KR101630814B1 - SNP molecular markers associated with distinction of grape understock variety and uses thereof - Google Patents

SNP molecular markers associated with distinction of grape understock variety and uses thereof Download PDF

Info

Publication number
KR101630814B1
KR101630814B1 KR1020130139383A KR20130139383A KR101630814B1 KR 101630814 B1 KR101630814 B1 KR 101630814B1 KR 1020130139383 A KR1020130139383 A KR 1020130139383A KR 20130139383 A KR20130139383 A KR 20130139383A KR 101630814 B1 KR101630814 B1 KR 101630814B1
Authority
KR
South Korea
Prior art keywords
seq
grape
primer set
snp
dna
Prior art date
Application number
KR1020130139383A
Other languages
Korean (ko)
Other versions
KR20150056407A (en
Inventor
허윤영
노정호
정성민
남종철
박서준
박교선
황해성
Original Assignee
대한민국
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국 filed Critical 대한민국
Priority to KR1020130139383A priority Critical patent/KR101630814B1/en
Publication of KR20150056407A publication Critical patent/KR20150056407A/en
Application granted granted Critical
Publication of KR101630814B1 publication Critical patent/KR101630814B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Abstract

본 발명은 서열번호 1 및 서열번호 2로 이루어진 프라이머 세트, 서열번호 3 및 서열번호 4로 이루어진 프라이머 세트, 서열번호 5 및 서열번호 6으로 이루어진 프라이머 세트, 서열번호 7 및 서열번호 8로 이루어진 프라이머 세트, 서열번호 9 및 서열번호 10으로 이루어진 프라이머 세트, 서열번호 11 및 서열번호 12로 이루어진 프라이머 세트, 서열번호 13 및 서열번호 14로 이루어진 프라이머 세트, 서열번호 15 및 서열번호 16으로 이루어진 프라이머 세트, 서열번호 17 및 서열번호 18로 이루어진 프라이머 세트 및 서열번호 19 및 서열번호 20으로 이루어진 프라이머 세트를 포함하는 군에서 적어도 하나가 선택된 포도 대목 품종을 판별할 수 있는 프라이머 세트 및 이를 이용하여 포도 대목 품종을 판별하는 방법에 관한 것이다.The present invention provides a primer set comprising the primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2, the primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6, the primer set consisting of SEQ ID NO: , A primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer set consisting of SEQ ID NO: 11 and SEQ ID NO: 12, a primer set consisting of SEQ ID NO: 13 and SEQ ID NO: 14, a primer set consisting of SEQ ID NO: A primer set capable of discriminating at least one selected grape seedling from the group comprising a primer set consisting of SEQ ID NO: 19 and SEQ ID NO: 20, and a grape seedling variety using the same. .

Description

포도 대목 품종 판별 연관 SNP 분자마커 및 이의 용도{SNP molecular markers associated with distinction of grape understock variety and uses thereof}[0002] SNP molecular markers and their uses [0002] SNP molecular markers associated with distinction of grape understock variety and uses thereof [

본 발명은 고추와 관련된 SNP 분자마커에 관한 것으로, 더욱 상세하게는 고추의 특이 품종을 구분할 수 있는 SNP 분자마커와 이를 이용한 고추의 특이 품종을 구분할 수 있는 방법에 관한 것이다.The present invention relates to a SNP molecular marker related to red pepper, and more particularly, to a method for distinguishing a SNP molecular marker capable of distinguishing a specific kind of red pepper from a specific type of red pepper using the same.

포도는 재배 역사가 길고 낙엽과수 중 전세계에서 재배 면적이 가장 넓은 과수이며, 재배 지역의 환경조건이나 과실의 이용 방법에 따라 다양한 품종이 육성되었다. 우리나라에서는 1906년에 원예모범장을 설치하고 수많은 포도 품종을 외국으로부터 도입하여 시험 재배하기 시작하였는데 켐벨얼리(Campbell Early)등을 제외한 많은 구미 개량 품종은 환경조건에 잘 맞지 않아 대부분 도태 되었다(Lee 등, 1999).Grapes have long cultivation history and have the largest cultivated area in deciduous and underwater world, and various cultivars have been cultivated according to the environmental condition of the cultivation area and how to use fruits. In Korea, a horticulture model was set up in 1906, and many grape varieties were introduced from abroad. However, most of the improved varieties except for Campbell Early were culled because they did not fit the environmental conditions (Lee et al. , 1999).

포도의 개량을 위해서는 접목묘의 품질이 매우 중요하다. 따라서 이러한 접목묘의 품질을 공인하기 위한 기술이 요구되고 있다. 과실의 특성이나 엽형 등 지상부의 표현형으로 구분이 가능한 접수 품종과 달리, 대목은 접목 이후 지하부 특성만으로 품종을 확인하는 것이 불가능하기 때문이다. 따라서, 생명공학 계통에서 이를 판별하기 위한 기술 개발이 진행되고 있다.Grape quality is very important for the improvement of grapes. Therefore, a technique for certifying the quality of such grafted seedlings is required. Unlike the acceptance varieties that can be distinguished by the phenotypes such as the fruit characteristics and the leaf type, it is impossible to identify the varieties only by the characteristics of the undergrowth after the grafting. Therefore, development of technology for discrimination in biotechnology system is proceeding.

특히, 1996년 Steiner와 Muller가 18s rDNA 염기서열 분석의 방법으로 쌍각류 연체 동물의 계통분류로써 신뢰성 있는 자료가 될 수 있다고 주장한 이후로, 많은 과학자들이 다양한 고등 생명체의 계통 분류에 18s rDNA 염기서열 분석의 방법을 이용한 바 있다. 이에 따라서 포도의 대목을 판별하는데에 18s rDNA 염기서열 분석을 이용하기 위한 시도도 있었으나, 아직 실용적이지 못하고 실제 적용하기에 어려움이 많았기 때문에 더 많은 개발이 요구되는 실정이다.In particular, since Steiner and Muller in 1996 asserted that 18s rDNA sequence analysis could be reliable data for phylogenetic classification of bivalve mollusk, many scientists have used 18s rDNA sequence analysis . Therefore, there has been an attempt to use 18s rDNA sequence analysis to identify grape leaves, but it has not been practical yet and is difficult to apply in practice.

한국 공개특허문헌 제10-2013-0102032호Korean Patent Publication No. 10-2013-0102032

본 발명은 포도 대목 품종을 판별할 수 있는 SNP 분자마커를 제공하여 이를 통한 정확한 대목 품종 유통을 가능하게 하여 포도 산업의 안정성에 기여하고자 한다.The present invention provides SNP molecular markers capable of discriminating grape varieties, thereby enabling accurate distribution of varieties and thereby contributing to the stability of the grape industry.

본 발명의 일측면은 포도 대목의 게놈 DNA를 분리하는 단계. 상기 단계의 DNA를 주형으로, 서열번호 1 및 서열번호 2로 이루어진 프라이머 세트, 서열번호 3 및 서열번호 4로 이루어진 프라이머 세트, 서열번호 13 및 서열번호 14로 이루어진 프라이머 세트 및 서열번호 19 및 서열번호 20으로 이루어진 프라이머 세트를 포함하는 포도 대목 품종 중 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 또는 Couderc 3309를 판별할 수 있는 프라이머 세트를 이용하여 중합효소연쇄반응(PCR)을 수행하는 단계 및 68℃에서 90℃까지 0.2℃씩 올리면서 각 온도에서 5초간 유지하는 동안 형광을 측정하여 유전자형을 분석하는 HRM(High Resolution Melting) 분석을 통하여 상기 PCR 산물을 검출하는 단계를 포함하는 포도 대목 품종을 판별하는 방법을 제공할 수 있다.One aspect of the present invention is a method for isolating genomic DNA of grape leaves. The primers set of SEQ ID NO: 1 and SEQ ID NO: 2, the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, the primer set of SEQ ID NO: 13 and SEQ ID NO: 14, and the primer set of SEQ ID NO: (PCR) using a primer set capable of discriminating 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 or Couderc 3309 among grape varieties including a primer set consisting of 20 primers And detecting the PCR product by HRM (High Resolution Melting) analysis, wherein the genotype is analyzed by measuring the fluorescence while maintaining the temperature for 5 seconds at each temperature while increasing the temperature from 68 ° C to 90 ° C by 0.2 ° C. It is possible to provide a method of discriminating a variety.

삭제delete

삭제delete

본 발명의 일측면에 따른 프라이머 세트는 포도 대목 품종을 판별할 수 있기 때문에 이를 통한 포도 대목 품종 판별로 정확한 대목 품종 유통이 가능할 수 있으며 포도 산업의 안정성에 기여할 수 있다.Since the primer set according to one aspect of the present invention is capable of discriminating grape varieties, it is possible to accurately distribute varieties of grapevines through the identification of grape varieties, thereby contributing to the stability of the grape industry.

도 1은 본 발명의 일 측면에 따른 10쌍의 분자마커의 HRM 분석 패턴 결과를 나타낸 그래프이다. 1 is a graph showing HRM analysis pattern results of ten pairs of molecular markers according to one aspect of the present invention.

본 명세서에 있어서, "프라이머"는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 하기 프라이머의 길이 및 서열은 연장산물의 합성을 시작하도록 허용해야 한다. 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라 온도 및 이온 강도와 같은 프라이머 이용 조건에 의존할 것이다.As used herein, "primer" refers to a single stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of the primer extension product. The length and sequence of the following primers should be allowed to start the synthesis of the extension product. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

서열번호 1 내지 20으로 표시되는 염기서열은 본 발명의 일측면에 따른 실시예로서 제시되는 포도 대목의 품종을 판별하기 위한 분자마커의 염기서열을 나타낸다. 홀수 서열은 정방향(forward) 프라이머를 나타내며, 짝수 서열은 역방향(reverse) 프라이머를 나타낸다.The nucleotide sequences shown in SEQ ID NOS: 1 to 20 represent the nucleotide sequences of the molecular markers for discriminating the grape varieties shown as examples according to one aspect of the present invention. The odd sequence represents a forward primer and the even sequence represents a reverse primer.

본 발명의 일측면에 따른 분자마커는 현재 유통되고 있는 포도 접목묘의 품질 인증을 위해 대목 품종 판별하기 위한 것일 수 있다. 이는 과실특성이나 엽형 등 지상부의 표현형으로 구분이 가능한 접수 품종과 달리, 대목은 접목 이후 지하부 특성만으로 품종을 확인하는 것이 불가능하기 때문이다.The molecular marker according to one aspect of the present invention may be one for discriminating the species of the grape for the quality certification of grape grafts currently distributed. This is because, unlike the acceptance varieties which can be distinguished into the phenotypes such as fruit characteristics and leaf type, it is impossible to identify the varieties only by the characteristics of the undergrowth after the grafting.

본 발명의 일측면에 따른 분자마커를 이용하는 경우, 국내 주요 포도 대목 품종인 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306, Couderc 3309 등 7품종을 판별할 수 있다. 특히, 이 중 Vsnp0001, 02, 07, 10 등 4종의 SNP 분자표지 조합을 이용하면 188.08 등 7개 품종 판별이 가능할 수 있다.In the case of using the molecular marker according to one aspect of the present invention, it is possible to discriminate the seven major varieties such as 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 and Couderc 3309. In particular, using the combination of four SNP molecular markers such as Vsnp0001, 02, 07, and 10, it is possible to discriminate 7 kinds such as 188.08.

개발된 SNP 분자마커를 이용한 품종 판별의 결과The results of the identification of the varieties using the developed SNP molecular markers 품종명Breed name Vsnp0001Vsnp0001 Vsnp0002Vsnp0002 Vsnp0007Vsnp0007 Vsnp0010Vsnp0010 188.08188.08 CC CC A2A2 A1A1 Kober 5BBKober 5BB AA CC BB BB SO4SO4 AA BB A1A1 BB Teleki 5CTouch 5C AA CC H2H2 BB Teleki 8BTouch 8B BB CC A1A1 A2A2 Couderc 3306Couderc 3306 AA CC H1H1 A1A1 Couderc 3309Couderc 3309 AA CC H1H1 H1H1 Campbell Early (접수품종)Campbell Early (reception varieties) HH AA A1A1 A1A1

이하, 그 구체적인 실시예를 제시한다. 그러나 본 발명의 권리범위가 하기 실시예에 국한되는 것은 아니며 통상의 기술자가 용이하게 도출할 수 있는 범위를 모두 포함한다고 해석함이 타당할 것이다.Hereinafter, specific embodiments will be described. It will be appreciated, however, that the scope of the present invention is not limited to the following examples, but includes all possible ranges that can be easily derived by a person skilled in the art.

SNP 탐색 및 primer 제작SNP search and primer production

같은 교배조합에서 유래한 Kober 5BB, SO4, Teleki 5C, Teleki 8B 등 포도 대목 4 품종 염기 서열 분석 후 포도 표준유전체에 mapping하는 과정을 거친다.Kober 5BB, SO4, Teleki 5C, and Teleki 8B, which are derived from the same crossbreeding combination, are subjected to a mapping process to grape standard genomes after analyzing four grape seedlings.

SNP(Single Nucleotide Polymorphism) 구간 탐색을 한 결과가 하기 표 2에 나타나 있다.SNP (Single Nucleotide Polymorphism) section search results are shown in Table 2 below.

SNP 탐색 결과SNP search result 표2. SNPs detection from whole genome sequencingTable 2. SNPs detection from whole genome sequencing SampleSample No. of SNPs in totalNo. of SNPs in total No. of SNPs in intergenicNo. of SNPs in intergenic SNPs in genicSNPs in genic No. of UTRNo. of UTR No. of CDSNo. of CDS No. of IntronNo. of Intron No. of genesNo. of genes 8B8B 174567174567 6527965279 37953795 1431914319 9117591175 1444814448 5BB5BB 167937167937 6269762697 36703670 1373613736 8783587835 1436514365 5C5C 170390170390 6375763757 36963696 1386313863 8907589075 1438714387 SO4SO4 170944170944 6370463704 37463746 1404014040 8945589455 1440714407

