ng/. Mu.l pea genomic DNA 0.8. Mu.l, KASP Master Mix 0.8. Mu.l, primer Mix 0.05. Mu.l.
7. The method of claim 6, wherein the PCR reaction procedure of step (2) is: pre-denaturation at 94 ℃ for 15min; denaturation at 94℃for 20S; renaturation/extension at 61 ℃ for 60s, wherein the annealing temperature is reduced by 0.6 ℃ in each cycle, and 10 cycles are taken; denaturation at 94℃for 20s and renaturation/extension at 55℃for 60s were performed for 26 cycles.
8. The method of claim 7, wherein the PCR of step (2) is performed using a high throughput IntelliQube (LGC) genotyping assay platform.
9. The method of claim 8, wherein step 3) is performed by data analysis software Kraken or klustercaler using LGC.
10. Use of the molecular marker set of claim 1 or the primer combination of claim 2 or 3 or the reagent, chip or kit of claim 4 for identifying pea genotypes, identification of pea variety authenticity, identification of pea variety purity, construction of pea SNP fingerprint library, analysis of pea genetic diversity, or pea molecular marker assisted breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111473981.8A CN116219048A (en) | 2021-12-02 | 2021-12-02 | Pea core SNP molecular marker set developed based on KASP technology and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111473981.8A CN116219048A (en) | 2021-12-02 | 2021-12-02 | Pea core SNP molecular marker set developed based on KASP technology and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116219048A true CN116219048A (en) | 2023-06-06 |
Family
ID=86584767
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111473981.8A Pending CN116219048A (en) | 2021-12-02 | 2021-12-02 | Pea core SNP molecular marker set developed based on KASP technology and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116219048A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117144037B (en) * | 2023-08-31 | 2024-02-20 | 山东省农业科学院 | Molecular marker set of onion core SNP and application thereof |
-
2021
- 2021-12-02 CN CN202111473981.8A patent/CN116219048A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117144037B (en) * | 2023-08-31 | 2024-02-20 | 山东省农业科学院 | Molecular marker set of onion core SNP and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | A high-density SNP genotyping array for rice biology and molecular breeding | |
| US9976191B2 (en) | Rice whole genome breeding chip and application thereof | |
| WO2021226806A1 (en) | Brassica napus l. high-density whole genome snp chip, and application thereof | |
| CN105950747A (en) | Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof | |
| CN110241252B (en) | SNP molecular marker combination for constructing peach DNA fingerprint spectrum, application and method | |
| CN110894542A (en) | Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer | |
| CN110541041B (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN108103239B (en) | SNP molecular marker A045736268C/T for identifying Chinese cabbage turnip mosaic virus disease resistance and application thereof | |
| CN114480704A (en) | SNP combined marker for identifying eggplant seed resources | |
| CN112522433B (en) | SNP marker closely linked with tomato root knot nematode resistant gene Mi1 and application thereof | |
| CN116219048A (en) | Pea core SNP molecular marker set developed based on KASP technology and application thereof | |
| CN102732514B (en) | Identification method for chemotactic factor acceptor 9 gene used as molecular marker for bovine excellent superovulation trait and application of same | |
| de Miguel et al. | Annotated genetic linkage maps of Pinus pinaster Ait. from a Central Spain population using microsatellite and gene based markers | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| KR101630814B1 (en) | SNP molecular markers associated with distinction of grape understock variety and uses thereof | |
| CN113355449B (en) | Elytrigia elongata 3E chromosome specific codominant KASP molecular marker and application thereof | |
| CN110592260B (en) | Competitive allele specific polymerase chain reaction marker of hard wheat adult plant leaf rust resistant locus and application thereof | |
| CN107354203B (en) | Primer combination and kit for identifying cured tobacco Bina No. 1, application and detection method | |
| CN107354201B (en) | Primer combination and kit for identifying flue-cured tobacco yunyan 97, application and detection method | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof | |
| CN107354205B (en) | Primer combination and kit for identifying tobacco 100 in flue-cured tobacco, application and detection method | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |