KR102458440B1 - Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set - Google Patents

Abstract

The present invention relates to a pepper blight-resistant individual identification SNP molecular marker and its use, and more specifically, a SNP marker composition, primer set, identification kit and method for discriminating pepper varieties and genetic resources resistant to pepper late blight. In relation to, the SNP molecular marker serves as a means to objectively evaluate pepper blight-resistant individuals, and can distinguish pepper varieties and genetic resources with resistance to pepper blight, and can be used to develop pepper blight-resistant varieties. .

Description

A primer set for determining pepper blight resistance and a method for determining pepper blight resistance using the same {Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set}

The present invention relates to a pepper blight-resistant individual identification SNP molecular marker and its use, and more specifically, a SNP marker composition, primer set, identification kit and method for discriminating pepper varieties and genetic resources resistant to pepper late blight. is about

Pepper blight is caused by Phytophthora capsici , and when late blight invades various host plants such as pepper, Solanaceae, and gourd crops, the root rots and eventually the plant dies. It is a phytobacterial disease that causes great damage. Although many chemical control methods have been developed to reduce the damage of red pepper blight, recently, in the movement to prevent environmental pollution, and as consumers' interest in healthy food increases, the cultivation of resistant varieties is actively progressing.

So far, molecular biological and genetic studies between pepper late blight and the host plant, pepper, are still in their infancy, and most studies have focused on genetic analysis to find molecular markers of resistance. For a long time, various attempts have been made to find the pepper plague resistance gene using the plague resistance gene map, but the identification of the plague resistance gene has not been made yet. In many crops, traits with high breeding value are often inherited by two or more genes, ie, quantitative trait locus (QTL), rather than by a qualitative character controlled by a single locus. It is known that the late blight resistance of pepper is also regulated by quantitative trait loci. Although the number and location of the quantitative trait locus differs depending on the study group or plant material for late blight resistance, research results have been reported that one major locus (major QTL) is commonly present on chromosome 5. Many have been developed However, even if the principal locus shows resistance, there are cases where the plant is virulent, and due to the nucleotide sequence difference according to various pepper varieties, it is practically very difficult to select a genetic resource with resistance to pepper blight using the existing single molecular marker of the principal gene. .

Therefore, there is a need for the development of new molecular markers closely related to resistance in order to develop pepper blight-resistant varieties.

Korean Patent No. 10-1401980 Korean Patent No. 10-1835124

It is an object of the present invention to provide a SNP marker composition for identifying pepper blight resistance individuals capable of discriminating pepper varieties and genetic resources with resistance to pepper blight.

In addition, an object of the present invention is to provide a primer set for identification of pepper late blight resistant individuals capable of discriminating pepper varieties and genetic resources having resistance to pepper blight.

In addition, an object of the present invention is to provide a kit for identifying pepper blight resistance individuals comprising the primer set.

In addition, an object of the present invention is to provide a method for identifying pepper blight resistance individuals using the primer set.

In quantitative traits related to resistance, a large number of loci with a large effect and a number of loci with a small effect are involved. Resistance by the principal gene has the advantage that resistance breeding is relatively easy because the resistance response is strong and is dominated by a small number of genes. On the other hand, resistance caused by microlocus has the advantage that resistance does not rapidly collapse.

Accordingly, the present inventors identified SNPs that can discriminate pepper blight resistance located at minor trait loci through the results of GBS and GWAS analysis using 342 pepper resources in order to select a new molecular marker for the development of resistant varieties. And the present invention was completed by preparing a primer set capable of detecting it.

One aspect of the present invention is a polynucleotide consisting of 5 to 200 consecutive bases including the 201st base among the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 1, or pepper blight resistance individual identification comprising a complementary polynucleotide thereof SNP marker compositions are provided.

As used herein, the term 'nucleotide' refers to deoxyribonucleotide or ribonucleotide that exists in single-stranded or double-stranded form, and unless otherwise specified, includes analogs of natural nucleotides.

'Resistance' as used in the present invention means a property to withstand external stress, specifically, to have resistance to infection such as disease, or to withstand damage such as pests.

