CN115786564A - Rice Pi-ta and Ptr dominant functional molecular marker and application thereof - Google Patents

Abstract

The invention belongs to the field of molecular identification and rice breeding, and relates to a rice Pi-ta and Ptr dominant functional molecular marker and application thereof.

Description

Rice Pi-ta and Ptr dominant functional molecular marker and application thereof

Technical Field

The invention belongs to the field of molecular identification and rice breeding, and relates to a rice Pi-ta and Ptr dominant functional molecular marker and application thereof.

Background

The rice blast caused by Magnaporthe oryzae is a very destructive fungal disease in the rice production areas of the world and seriously affects the yield and quality of rice. Considering environmental protection and agricultural sustainable development, breeding and planting disease-resistant varieties by using host resistance is the most safe and effective way for preventing and treating rice blast, but the greatest challenge of breeding of disease-resistant varieties lies in correct selection of disease-resistant genes. At present, although more than 100 rice blast resistance genes have been identified from rice, only 37 resistance genes have been successfully cloned by a map-based cloning method or the like. A group of resistance genes on the 12 th chromosome of rice, including Pi-ta and Ptr (namely Pi-ta 2), has effectively prevented the infection of various rice blast germs in the United states within the last two decades, but only 48 parts of 3000 parts of core rice germplasm resource re-sequencing materials in the world contain Ptr disease-resistant genotypes, which indicates that the Pi-ta and Ptr genes still have great application prospect in rice breeding for disease resistance.

In general, the rice blast resistance gene and the corresponding avirulence gene follow the "gene-to-gene" interaction pattern. Pi-ta is the 1 st confirmed rice blast resistance protein which directly interacts with the avirulence protein of pathogenic bacteria, and the change of a single amino acid in the LRR domain (position 918) directly influences the interaction with the avirulence protein Avr-Pita and further influences the resistance of rice to the rice blast bacteria. In recent years, it has been found that at least 19 rice blast resistant genes including Pi-ta and Ptr have been localized near the Pi-ta locus, most of which are concentrated in the centromere region where recombination is highly inhibited, making it difficult to identify them by conventional forward genetics means. At present, only Pi-42 and Ptr genes are reported to be closely related to Pi-ta gene function. The Pi-42 gene can participate in a disease-resistant signal path; the Ptr gene is a broad-spectrum rice blast resistance gene with novel structure, is about 200Kb away from the Pi-ta gene, and plays a complementary disease resistance function with the Pi-ta gene in the rice blast resistance process. The gene does not contain all NLR structural domains of common disease-resistant genes, but has an ARM repetitive structural domain, and assists Pi-ta to play a rice blast resistant function. The mutant M2354 deleted the Ptr gene, but the Pi-ta gene carried by it appeared sensitive to the rice blast strain with AVR-Pita, indicating that Pi-ta mediated resistance may require the involvement of Ptr. When the genetic resistance spectrum of rice containing the Ptr gene is identified, the wide-spectrum resistance mediated by the Ptr is found to be independent of the Pi-ta gene. 4 amino acid deletions (KPEK) caused by 12bp deletion in the fourth exon of the Ptr gene and amino acid changes (M → K, E → K) caused by two non-synonymous SNPs nearby distinguish the rice varieties from rice blast fungus resistance.

With the appearance and rapid development of DNA molecular markers, marker-assisted selection (MAS) technology has become an effective way to correctly select disease-resistant genes. However, because the recombination rate between the disease-resistant gene and the molecular marker is greatly different in different populations, the population for constructing the molecular marker is not a breeding material, and the practical application has certain limitation. Most of molecular markers in the prior art are not genes, and the situation of non-linkage can occur in mass group breeding, so that disease-resistant genes cannot be selected. However, a small number of markers designed for the disease-resistant gene per se often require multiple pairs of primers or enzyme digestion and other experiments to identify the disease-resistant genotype, and increase the breeding workload. Therefore, the corresponding molecular marker is established based on the disease-resistant gene, namely, the functional marker and the target gene are co-separated and directly come from the polymorphism motif which determines the function on the gene locus, and compared with the traditional marking method, the method has the advantages of effectiveness in the selection of artificial populations and natural populations and higher efficiency in population gene detection.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides a rice Pi-ta and Ptr dominant functional molecular marker and application thereof.

The technical scheme provided by the invention is as follows:

the invention provides a rice Pi-ta and Ptr dominant functional molecular marker, wherein the Pi-ta molecular marker is positioned at 2725 th nucleotide of a rice Pi-ta gene, and is a Pi-ta disease-resistant allele when the site is G; when the locus is T, the locus is a Pi-ta susceptibility allele; ptr molecular markers are located at 2606 th nucleotide variation and 2611 th nucleotide variation of rice Ptr gene and insertion/deletion variation of 2608 th 12 nucleotides, namely, when 2606 is T, 2612 is G and 2608 bit lacks 12bp sequence, the Ptr molecular markers are Ptr disease-resistant alleles; and when A is at position 2606, A is at position 2612 and 12bp sequence is inserted at position 2608, the allele is Ptr susceptible allele; the 12bp sequence is AAACCAGAAA.

Further, the nucleotide sequence containing the molecular marker is shown in SEQ ID NO. 1-SEQ ID NO. 4.

The invention also provides a primer of the dominant functional molecular marker of rice Pi-ta and Ptr, and the sequence of the primer is as follows:

pi-ta upstream primer: 5 'TGCCGTGGCTTCTATCTTTACCTG-3';

pi-ta downstream primer: 5 'GTTATGCTGTCCTCAAACACCTCG-3';

ptr upstream primer: 5 'CCAAGGTACGTTAGTAGTCGCTGTCATTTA-3';

ptr downstream primer: 5 'GCTTGGCAGGTGGTTCAGGCA-3'.

The invention also provides a method for detecting rice blast resistance, which comprises the steps of carrying out PCR amplification on the rice genome DNA by using the primers, and judging the rice blast resistance according to the amplification result.

Further, if a band with the size of 471bp is obtained after amplification, the Pi-ta disease-resistant allele is carried; if a band with the size of 619bp is obtained after amplification, the band carries the Ptr disease-resistant allele; if the sample to be detected carries the Pi-ta disease-resistant allele and the Ptr disease-resistant allele at the same time, the rice blast resistance of the sample to be detected is stronger.

Further, the PCR reaction system was 20. Mu.L, including 10. Mu.L of 2 XTAQQ Master Mix, 2. Mu.L of DNA template, 1. Mu.L each of 10. Mu. Mol/L upstream and downstream primers, ddH ₂ O make up to 20. Mu.L.

Further, the reaction conditions are as follows: (1) pre-denaturation at 98 ℃ for 5min; (2) Denaturation at 98 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 35s for 35 cycles; (3) extension at 72 ℃ for 5min; and (5) carrying out 1% agarose gel electrophoresis on the amplification product, scanning and photographing by a gel imager, and recording an electrophoresis result.

Further, the DNA extraction method comprises the following steps: taking 100mg of rice leaves growing for two weeks, placing the rice leaves in a 2mL centrifuge tube containing steel balls, immediately freezing the rice leaves for 5min by using liquid nitrogen, placing the rice leaves in a ball mill, fully crushing plant tissues, and extracting genome DNA; the concentration and purity of the DNA sample were measured by a nucleic acid protein detector, and the DNA concentration was adjusted to 50 ng/. Mu.L and stored at-20 ℃ for further use.

The invention also provides a reagent or a kit of the primer.

The invention also provides the application of the rice Pi-ta and Ptr dominant functional molecular marker or the primer in screening and identifying rice blast resistant rice germplasm resources or molecular marker assisted breeding.

Advantageous effects

The invention discloses a novel Pi-ta and Ptr gene dominant functional molecular marker and application thereof according to the characteristic that sequence variation of rice blast resistance genes Pi-ta and Ptr determines the resistance to infection. The PCR amplification and agarose gel electrophoresis detection of the genome DNA of rice varieties with different genetic backgrounds can amplify specific bands in rice samples carrying Pi-ta and Ptr disease-resistant alleles, but no bands in rice samples carrying Pi-ta and Ptr disease-sensitive alleles. The invention establishes the dominant functional molecular marker based on Pi-ta and Ptr genes, identifies the main cultivated rice variety of japonica rice regions at the middle and lower reaches of Yangtze river, and provides a basis for molecular marker assisted breeding and variety improvement of rice disease-resistant varieties.

Compared with the existing related closely-linked markers and functional molecular markers, the dominant functional molecular marker of the rice blast resistance gene Pi-ta has the advantages of strong specificity, independence on F2 population, no need of enzyme digestion reaction, simple identification steps, utilization of conventional instruments and the like, can be directly used for identifying the allele of the rice blast resistance gene Pi-ta only through one round of PCR reaction and electrophoresis detection, effectively reduces the identification cost and improves the utilization efficiency of the marker.

The dominant functional molecular marker of the rice blast resistance gene Ptr fills the blank that the gene has no functional molecular marker, and provides technical support for the wide application of the Ptr gene in breeding for disease resistance.

The research utilizes newly developed Pi-ta and Ptr dominant functional molecular markers to identify 18 main-cultivated rice varieties in Jiangsu province in recent years, and the results show that the Pi-ta and Ptr disease-resistant alleles have higher frequency (14/18) in the test varieties, can effectively prevent infection of various rice blast germs, and should continuously strengthen gene monitoring to prevent loss.

Drawings

FIG. 1 shows the co-linear analysis of the Pi-ta gene and its adjacent chromosome segments. The red zone is Pi-ta gene, the yellow zone is Pi-42 gene, the purple zone is Ptr gene, and the green and blue arrows represent gene directions respectively.

FIG. 2 shows the analysis of the variation sites of Pi-ta and Ptr gene fragments.

FIG. 3 shows the amplification results of the developed Pi-ta (A) and Ptr (B) dominant functional molecular markers in Jiangsu main-cultivated rice variety. 1-18 are different rice varieties and are detailed in table 1; and M is DL2000DNA Marker.

FIG. 4 shows the amplification results of individual verification of developed Pi-ta (A) and Ptr (B) dominant functional molecular markers in Jiangsu main-cultivated rice variety. 1-18 are different rice varieties and are detailed in table 1.

Detailed Description

1 materials and methods

1.1 materials

The data source is as follows: genomic sequences and annotation files for 6 representative species of Oryza and 1 species of Pseudooryza were downloaded from JGI (https:// phytozome.jgi. Doe. Gov/pz/portal. Html) and NCBI (https:// www.ncbi. Nlm. Nih. Gov) databases.

Test materials: the total amount of the research materials is 18 parts, and the research materials are cultivated rice varieties which are planted in large areas and demonstrated at multiple points in Jiangsu province. The rice seeds to be tested were provided by the institute of agricultural academy of sciences, ever-maturing market. The source, pedigree, breeding unit and other information of the experimental variety are listed in table 1.

TABLE 1 Experimental materials Table

1.2 methods

1.2.1 identification of homologous genes of the genus Oryza Pi-ta and Ptr

Pi-ta (LOC _ Os12g 18360) and Ptr (LOC _ Os12g 18729) were searched as query in the genomic data of 6 Oryza species and Pseudooryzae species, respectively, with e-value set to 1e-4, and sequences less than 50 amino acids in length were deleted. Based on a Pfam-A.hmm domain model library in a Pfam database, domain identification is performed by scanning using an HMMscan program in a hmmer3.1 software package (e-value is set to 1 e-4), sequences without related domains are deleted, and the remaining sequences are considered to be homologous sequences of Pi-ta and Ptr genes. The alignment of the sequences was performed using the software MAFFT v7.310, truncated after alignment using trimAL v1.3 with gt value set to 0.03. The alignment-trimmed sequence was then checked using MEGA X to ensure alignment quality and retention of the core domain (Kumar et al, 2018). Then, software IQTREE v1.5.5 is used for constructing Pi-ta and Ptr gene phylogenetic trees, and the node support rate is generated by an ultra fast bootstrap method (ultra fast bootstrap) with the repetition frequency of 1000 times. After the phylogenetic tree is constructed, selecting a single line in which the genes Pi-ta and Ptr of the rice are positioned, and extracting all sequences in the single line by using a script, namely the orthologous sequences Pi-ta and Ptr.

1.2.2 colinear analysis

DNA sequences were aligned using ClustalW and phylogenetic analysis was performed using the maximum likelihood method and MEGA X software. The co-evolutionary relationship of Pi-ta and Ptr is detected by using an online website Mirrortree (http:// csbg. Cnb. Csic. Es/mtserver/index. Php). The result is returned after uploading the tree graph file or the multiple sequence alignment file, if r >0.5 and P <0.001, it can be determined that the two have co-evolutionary relationship (Ochoa and Pazos, 2010).

1.2.3 Gene polymorphism analysis

According to Pi-ta and Ptr gene sequences of Nipponbare and Katy rice, the difference sequence is compared and analyzed, primers Pita-F (TAAGGAGAGACAGGGTTGGAACAC, SEQ ID NO. 5) and Pita-R (TCAAACAATCATCAAGTCAGGTTG, SEQ ID NO. 6), and Ptr-F (CTGCTCTACATGTTTTGGGCT, SEQ ID NO. 7) and Ptr-R (CGGTCCACCTAGCATAAAGC, SEQ ID NO. 8) are designed, and gene segments containing anti-infectious allele identification sites are amplified by taking rice genome DNA as a template. Primer synthesis and amplification product sequencing are completed by Beijing Optimala Xin trade biotechnology Limited. And comparing the sequencing result by using Clustal W, and exporting the differential sites to an Excel file.

1.2.4 functional marker design

The 2725 th nucleotide of the Pi-ta gene is a key site for distinguishing an anti-disease allele (disease resistance is G, infection is T), the anti-disease allele base G is designed at the 3' end of an upstream primer Pita-S, the sequence is 5' GCTATGCATCTTCAACCTGACTTG-3' (SEQ ID NO. 9), the downstream primer Pita-AS is designed at the position of 471bp downstream of the site, the sequence is 5' GTTATGCTGTCCTCAAACACCTCG-3' (SEQ ID NO. 10), if a 471bp band can be amplified by using the primers, the variety is detected to carry the Pi-ta anti-disease allele, and if the band cannot be amplified, the variety is the infection allele;

the Ptr anti-influenza allele is different in 12bp insertion/deletion and 2 base substitution nearby, so that the 12bp base deletion is designed at the 3' end of a downstream primer Ptr-AS and has the sequence of 5; an upstream primer Ptr-S is designed at the upstream-600 bp of the locus, the sequence is 5.

1.2.5DNA extraction

100mg of rice leaves growing for two weeks are taken and placed in a 2mL centrifuge tube containing steel balls, immediately frozen for 5min by liquid nitrogen, placed in a ball mill (Tiss-48 type) to fully break plant tissues, and then the genomic DNA is extracted by utilizing an improved CTAB method. The concentration and purity of the DNA sample were measured by a nucleic acid protein detector, and the DNA concentration was adjusted to 50 ng/. Mu.L and stored at-20 ℃ for further use.

1.2.6 molecular marker detection

The PCR reaction system for molecular detection is 20 μ L, and comprises 10 μ L of 2 XTAQA Master Mix (product number P111, nanjing Nodezan Biotech Co., ltd.), 2 μ L of DNA template, 10 μmol/L of upstream and downstream primers, each 1 μ LL，ddH ₂ Make up to 20. Mu.L of O. The amplification reaction was performed on a conventional PCR instrument. The reaction conditions are as follows: (1) pre-denaturation at 98 ℃ for 5min; (2) Denaturation at 98 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 35s for 35 cycles; (3) extension at 72 ℃ for 5min. And (4) carrying out 1% (mass volume fraction) agarose gel electrophoresis on the amplification product, scanning and photographing by a gel imaging instrument, and recording an electrophoresis result.