상기 SNP를 탐색한 결과를 기초로하여 SNP를 선택하는 과정을 거친다. SNP 선택시 보이는 염기서열을 기준으로 앞(forward), 뒤(backward) 300bp 구간에는 SNP가 존재하지 않는 구간만 선발하였다. 전체 SNP 중 위 조건을 만족하는 10개 SNP를 선발하였다. 그 결과가 하기 표 3에 나타나있다.And selecting a SNP based on the result of searching for the SNP. For the forward and backward 300bp regions, only the regions where no SNP existed were selected based on the nucleotide sequence selected when the SNP was selected. Of the total SNPs, 10 SNPs satisfying the above conditions were selected. The results are shown in Table 3 below.

SNP 선발 결과SNP selection result 표3. Summary of SNPs PositionTable 3. Summary of SNPs Position NameName Chr.Chr. PositionPosition Ref.Ref. 8B8B 5BB5BB 5C5C SO4SO4 Vsnp0001Vsnp0001 chr1chrl 1941145319411453 AA GG AA AA AA Vsnp0002Vsnp0002 chr4chr4 1433981914339819 AA AA AA AA GG Vsnp0003Vsnp0003 chr6chr6 74123567412356 AA AA GG AA GG Vsnp0004Vsnp0004 chr7chr7 64041476404147 GG GG GG AA GG Vsnp0005Vsnp0005 chr11chr11 19502611950261 AA GG GG AA AA Vsnp0006Vsnp0006 chr15chr15 1293546212935462 AA AA AA AA GG Vsnp0007Vsnp0007 chr17chr17 15044661504466 GG GG GG AA GG Vsnp0008Vsnp0008 chr17chr17 75795127579512 AA AA GG AA AA Vsnp0009Vsnp0009 chr17chr17 1207194912071949 AA AA GG AA AA Vsnp0010Vsnp0010 chrUnchrun 2286128822861288 AA GG AA AA AA

상기 결과를 토대로 SNP의 보이는 염기서열의 앞, 뒤 300bp 염기서열을 Primer3 프로그램에 입력하여 SNP primer를 제작하였다. 그 결과가 하기 표 4에 나타나 있다. 그리고 하기 표 4의 위에서부터 차례대로 forward와 reverse 순서로 서열번호는 매겨진다.Based on the above results, SNP primers were constructed by inputting the 300bp nucleotide sequence before and after the visible nucleotide sequence of the SNP into the Primer3 program. The results are shown in Table 4 below. Sequence numbers are assigned in forward and reverse order from the top of Table 4 below.

SNP 프라이머 정보SNP primer information 표4. Development of SNP primersTable 4. Development of SNP primers NameName Forward primerForward primer TmTm Reverse primerReverse primer TmTm Vsnp0001Vsnp0001 ACCCACTAGACTAATTGGTCTCAACCCACTAGACTAATTGGTCTCA 58.3258.32 AGGCTTCTTCATGGAGTTCTAGGCTTCTTCATGGAGTTCT 56.1456.14 Vsnp0002Vsnp0002 TGGCAACTGACTCAGCAACATGGCAACTGACTCAGCAACA 60.1160.11 TGGAAGTTTCTTATTGTTGCTCTTGGAAGTTTCTTATTGTTGCTCT 56.3756.37 Vsnp0003Vsnp0003 GGGGTCCTTTGTTCCATTTGCGGGGTCCTTTGTTCCATTTGC 6060 TCCTCCCTTCAGAATGGCTGTCCTCCCTTCAGAATGGCTG 59.0959.09 Vsnp0004Vsnp0004 GTGTCCATGACCAGGGGAAAGTGTCCATGACCAGGGGAAA 59.659.6 AAGCACACATTTGGCTTGTCCAAGCACACATTTGGCTTGTCC 59.9359.93 Vsnp0005Vsnp0005 GGGAAGGTGACGAGGCTAATGGGAAGGTGACGAGGCTAAT 59.1759.17 GCTCTTTGGGGTGCAACTTGGCTCTTTGGGGTGCAACTTG 59.9759.97 Vsnp0006Vsnp0006 TCACATTGATGGGAACTGCGTCACATTGATGGGAACTGCG 58.5558.55 ACAGCACAACCAACCCTTCTACAGCACAACCAACCCTTCT 59.7459.74 Vsnp0007Vsnp0007 GACTTTTGGCTTTACAGAGTGGTGACTTTTGGCTTTACAGAGTGGT 59.1259.12 TCTTCCTGAATTCTAAAGTCCCTTCTTCCTGAATTCTAAAGTCCCT 56.6356.63 Vsnp0008Vsnp0008 CTTGCTTAGTTGATTTATTCCACACTTGCTTAGTTGATTTATTCCACA 55.6955.69 ACTTAGGGCATTCTAAGCCAACTTAGGGCATTCTAAGCCA 56.256.2 Vsnp0009Vsnp0009 AGTCCATCTCCCTGGAAGCAAGTCCATCTCCCTGGAAGCA 60.2560.25 AGGAATCGCTTCTTCGTTCACTAGGAATCGCTTCTTCGTTCACT 60.0360.03 Vsnp0010Vsnp0010 TTCAGTGCTCCTTGTGTGCATTCAGTGCTCCTTGTGTGCA 60.1160.11 GCAAAACAAGGGAGGTAAGATGGGCAAAACAAGGGAGGTAAGATGG 59.8159.81