The 'individual' used in the present invention refers to red pepper ( Capsicum spp.), which is a subject to confirm pepper blight resistance, and by analyzing the genotype of the SNP marker using the sample obtained from the pepper, pepper with pepper blight resistance. can be judged The sample may be a sample such as a leaf, a root, a stem, a flower, a fruit, an isolated tissue, or an isolated cell, but is not particularly limited thereto.

As used herein, 'SNP (Single Nucleotide Polymorphism) marker' refers to a single base polymorphic allele base pair on a DNA sequence used to identify an individual or species. Since SNPs are relatively high in frequency and stable and distributed throughout the genome, thereby generating genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers usually include phenotypic changes that accompany single nucleotide polymorphisms, but in some cases this may not. In the present invention, the SNP marker may indicate a difference in the phenotype of an individual, such as a mutation in the amino acid sequence or resistance to pepper blight.

Here, 'polymorphism' means a case in which two or more alleles exist at one locus, and among polymorphic sites, only a single base differs depending on the individual is called single nucleotide polymorphism. . Preferred polymorphic markers have two or more alleles that exhibit an incidence of at least 1%, more preferably at least 5% or 10% in a selected population. An 'allele' refers to several types of a gene present at the same locus on a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

According to an embodiment of the present invention, in order to discover a pepper blight resistance SNP marker, GBS and GWAS analysis using 342 pepper resources was performed to identify one SNP marker capable of discriminating resistance to pepper blight.

The SNP marker is a genetic marker that can discriminate pepper blight resistance and is based on the SNP position present in the nucleotide sequence of the pepper 2 chromosome (see Table 1 below). For example, the SNP corresponding to the 201st base of SEQ ID NO: 1 indicates a nucleotide polymorphism as T or C, wherein the individual having the T genotype is a pepper blight resistant individual, and the individual having the C genotype is a pepper blight diseased individual. can

location gene SEQ ID NO: SNP location CH2-112632207 Intergenic One AAGGCAGCAGATACAGTGAGGAATCGGAAACTGAATCTGGTGGGGTTTAAGGGAATTAAGGTTTTAGAATTGAAGAATAGGAAATGAAATTGATTGAAATTAGGTTTCATTATTAGAGAGCAAAATGGATTCTCTTAAGAATTTTGGTATTGCTGCCCCTTGCCTGCTATAACTAGCGGCGGGCGGGAAGGGGATGTTCG [T/C] TCGGTAAATGGGCCGGGTACGAAAATGTCATCCTCGCAGCCCCATTTGCCTAAACAAATCTAACAGGAAATTATGTGGTCCCTCAAGAGCGTCGGATCTTAAATTTTTGTCTCCTGAGTATCCTGAAATTTAATTTTTACCTCCACTACTTCCTCCGTTTCAAATTACCCGTTTAAAATTAAGATGGCATAACTATTAAA Reference: Capsicum annuum L. (Annuum. V1.6)

In the present invention, a polynucleotide consisting of 5 to 200, preferably 10 to 50, more preferably 15 to 30 consecutive bases including the SNP marker as a composition for identifying pepper blight resistance individuals, or its complementary polynucleotides.

According to one embodiment of the present invention, the SNP marker composition for identifying red pepper blight resistance individuals is a polynucleotide consisting of 10 to 30 consecutive bases including the 201st base among the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 1, or It may include a polynucleotide complementary thereto.

The pepper blight resistant individual is the causative agent of pepper blight Phytophthora cap sai ( Phytophthora capsici ) It may be to have resistance to.

According to one embodiment of the present invention, the pepper blight resistant individual is Phytophthora capsici ( Phytophthora capsici ) It may be one having resistance to the KPC-7 strain.

In addition, another aspect of the present invention provides a primer set for identifying pepper blight resistance individuals comprising the nucleotide sequences of SEQ ID NOs: 2 and 3.

As used herein, a 'primer' refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be replicated, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow synthesis of the extension product to begin and depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required. In addition, the primer may incorporate additional features that do not change the basic properties of the primer to serve as the starting point of DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually used in a length of 15 to 30 bp. The primer need not be exactly complementary to the sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

As used herein, the term 'primer set' means including a forward primer and a reverse primer for a nucleic acid strand to be replicated.