2 results and analysis

2.1 Co-evolutionary analysis of the genes Pi-ta and Ptr of Oryza

To examine the evolution pattern of the Pi-ta gene and its adjacent chromosomal segments, 7 genome-wide sequenced species of the Gramineae family were selected, including japonica rice (Oryza sativa ssp. Japonica, AA chromosome), indica rice (O.sativa ssp. Indica, AA chromosome), oryza sativa (O.rufipogon, AA chromosome), nivara japonica (O.nivara, AA chromosome), oryza sativa (O.punctata, BB chromosome), brevibrant Oryza sativa (O.brachhyantha, FF chromosome), and Pseudooryza sativa Leersia perrie. The chromosome segments of 20 genes upstream and downstream of the Pi-ta gene were analyzed for inter-species collinearity. The results showed that the Pi-ta gene chromosomal segment has a good collinearity relationship between 6 species of Oryza and pseudorice, and 41 genes are present in tandem with the arrangement order in nearly identical coding orientation (FIG. 1). Wherein the Pi-ta/Pi-42 segment has no homologous segment in the pseudorice, and the segment has sequence inversion in the spotted wild rice; the Ptr gene has no homologous segments in short anther wild rice and pseudorice. This indicates that the Pi-ta/Pi-42 region may appear at the early stage of Oryza formation, whereas the Ptr gene appears after the differentiation of the BB and FF chromosome groups of Oryza. In addition, the Pi-ta chromosome segment has no large-scale gene insertion, loss or rearrangement in the rice chromosome polyploidization and remodeling process, and the evolution mode is very conservative.

2.2 analysis of the mutation sites of Pi-ta and Ptr Gene fragments

In order to understand the utilization condition of disease-resistant genes Pi-ta and Ptr in rice varieties developed in Jiangsu province in recent years, 18 rice varieties are selected, gene fragments containing the identification sites are respectively amplified according to the identification sites of the disease-resistant alleles Pi-ta and Ptr, and the genotypes are analyzed by sequencing. Pi-ta and Ptr gene fragments were cloned in all the varieties, of which 72.2% (13/18) carried both Pi-ta and Ptr resistance alleles consistent with Katy, and the other 5 carried both Pi-ta and Ptr susceptibility alleles consistent with Nip. The Pi-ta gene fragment has few nucleotide variation sites, and the G/T variation exists only at the 2754bp position of the identification site; whereas, the Ptr gene fragment has many mutation sites, and there are polymorphisms at 14 sites, and 11 of them are nonsynonymous mutations (fig. 2).

2.3 development of Pi-ta and Ptr dominant functional molecular markers

Pi-ta gene function studies have found that the Pi-ta allele-encoded protein in disease-resistant and disease-susceptible rice varieties differs only at amino acid position 918 (Ala/Ser), i.e., whether the corresponding base at position 2754 is G or T is a marker for distinguishing the Pi-ta disease-resistant allele from the disease-susceptible allele (Bryan et al, 2000). Accordingly, a specific primer pair of Pi-ta disease-resistant allele, pita-S (the 3 'end is a disease-resistant allele identification site G) and Pita-AS (located in a gene 3' -UTR region) is designed. The results of PCR amplification and electrophoresis detection of the genomic DNA of the 18 rice varieties by the pair of primers are shown in FIG. 3A, and 14 rice varieties can be amplified to form strips with the size of 471bp and carry Pi-ta disease-resistant alleles; the other 4 rice varieties were amplified without bands and carried Pi-ta susceptibility allele.

Similarly, the Ptr anti-influenza alleles differ by 4 amino acid deletions (KPEK) due to a 12bp deletion in the fourth exon and by amino acid changes (M → K, E → K) due to two non-synonymous SNPs in the vicinity thereof. Accordingly, specific primer pairs of the Ptr disease-resistant allele, ptr-S and Ptr-AS (12 bp base deletion of the disease-resistant allele is designed at the 3' end) are designed. The pair of primers is used for carrying out PCR amplification and electrophoresis detection on the genome DNA of the tested rice variety, and the result is shown in figure 3B, and 14 rice varieties can be amplified to form stripes with the size of 619bp and are used for carrying Ptr disease-resistant alleles; the other 4 rice varieties have no band amplification and are carried with Ptr disease-sensitive alleles.