HRM 분석(High Resolution Melting Analysis)HRM analysis (High Resolution Melting Analysis)

HRM 분석은 CFX96 ThochTM Real-Time PCR Detection System(Bio-Rad, CA, USA)을 사용하여 수행하였다. PCR 반응액은 genomic DNA 10ng, 10× PCR buffer 2ul(ELPIS Bio, Korea), 10mM dNTP mixture 1 uL(ELPIS Bio, Korea), rTaq PLUS polymerase 0.1uL(ELPIS Bio, Korea), LCGreen Plus+ Melting Dye 1uL(BioFire Diagnostics, UT, USA), 각 분자표지에 해당하는 한 쌍 각각의 10pmole·uL-1 프라이머(표3) 1uL, 그리고 멸균된 3차 증류수로 총 20uL로 맞추었다.HRM analysis was performed using the CFX96 Thoch TM Real-Time PCR Detection System (Bio-Rad, CA, USA). The PCR reaction mixture contained 10 μg of genomic DNA, 2 μl of 10 × PCR buffer (ELPIS Bio, Korea), 1 μl of 10 mM dNTP mixture (ELPIS Bio, Korea), 0.1 μl of rTaq PLUS polymerase (ELPIS Bio, Korea), LCGreen Plus + Melting Dye 1 μl BioFire Diagnostics, UT, USA), 1 uL of each of the 10 pmole.uL- 1 primers (Table 3) of each pair corresponding to each molecular beacon, and sterilized tertiary distilled water to a total of 20 uL.

PCR 반응은 CFX96을 이용하여 98℃에서 초기 denaturation을 수행한 뒤, 95℃에서 10초간 denaturation과 60℃에서 20초간 annealing 하는 과정을 40회 반복하였음 마지막으로 95℃에서 10초간 denaturation 반응을 시킨 후, 68℃에서 90℃까지 0.2℃씩 올리면서 각 온도에서 5초간 유지하는 동안 형광을 측정하여 HRM melting 그래프를 그렸고, 이를 도 1에 나타내었다. 또한, Precision Melt Analysis 프로그램(Bio-Rad, CA, USA)을 사용하여 유전자형을 분석하였다.The denaturation at 95 ° C for 10 seconds and the annealing at 60 ° C for 20 seconds were repeated 40 times. The denaturation was carried out at 95 ° C for 10 seconds, The HRM melting graph was plotted while the fluorescence was measured while the temperature was increased from 68 ° C to 90 ° C by 0.2 ° C for 5 seconds at each temperature, which is shown in FIG. Genotype analysis was also performed using the Precision Melt Analysis program (Bio-Rad, CA, USA).

SNP 분자표지 개발SNP molecular marker development

개발된 Vsnp0001~Vsnp0010 등 10쌍의 SNP 분자마커는 시험에 사용한 7개 포도 대목 품종에서 다형성을 보여 품종 판별용 분자마커로 사용할 수 있었다. 이 중 Vsnp0001, 02, 07, 10 등 4종의 SNP 분자표지 조합을 이용하면 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306, Couderc 3309 등 7개 품종 판별이 가능함을 확인할 수 있었다. 그 결과가 하기 표 5에 나타나 있다.Ten pairs of SNP molecular markers such as Vsnp0001 ~ Vsnp0010 were polymorphic in the seven grape varieties used in the test and could be used as molecular markers for breed identification. We could confirm that 7 varieties such as 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 and Couderc 3309 could be discriminated by using four SNP molecular label combinations such as Vsnp0001, 02, 07 and 10. The results are shown in Table 5 below.