According to an embodiment of the present invention, it was confirmed that an individual having resistance to the Phytophthora capsici KPC-7 strain can be discriminated using the primer set.

In addition, another aspect of the present invention provides a kit for identifying pepper blight resistance individual comprising the primer set.

According to one embodiment of the present invention, the kit may be a high resolution melting (HRM) analysis kit or a DNA chip kit.

The HRM analysis kit amplifies and reads the genotype of the SNP marker, which is a marker for determining pepper blight resistance, or by detecting a small difference in the PCR dissociation curve, it is possible to determine pepper blight resistant pepper varieties. More specifically, the HRM analysis kit may be to determine the genotype by detecting the difference in the degree of dissociation of the double-strands according to the mutation of the 201st base among the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 1.

The HRM analysis technique is a relatively new post-PCR analysis method used to identify variations in nucleic acid sequences, and this method is based on detecting small differences in PCR dissociation curves. This is made possible by a more advanced double-stranded DNA (dsDNA) with the dye used in connection with the PCR instrument. For HRM analysis, the difference in the degree of dissociation according to the temperature of dsDNA can be analyzed and processed using software specifically designed. In the present invention, HRM analysis was used to select pepper late blight resistant pepper varieties.

Such an HRM assay kit includes a pair of primers specific for the polynucleotide containing the SNP marker, DNA polymerase, deoxynucleotides (dNTPs), RNAase, DEPC-water, test tubes and appropriate containers, etc. may include, but is not limited thereto.

The DNA chip kit specifically hybridizes and binds with a target DNA using a chip to which an oligonucleotide comprising a nucleotide sequence complementary to a sequence of a polynucleotide including a SNP marker, which is a marker for identifying pepper late blight resistance, is attached. Characterized, it is possible to discriminate the pepper blight-resistant pepper by using the change in the hybridization level according to the base mutation of the SNP. More specifically, the DNA chip kit attaches a polynucleotide complementary to a polynucleotide containing the 201st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 to the chip together with a marker, and reacts the target DNA to the chip to achieve hybridization level It may be a kit for determining the genotype through, a kit for determining pepper blight resistance.

In addition, another aspect of the present invention comprises the steps of: a) extracting genomic DNA from a sample; b) amplifying the extracted genomic DNA with the primer set as a template; And c) provides a method for identifying pepper blight resistant individuals comprising the step of analyzing the amplified product.

Step a) is a process of extracting genomic DNA from red pepper.

For the genomic DNA extraction method, methods known in the art can be used without limitation, for example, using a CTAB (cetyltrimethylammonium bromide) method, a phenol/chloroform extraction method, an SDS extraction method, or a commercially available DNA extraction kit can be used. .

Step b) is a process of amplifying the genomic DNA of pepper using a primer set capable of discriminating a pepper blight-resistant individual.

The primer set may include the nucleotide sequences of SEQ ID NOs: 2 and 3.

The genomic DNA amplification method may be performed by polymerase chain reaction (PCR). PCR can be performed using a PCR reaction mixture containing components known to be necessary for a PCR reaction in the art or using a commercially available kit. The PCR reaction mixture may include genomic DNA extracted from red pepper, the primer set, an appropriate amount of DNA polymerase, dNTP, a PCR buffer, and water. The PCR buffer may include Tris-HCl, MgCl ₂ , KCl, and the like.

The amplified target sequence (amplification product) may be labeled with a detectable labeling substance. For example, the labeling material is a labeling material known in the art, and may be a material that emits fluorescence, phosphorescence, or radioactivity. Preferably, the labeling material may be Cy-5 or Cy-3. When PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer during amplification of the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In the case of using a radioactive material as a labeling material, if a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, the amplification product is synthesized, and the radioactive isotope is incorporated into the amplification product and can be radioactively labeled. On the other hand, the amplification product can be visualized using a silver staining kit (Bioneer, Daejeon, Korea).

The amplification product may be further cleaved using a restriction enzyme. For example, the amplification product can be cleaved by treatment within the activation temperature using restriction enzymes for each primer. In this case, as the restriction enzyme, substances known in the art may be used without limitation.