2.4Pi-ta and Ptr dominant functional molecular marker stability validation

The stability and the accuracy of the dominant functional molecular markers of the two genes among different varieties of individuals are further detected. The results of the verification of the randomly selected 8 rice varieties of the 18 rice varieties show that 1 clear strip with the fragment length of 616bp is amplified in 8 individuals of the rice varieties carrying the Pi-ta or Ptr disease-resistant alleles, and no strip is amplified in 8 individuals of the rice varieties carrying the Pi-ta or Ptr disease-resistant alleles (figure 4).

Pi-ta sequence (SEQ ID NO. 1) in Nipponbare (Nip) of an infected variety

ATGGCGCCGGCGGTCAGTGCATCGCAGGGTGTCATCATGCGGTCCCTGACGAGCAAGCTCGACTCGCTGCTGCTGCAGCCGCCGGAGCCGCCGCCGCCTGCGCAACCGTCGTCGCTGCGGAAGGGGGAGAGGAAGAAGATCCTCCTCCTCAGAGGCGATCTCCGACACCTGCTAGATGACTACTACCTCCTCGTGGAGCCGCCGTCAGACACCGCGCCACCGCCAGACTCGACGGCGGCGTGCTGGGCTAAGGAGGTTCGCGAGCTCTCCTACGACGTCGACGACTTCCTCGACGAGCTAACGACCCAGCTCCTCCACCACCGCGGCGGCGGCGATGGCAGTAGCACTGCTGGTGCCAAGAAGATGATCAGCAGCATGATCGCCCGGCTTCGAGGGGAGCTTAACCGGCGGCGGTGGATCGCCGACGAGGTCACCCTGTTCAGCGCCCGCGTGAAGGAGGCCATTCGCCGCCAGGAGAGCTACCATCTTGGCAGGCGCACCTCGAGCTCGAGGCCGAGAGAAGAAGTCGACGACGACGATCGCGAGGACTCCGCCGGCAACGAACGCCGCCGGTTTCTGTCGCTGACGTTCGGGATGGACGACGCTGCTGTGCACGGCCAGCTCGTTGGTAGGGATATTTCGATGCAAAAGCTCGTCCGGTGGCTGGCCGACGGCGAGCCGAAGCTCAAGGTGGCTTCCATTGTTGGATCCGGAGGTGTTGGCAAGACGACGCTGGCCACAGAATTCTATCGTCTGCATGGCCGGCGGTTGGATGCGCCGTTCGACTGCCGGGCTTTCGTGCGGACGCCCCGGAAGCCTGACATGACGAAGATCCTCACCGACATGCTGTCACAGCTGCGGCCACAACATCAGCATCAGTCTTCGGATGTTTGGGAGGTTGATCGACTCCTTGAAACTATCCGGACGCATTTGCAAGATAAAAGGTACTTCATCATAATTGAAGATTTATGGGCTTCATCAATGTGGGATATTGTTAGCCGTGGTTTGCCTGATAATAATAGTTGCAGTAGAATACTAATAACAACAGAAATTGAACCTGTAGCTTTGGCATGCTGTGGATATAACTCAGAGCACATTATTAAGATTGATCCACTGGGTGATGATGTCTCAAGTCAATTGTTTTTCAGTGGAGTTGTTGGCCAAGGAAATGAATTTCCTGGACATCTTACTGAAGTTTCTCATGACATGATAAAAAAATGTGGTGGCTTGCCACTAGCAATAACTATAACAGCCAGACATTTTAAAAGCCAGCTGTTAGATGGAATGCAGCAATGGAATCACATACAAAAATCATTGACTACTTCCAATTTGAAGAAAAATCCTACTTTGCAGGGGATGAGGCAAGTACTCAACCTTATTTACAATAATCTTCCTCATTGTTTGAAAGCATGTCTGTTATACCTTAGCATCTACAAAGAGGACTACATAATTAGGAAGGCCAACTTGGTGAGGCAATGGATGGCTGAAGGTTTCATCAATTCCATAGAAAATAAAGTCATGGAAGAAGTTGCAGGGAACTATTTTGATGAACTTGTTGGTAGGGGCCTGGTCCAACCAGTAGATGTTAACTGCAAAAATGAGGTATTGTCATGTGTAGTGCACCACATGGTATTAAATTTCATCAGGTGTAAGTCAATAGAGGAGAATTTCAGCATTACATTGGATCATTCTCAGACGACAGTAAGACATGCTGACAAGGTTCGCCGACTCTCGCTTCACTTCAGCAATGCACATGATACAACACCACTAGCAGGTTTGAGACTCTCACAAGTTCGATCGATGGCATTTTTCGGACAAGTCAAGTGTATGCCTTCCATTGCAGATTATAGGCTTCTTCGAGTTCTGATTCTTTGTTTTTGGGCTGATCAAGAGAAAACAAGCTATGACCTCACAAGCATTTCTGAACTGTTACAACTGAGATATCTGAAGATAACAGGTAATATCACAGTTAAACTTCCAGAGAAGATCCAAGGACTACAACACTTGCAGACACTGGAAGCAGATGCAAGAGCAACTGCTGTCCTATTGGATATTGTTCATACACAGTGTTTGTTGCACCTTCGTCTTGTACTACTTGATCTGCTCCCTCACTGTCACAGGTACATCTTCACCAGCATCCCCAAATGGACTGGAAAGCTCAACAATCTCCGCATTTTAAACATTGCAGTCATGCAAATTTCCCAGGATGACCTTGACACTCTCAAAGGACTGGGATCTCTCACTGCTCTTTCGCTGCTTGTTCGAACAGCGCCTGCGCAAAGAATCGTCGCTGCGAATGAGGGGTTCGGGTCTCTCAAGTACTTCATGTTTGTCTGTACAGCACCATGCATGACTTTTGTGGAAGGAGCAATGCCGAGTGTGCAAAGATTAAATCTAAGGTTCAATGCCAACGAGTTCAAGCAGTATGACTCTAAGGAGACAGGGTTGGAACACTTGGTCGCCCTTGCAGAGATCTCTGCAAGAATTGGGGGCACTGATGATGATGAATCAAACAAAACTGAAGTGGAGTCTGCCTTGAGGACTGCAATTCGCAAGCATCCGACGCCGAGCACTCTTATGGTTGATATACAATGGGTGGATTGGATCTTTGGTGCTGAAGGGAGAGACTTGGATGAAGATTTGGCACAACAAGATGATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTTCTATGCATCTTCAACCTGACTTGATGATTGTTTGA