Identification of grape rootstock cultivars using SNP markersIdentification of grape rootstock cultivars using SNP markers 표5. Identification of grape rootstock cultivars using SNP markersTable 5. Identification of grape rootstock cultivars using SNP markers 품종명Breed name Vsnp0001Vsnp0001 Vsnp0002Vsnp0002 Vsnp0003Vsnp0003 Vsnp0004Vsnp0004 Vsnp0005Vsnp0005 Vsnp0006Vsnp0006 Vsnp0007Vsnp0007 Vsnp0008Vsnp0008 Vsnp0009Vsnp0009 Vsnp0010Vsnp0010 188.08188.08 CC CC AA AA BB CC A2A2 BB AA A1A1 Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 8BTouch 8B BB CC BB AA AA AA A1A1 BB AA A2A2 Couderc 3306Couderc 3306 AA CC HH AA HH AA H1H1 AA AA A1A1 Couderc 3309Couderc 3309 AA CC HH H2H2 HH AA H1H1 AA AA H1H1 Campbell Early
(접수품종)Campbell Early
(Accepted varieties) HH AA BB AA HH AA A1A1 AA AA A1A1

개발된 SNP 분자표지를 이용한 대목 품종 판별Identification of varieties using SNP molecular markers developed

상기 방법으로 개발이 완료된 SNP 분자마커를 이용하여 포도 대목 품종을 판별하는 시험을 한 결과 하기 표 6과 같은 결과를 얻을 수 있었다.As a result of the test for discriminating grape varieties using the developed SNP molecular markers, the results as shown in Table 6 were obtained.

List of plant materials used for validation List of plant materials used for validation 표6. List of plant materials used for validation Table 6. List of plant materials used for validation 품종명Breed name 점수score 수집지Collection place 188.08188.08 22 국립원예특작과학원 과수과, 포도묘목업체ANational Institute of Horticultural Science, Grape Seedling Company A Kober 5BBKober 5BB 55 국립원예특작과학원 과수과, 미국 ARS(Geneva), 프랑스 INRA,
상주 과수묘목관리센터, 포도묘목업체ANational Institute of Horticultural Science, ARS (Geneva), France INRA,
Changzhou fruit tree seedling management center, grape seedling company A SO4SO4 55 국립원예특작과학원 과수과, 일본 식원묘목연구소, 미국 ARS(Geneva), 프랑스 INRA, 상주 과수묘목관리센터National Institute of Horticultural Science and Technology, Japan Plantation Seedling Research Institute, USA ARS (Geneva), France INRA, Changzhou Fruit Tree Seedling Management Center Teleki 5CTouch 5C 44 국립원예특작과학원 과수과, 미국 ARS(Davis), 프랑스 INRA, 포도묘목업체ANational Institute of Horticultural Science, ARS (Davis), France INRA, Grape Seedling Company A Teleki 8BTouch 8B 22 국립원예특작과학원 과수과, 미국 ARS(Davis)National Institute of Horticultural Science, USA ARS (Davis) Couderc 3306Couderc 3306 22 국립원예특작과학원 과수과, 미국 ARS(Geneva)National Horticultural Research Institute, USA ARS (Geneva) Couderc 3309Couderc 3309 22 국립원예특작과학원 과수과, 미국 ARS(Geneva)National Horticultural Research Institute, USA ARS (Geneva)

상기 표 6에 있는 국내·외에서 수집한 대목 품종을 대상으로 개발된 SNP 분자마커를 적용한 결과 하기 표 7과 같이, 재현성 있는 결과를 얻었으며 개발된 분자표지를 이용하여 시험에 사용한 7개 포도 대목 품종을 판별 할 수 있었다.As a result of applying the SNP molecular markers developed in the domestic and foreign ginseng cultivars shown in Table 6 above, reproducible results were obtained as shown in Table 7 below. Using the developed molecular markers, the seven grape varieties .

Validation of SNP markers developed in this studyValidation of SNP markers developed in this study 표7. Validation of SNP markers developed in this studyTable 7. Validation of SNP markers developed in this study 품종명Breed name Vsnp0001Vsnp0001 Vsnp0002Vsnp0002 Vsnp0003Vsnp0003 Vsnp0004Vsnp0004 Vsnp0005Vsnp0005 Vsnp0006Vsnp0006 Vsnp0007Vsnp0007 Vsnp0008Vsnp0008 Vsnp0009Vsnp0009 Vsnp0010Vsnp0010 188.08188.08 CC CC AA AA BB CC A2A2 BB AA A1A1 188.08188.08 CC CC AA AA BB CC A2A2 BB AA A1A1 Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB Kober 5BBKober 5BB AA CC HH AA AA AA BB BB BB BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB SO4SO4 AA BB HH AA HH BB A1A1 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 5CTouch 5C AA CC BB H1H1 HH AA H2H2 AA AA BB Teleki 8BTouch 8B BB CC BB AA AA AA A1A1 BB AA A2A2 Teleki 8BTouch 8B BB CC BB AA AA AA A1A1 BB AA A2A2 Couderc 3306Couderc 3306 AA CC HH AA HH AA H1H1 AA AA A1A1 Couderc 3306Couderc 3306 AA CC HH AA HH AA H1H1 AA AA A1A1 Couderc 3309Couderc 3309 AA CC HH H2H2 HH AA H1H1 AA AA H1H1 Couderc 3309Couderc 3309 AA CC HH H2H2 HH AA H1H1 AA AA H1H1