Step c) is a process of confirming the base of the SNP marker site in the amplified product.

Analysis of the amplified product includes sequencing analysis to determine the base of the amplified SNP marker site, hybridization by microarray, allele specific PCR, dynamic allele hybridization technique ( dynamic allele-specific hybridization (DASH), PCR extension assay, PCR-SSCP, PCR-RFLP assay, HRM assay or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. Sequenom's MassARRAY system), mini- Mini-sequencing methods, Bio-Plex systems (BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technologies (eg, Affymetrix GeneChip) and BeadArray Technologies (eg, Illumina GoldenGate and Infinium assays) ), etc., but is not limited thereto.

According to one embodiment of the present invention, the step of analyzing the amplified product may be determining the base of the polymorphic site through HRM analysis.

According to an embodiment of the present invention, by HRM analysis of the amplified product, by detecting the difference in the degree of dissociation according to the nucleotide variation of double-stranded DNA, and determining the base of the polymorphic site, it is possible to distinguish resistant or diseased varieties against pepper blight. .

The novel SNP molecular marker according to the present invention can serve as a means to objectively evaluate pepper blight-resistant individuals, and can distinguish pepper varieties and genetic resources with resistance to pepper blight, and can be used for development and identification of pepper blight-resistant varieties. can

1 shows the incidence index of pepper blight according to the degree of progression of pepper blight according to an embodiment of the present invention.
Figure 2 is a (a) population analysis and (b) principal component analysis (PCA) graph for a total of 342 pepper blight resistance and morbidity resources according to an embodiment of the present invention.
Figure 3 is a graph analyzing the blight bioassay for a total of 342 pepper resources according to an embodiment of the present invention.
4 is a melting curve graph obtained by analyzing the genotypes of 93 pepper resources using a primer set according to an embodiment of the present invention.

Hereinafter, the present invention will be described in more detail. However, these descriptions are provided for illustrative purposes only to help the understanding of the present invention, and the scope of the present invention is not limited by these illustrative descriptions.

Example 1. Confirmation of pepper blight resistance

In order to confirm pepper blight resistance, 342 pepper resource core resources including C. annuum , C. baccatum , C. chacoense , C. chinense and C. frutescens (8 resistant resources, 19 moderately resistant resources and 315 morbidity/susceptibility) Resources) to the target phytophthora capsici ( Phytophthora capsici ) KPC-7 strain was inoculated.

First, the KPC-7 strain was cultured in V8 solid medium at 25° C. for 5 to 7 days. After collecting the strain colonies, the strain inoculum was prepared by diluting it in distilled water to a final concentration of 5Х10 ⁴ sporangia/ml.

The seeds of each pepper resource were sown and cultivated in a state where the true leaves were about 6 leaves. After inoculating 10 mL of the prepared strain inoculum per pot to 1 to 12 seedlings per resource, symptoms of late blight were observed at intervals of 1 week for 4 weeks at 60% humidity and 25°C.

Referring to Table 2 and FIG. 1 below, the disease index (DI) classified the progression of red pepper blight by the KPC-7 strain into 5 stages according to the severity of the disease symptoms, and 10 to 12 individuals for each resource. The incidence index was averaged.

The disease incidence rate (%) was calculated as [(number of seedlings showing disease symptoms)/(total number of seedlings used for evaluation)] X 100, and the value obtained by repeating 3 experiments for 10 to 12 individuals for each resource was averaged. .

incidence index Symptom 0 No symptoms of plague (no disease symptoms) One The leaves wither and brown lesions begin to appear on the stems. 2 30-50% of all plants wither 3 51-70% of all plants wither 4 71-100% of all plants wither

As a result, as shown in Table 3 below, the incidence index was different depending on the pepper resource, and if the average incidence index was 0, resistance, 1 to 2, moderate resistance, and 3 or more corresponded to diseased individuals. do. These pepper resources were consistent with the previously known resistance information of each variety.

scientific name Average incidence index Sum 0 to 1 1 to 2 2-3 3 to 4 C. annuum 8 6 11 197 222 C. baccatum 48 48 C. chacoense 2 2 C. chinense One 44 45 C. frutescens One 24 25 Sum 8 6 13 315 342

Example 2. Search for pepper blight resistance SNP markers

In order to search for SNP markers between pepper resources, GWAS analysis was performed on 342 types of pepper resources.

First, as a result of calculating the degree of admixture with the fastStructure program to check the population structure of 342 resources whose phenotypes for plague were confirmed, each sample was the best model when K = 5. ) was confirmed to be assumed.

In order to perform PCA analysis through correlation between pepper samples using SNP data, PC (Principal component) 1 and PC2, which have the highest explanatory power, were used. The variance of the degree to which each of PC1 and PC2 differentiated the entire sample was calculated to be 42.3% and 26.5%, respectively. As a result, as shown in FIG. 2 , the pepper resources composed of 5 species were classified into 5 groups biotaxonomically. C. chinese and C. frutescens, C. annuum, and C. baccatum respectively formed groups, and it was confirmed that the two samples of C. chacoense were separated from each other.

In addition, GWAS analysis was performed on the results of inoculation experiments for 4 weeks for each late blight inoculation week. As a result, as shown in FIG. 3 , significant differences were observed between chromosomes from the second week after inoculation with the late blight, and the difference between the resistant individual and the diseased individual in the overall staining was remarkable. Significant SNPs selected through these results are shown in Table 4 below.

chromosome location P value reference
(reference) transition
(alternative) Create a primer
Whether chr01 18309131 3.12E-07 T A N chr01 18541809 5.9E-07 T A N chr01 18541871 5.37E-07 C G N chr02 112632207 4.85E-07 T C Y chr02 115557669 8.66E-07 G A Y chr02 118473950 8.83E-07 A C Y chr02 165074534 8.84E-08 C A Y chr02 165083237 1.09E-06 C A Y chr02 165083291 1.1E-08 T C Y chr03 26843710 2.82E-07 G T Y chr03 92882787 1.46E-07 G C N chr03 203119513 4.45E-07 T C Y chr03 273929454 1.06E-06 A G Y chr03 281084163 1.07E-07 A T N chr03 281374819 3.75E-07 T C Y chr03 281374880 3.77E-07 T G Y chr04 9578255 2.47E-24 G A Y chr06 1385184 2.39E-08 A T N chr06 3204310 7.86E-07 G A Y chr06 184471306 4.83E-07 G A Y chr07 9144225 3.23E-07 A G Y chr07 205297202 1.85E-07 C T Y chr08 126466421 3.57E-08 T A N chr08 138930210 1.86E-07 C A Y chr09 3642467 8.34E-07 T C Y chr09 16370729 9.33E-07 C T Y chr10 19168172 6.5E-07 C G Y chr12 208357955 6.52E-07 T A N chr12 232050702 1.24E-10 T C Y *N: no, Y: yes

Example 3. Pepper blight resistance SNP marker development and verification

3-1. Selection of pepper blight resistance SNP markers

In order to develop a pepper late blight resistance SNP marker, first, 5 types of pepper varieties and 88 genetic resources were inoculated with late blight in the same manner as in Example 1 to confirm the bioassay phenotype.

As a result, as shown in Table 5 below, the phenotype and the genotype were consistent with the bioassay results.

scientific name Morbidity (S)/Resistance (R) (Incidence Index) Chilli Genetic Resources / Varieties C. annuum R (0 to 1) 57 (genetic resource), 4 (cultivar) C. annuum S (3 to 4) 31 (genetic resource), 1 (cultivar) Sum - 93

In addition, one SNP with a difference between the resistant resource and the virulent resource was identified. In the pepper blight resistant resource, the base sequence was changed from T to C at position 112632207 in chromosome 2. Accordingly, the base polymorphism at position 112632207 was used as a SNP marker for the discrimination of pepper late blight resistant varieties.

3-2. Validation of pepper blight resistance SNP markers

In order to verify the SNP marker, HRM analysis was performed using 93 kinds of pepper resources.