<110> Republic of Korea <120> SNP molecular marker of grape understock's variety and uses thereof <130> 13-0200 <160> 20 <170> KopatentIn 2.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0001(forward) <400> 1 acccactaga ctaattggtc tca 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0001(reverse) <400> 2 aggcttcttc atggagttct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0002(forward) <400> 3 tggcaactga ctcagcaaca 20 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0002(reverse) <400> 4 tggaagtttc ttattgttgc tct 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0003(forward) <400> 5 ggggtccttt gttccatttg c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0003(reverse) <400> 6 tcctcccttc agaatggctg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0004(forward) <400> 7 gtgtccatga ccaggggaaa 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0004(reverse) <400> 8 aagcacacat ttggcttgtc c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0005(forward) <400> 9 gggaaggtga cgaggctaat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0005(reverse) <400> 10 gctctttggg gtgcaacttg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0006(forward) <400> 11 tcacattgat gggaactgcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0006(reverse) <400> 12 acagcacaac caacccttct 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0007(forward) <400> 13 gacttttggc tttacagagt ggt 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0007(reverse) <400> 14 tcttcctgaa ttctaaagtc cct 23 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0008(forward) <400> 15 cttgcttagt tgatttattc caca 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0008(reverse) <400> 16 acttagggca ttctaagcca 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0009(forward) <400> 17 agtccatctc cctggaagca 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0009(reverse) <400> 18 aggaatcgct tcttcgttca ct 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0010(forward) <400> 19 ttcagtgctc cttgtgtgca 20 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0010(reverse) <400> 20 gcaaaacaag ggaggtaaga tgg 23 <110> Republic of Korea &Lt; 120 > SNP &lt; / RTI &gt;          the <130> 13-0200 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0001 (forward) <400> 1 acccactaga ctaattggtc tca 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0001 (reverse) <400> 2 aggcttcttc atggagttct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0002 (forward) <400> 3 tggcaactga ctcagcaaca 20 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0002 (reverse) <400> 4 tggaagtttc ttattgttgc tct 23 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0003 (forward) <400> 5 ggggtccttt gttccatttg c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0003 (reverse) <400> 6 tcctcccttc agaatggctg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0004 (forward) <400> 7 gtgtccatga ccaggggaaa 20 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0004 (reverse) <400> 8 aagcacacat ttggcttgtc c 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0005 (forward) <400> 9 gggaaggtga cgaggctaat 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0005 (reverse) <400> 10 gctctttggg gtgcaacttg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0006 (forward) <400> 11 tcacattgat gggaactgcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0006 (reverse) <400> 12 acagcacaac caacccttct 20 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0007 (forward) <400> 13 gacttttggc tttacagagt ggt 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0007 (reverse) <400> 14 tcttcctgaa ttctaaagtc cct 23 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0008 (forward) <400> 15 cttgcttagt tgatttattc caca 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0008 (reverse) <400> 16 acttagggca ttctaagcca 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0009 (forward) <400> 17 agtccatctc cctggaagca 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Vsnp0009 (reverse) <400> 18 aggaatcgct tcttcgttca ct 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0010 (forward) <400> 19 ttcagtgctc cttgtgtgca 20 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> &Lt; 223 &gt; Vsnp0010 (reverse) <400> 20 gcaaaacaag ggaggtaaga tgg 23

Claims (3)

1) 포도 대목의 게놈 DNA를 분리하는 단계;
2) 상기 단계 1)의 DNA를 주형으로, 서열번호 1 및 서열번호 2로 이루어진 프라이머 세트, 서열번호 3 및 서열번호 4로 이루어진 프라이머 세트, 서열번호 13 및 서열번호 14로 이루어진 프라이머 세트 및 서열번호 19 및 서열번호 20으로 이루어진 프라이머 세트를 포함하는 포도 대목 품종 중 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 또는 Couderc 3309를 판별할 수 있는 프라이머 세트를 이용하여 중합효소연쇄반응(PCR)을 수행하는 단계; 및
3) 68℃에서 90℃까지 0.2℃씩 올리면서 각 온도에서 5초간 유지하는 동안 형광을 측정하여 유전자형을 분석하는 HRM(High Resolution Melting) 분석을 통하여 상기 PCR 산물을 검출하는 단계를 포함하는 포도 대목 품종을 판별하는 방법.
1) isolating the genomic DNA of grape leaves;
2) The primer set of SEQ ID NO: 1 and SEQ ID NO: 2, the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, the primer set of SEQ ID NO: 13 and SEQ ID NO: 14, and the primer set of SEQ ID NO: Among the grape varieties including the primer set consisting of SEQ ID NO: 19 and SEQ ID NO: 20, PCR was carried out using a primer set capable of discriminating 188.08, Kober 5BB, SO4, Teleki 5C, Teleki 8B, Couderc 3306 or Couderc 3309 ); And
3) detecting the PCR product by HRM (High Resolution Melting) analysis, which measures the fluorescence while maintaining the temperature for 5 seconds at each temperature while increasing the temperature from 68 ° C to 90 ° C by 0.2 ° C, How to identify the breed.
삭제delete 삭제delete
KR1020130139383A 2013-11-15 2013-11-15 SNP molecular markers associated with distinction of grape understock variety and uses thereof KR101630814B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130139383A KR101630814B1 (en) 2013-11-15 2013-11-15 SNP molecular markers associated with distinction of grape understock variety and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130139383A KR101630814B1 (en) 2013-11-15 2013-11-15 SNP molecular markers associated with distinction of grape understock variety and uses thereof