First, the primer sets shown in Table 6 below that can recognize and amplify SNP markers were designed and prepared. For determination of genotype using SNP molecular marker, HRM analysis was performed using LightCycler® 96 Real-Time PCR System. The PCR reaction solution is 10X PCR buffer (10x EasyTaq® buffer, TransGen Biotech), 1 μL of 2.5　mM dNTP mixture (TransGen Biotech), 0.5 U of nucleic acid polymerase (Transgen Biotech), SYTO®9 green fluorescent nucleic acid stain ( Life Technologies™, Carlsbad, CA, USA) 1.0 μL, 0.5 pM primer, and 20 μL of a mixture consisting of 50 ng of template nucleic acid were used to perform standard PCR. The PCR reaction was maintained at 95° C. for 10 minutes and then 45 cycles (95° C. 10 seconds, 60° C. 15 seconds, and 72° C. 15 seconds) were repeated, and then fluorescence was measured at every 0.1° C. in a temperature range of 60 to 90° C.

primer Primer sequence (5'>3') SEQ ID NO: Forward GCCCCTTGCCTGCTATAACTA 2 Reverse CGAGGATGACATTTTCGTACC 3

As a result, as shown in FIG. 4, the genotypes of pepper resources were clearly divided into resistant homozygous (R), heterozygous homozygous (S), and heterozygous (H) genotypes based on the melting curve standardized in HRM analysis. , the resistance resource identification accuracy was 78.5%. C. annuum cv. Plants similar to the graph of Manita were heterozygous (S), and C. annuum cv. Plants similar to the graph of CM334 were classified as resistant homozygous (R), and plants showing a graph different from the two indicator plants were classified as heterozygous (H). This result is different from the pepper blight inoculation result (FIG. 3), because the resistance to pepper blight can be considered to be due to mutation by the microlocus rather than the main locus.

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> REPUBLIC OF KOREA (RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set <130> RDA-P200031 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 401 <212> DNA <213> Artificial Sequence <220> <223> Intergenic in Chromosome 2 <400> 1 aaggcagcag atacagtgag gaatcggaaa ctgaatctgg tggggtttaa gggaattaag 60 gttttagaat tgaagaatag gaaatgaaat tgattgaaat taggtttcat tattagagag 120 caaaatggat tctcttaaga attttggtat tgctgcccct tgcctgctat aactagcggc 180 gggcgggaag gggatgttcg ctcggtaaat gggccgggta cgaaaatgtc atcctcgcag 240 ccccatttgc ctaaacaaat ctaacaggaa attatgtggt ccctcaagag cgtcggatct 300 taaatttttg tctcctgagt atcctgaaat ttaattttta cctccactac ttcctccgtt 360 tcaaattacc cgtttaaaat taagatggca taactattaa a 401 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 2 gccccttgcc tgctataact a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 3 cgaggatgac attttcgtac c 21

Claims (8)

A polynucleotide consisting of 5 to 200 consecutive bases including the 201st base among the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 1, or a SNP marker composition for identifying pepper blight resistant individuals comprising a polynucleotide complementary thereto.
The method according to claim 1,
The pepper blight resistant individual is Phytophthora capsici ( Phytophthora capsici ) The composition will have resistance to the KPC-7 strain.
It includes a primer of SEQ ID NO: 2 and a primer of SEQ ID NO: 3 that recognizes the 201st base among the polynucleotides consisting of the nucleotide sequence of SEQ ID NO: 1, wherein the base is T if the subject is pepper blight disease and if C is pepper blight resistant subject A primer set for identifying pepper blight-resistant individuals identified by
4. The method of claim 3,
The pepper blight resistant individual is Phytophthora capsici ( Phytophthora capsici ) That having resistance to the KPC-7 strain, a primer set.
4. The method of claim 3,
The primer set is for use in PCR (polymerase chain reaction) or multiplex PCR (multiplex PCR), the primer set.
A kit for identifying pepper blight-resistant individuals comprising the primer set of claim 3.
a) extracting genomic DNA from the sample;
b) amplifying the extracted genomic DNA with the primer set of claim 3 as a template; and
c) analyzing the amplified product
A method for identifying pepper blight-resistant individuals comprising a.
8. The method of claim 7,
The method c) is to determine the base of the polymorphic site through high resolution melting (HRM) analysis.

Images