Publications (2)

Publication Number Publication Date
KR20150056407A KR20150056407A (en) 2015-05-26
KR101630814B1 true KR101630814B1 (en) 2016-06-16

Family

ID=53391724

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130139383A KR101630814B1 (en) 2013-11-15 2013-11-15 SNP molecular markers associated with distinction of grape understock variety and uses thereof

Country Status (1)

Country Link
KR (1) KR101630814B1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101976974B1 (en) * 2018-01-05 2019-05-09 가톨릭대학교 산학협력단 SSR molecular markers for discriminating grape cultivars and uses thereof
KR102052428B1 (en) * 2018-12-21 2019-12-06 가톨릭대학교 산학협력단 SSR molecular markers for discriminating Korean wild grape accessions and uses thereof
CN113930531B (en) * 2021-07-05 2023-08-18 尼秀媚 Grape stock specificity molecular marker and screening method and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101382406B1 (en) 2013-09-06 2014-04-09 대한민국 Primer sets for discrimination of grape cultivars and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
허윤영 등. Kor. J. Breed. Sci. Vol. 44, No. 1, 페이지 19-28 (2012)*

Also Published As

Publication number Publication date
KR20150056407A (en) 2015-05-26

Similar Documents

Publication Publication Date Title
CN105950747A (en) Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof
KR20140039866A (en) Ssr primer sets for discrimination of oriental melon line or cultivar and uses thereof
CN107354202B (en) Primer combination and kit for identifying flue-cured tobacco K326, application and identification method
KR101630814B1 (en) SNP molecular markers associated with distinction of grape understock variety and uses thereof
KR20180077873A (en) SNP markers for selection of marker-assisted backcross in watermelon
KR101976974B1 (en) SSR molecular markers for discriminating grape cultivars and uses thereof
KR20170024388A (en) Markers for the differentiation of Polygonum multiflorum Thumberg, Cynanchum wilfordii Max. Hemsl, Cynanchum auriculatum Royle ex Wight
JP5799600B2 (en) Species identification method of Eucalyptus hybrids
CN111471790A (en) Molecular marker closely linked with wheat grain filling rate QT L QGfr. sicau-7D.1 and application thereof
KR20090088492A (en) Development of sequence-based microsatellite markers in brassica rapa and construction of genetic map
KR102458440B1 (en) Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set
KR101834774B1 (en) SNP markers for identification of grape cultivars and Use thereof
CN109487001B (en) Method, primer group and kit for evaluating length of poplar wood fibers based on multi-site combination and application of method, primer group and kit
CN107354203B (en) Primer combination and kit for identifying cured tobacco Bina No. 1, application and detection method
KR20180055075A (en) Single nucleotide polymorphism marker for selecting bacterial wilt-resistant or sensitive pepper cultivar and uses thereof
CN116219048A (en) Pea core SNP molecular marker set developed based on KASP technology and application thereof
KR101546428B1 (en) SCAR marker for cultivar discrimination in Korean breeding wheat and use thereof
CN107345252B (en) Primer combination and kit for identifying 96 of flue-cured tobacco Qin tobacco, application and identification method
CN107354205B (en) Primer combination and kit for identifying tobacco 100 in flue-cured tobacco, application and detection method
CN107354201B (en) Primer combination and kit for identifying flue-cured tobacco yunyan 97, application and detection method
CN107345251B (en) Primer combination and kit for identifying flue-cured tobacco Longjiang 911, application and identification method
CN107354206B (en) Primer combination and kit for identifying No. 3 of flue-cured tobacco Nanjiang, application and detection method
CN107354204B (en) Primer combination and kit for identifying flue-cured tobacco Longjiang 981, application and identification method
KR101955072B1 (en) Snp markers for discrimination of raphanus sativus
He et al. Construction of Fingerprint of Michelia Germplasm by Fluorescent SSR Markers

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
E902 Notification of reason for refusal
AMND Amendment
X701 Decision to grant (after re-examination)
GRNT Written decision to grant