Pi-ta sequence in disease-resistant variety Katy (SEQ ID NO. 2)

ATGGCGCCGGCGGTCATTGCATCGCAGGGTGTCATCATGCGGTCCCTGACGAGCAAGCTCGACTCGCTGCTGCTGCAGCCGCCGGAGCCGCCGCCGCCTGCGCAACCGTCGTCGCTGCGGAAGGGGGAGAGGAAGAAGATCCTCCTCCTCAGAGGCGATCTCCGACACCTGCTAGATGACTACTACCTCCTCGTGGAGCCGCCGTCAGACACCGCGCCACCGCCAGACTCGACGGCGGCGTGCTGGGCTAAGGAGGTTCGCGAGCTCTCCTACGACGTCGACGACTTCCTCGACGAGCTAACGACCCAGCTCCTCCACCACCGCGGCGGCGGCGATGGCAGTAGCACTGCTGGTGCCAAGAAGATGATCAGCAGCATGATCGCGCGGCTTCGAGGGGAGCTTAACCGGCGGCGGTGGATCGCCGACGAGGTCACCCTGTTCAGGGCCCGCGTGAAGGAGGCCATTCGCCGCCACGAGAGCTACCATCTTGGCAGGCGCACCTCGAGCTCGAGGCCGAGAGAAGAAGACGACGACGACGATCGCGAGGACTCCGCCGGCAACGAACGCCGCCGGTTTCTGTCGCTGACGTTCGGGATGGACGACGCTGCTGTGCACGGCCAGCTCGTTGGTAGGGATATTTCGATGCAAAAGCTCGTCCGGTGGCTGGCCGACGGCGAGCCGAAGCTCAAGGTGGCTTCCATTGTTGGATCCGGAGGTGTTGGCAAGACGACGCTGGCCACAGAATTCTATCGTCTGCATGGCCGGCGGTTGGATGCGCCGTTCGACTGCCGGGCTTTCGTGCGGACGCCCCGGAAGCCTGACATGACGAAGATCCTCACCGACATGCTGTCACAGCTGCGGCCACAACATCAGCATCAGTCTTCGGATGTTTGGGAGGTTGATCGACTCCTTGAAACTATCCGGACGCATTTGCAAGATAAAAGGTACTTCATCATAATTGAAGATTTATGGGCTTCATCAATGTGGGATATTGTTAGCCGTGGTTTGCCTGATAATAATAGTTGCAGTAGAATACTAATAACAACAGAAATTGAACCTGTAGCTTTGGCATGCTGTGGATATAACTCAGAGCACATTATTAAGATTGATCCACTGGGTGATGATGTCTCAAGTCAATTGTTTTTCAGTGGAGTTGTTGGCCAAGGAAATGAATTTCCTGGACATCTTACTGAAGTTTCTCATGACATGATAAAAAAATGTGGTGGCTTGCCACTAGCAATAACTATAACAGCCAGACATTTTAAAAGCCAGCTGTTAGATGGAATGCAGCAATGGAATCACATACAAAAATCATTGACTACTTCCAATTTGAAGAAAAATCCTACTTTGCAGGGGATGAGGCAAGTACTCAACCTTATTTACAATAATCTTCCTCATTGTTTGAAAGCATGTCTGTTATACCTTAGCATCTACAAAGAGGACTACATAATTAGGAAGGCCAACTTGGTGAGGCAATGGATGGCTGAAGGTTTCATCAATTCCATAGAAAATAAAGTCATGGAAGAAGTTGCAGGGAACTATTTTGATGAACTTGTTGGTAGGGGCCTGGTCCAACCAGTAGATGTTAACTGCAAAAATGAGGTATTGTCATGTGTAGTGCACCACATGGTATTAAATTTCATCAGGTGTAAGTCAATAGAGGAGAATTTCAGCATTACATTGGATCATTCTCAGACGACAGTAAGACATGCTGACAAGGTTCGCCGACTCTCGCTTCACTTCAGCAATGCACATGATACAACACCACTAGCAGGTTTGAGACTCTCACAAGTTCGATCGATGGCATTTTTCGGACAAGTCAAGTGTATGCCTTCCATTGCAGATTATAGGCTTCTTCGAGTTCTGATTCTTTGTTTTTGGGCTGATCAAGAGAAAACAAGCTATGACCTCACAAGCATTTCTGAACTGTTACAACTGAGATATCTGAAGATAACAGGTAATATCACAGTTAAACTTCCAGAGAAGATCCAAGGACTACAACACTTGCAGACACTGGAAGCAGATGCAAGAGCAACTGCTGTCCTATTGGATATTGTTCATACACAGTGTTTGTTGCACCTTCGTCTTGTACTACTTGATCTGCTCCCTCACTGTCACAGGTACATCTTCACCAGCATCCCCAAATGGACTGGAAAGCTCAACAATCTCCGCATTTTAAACATTGCAGTCATGCAAATTTCCCAGGATGACCTTGACACTCTCAAAGGACTGGGATCTCTCACTGCTCTTTCGCTGCTTGTTCGAACAGCGCCTGCGCAAAGAATCGTCGCTGCGAATGAGGGGTTCGGGTCTCTCAAGTACTTCATGTTTGTCTGTACAGCACCATGCATGACTTTTGTGGAAGGAGCAATGCCGAGTGTGCAAAGGTTAAATCTAAGGTTCAATGCCAACGAGTTCAAGCAGTATGACTCTAAGGAGACAGGGTTGGAACACTTGGTCGCCCTTGCAGAGATCTCTGCAAGAATTGGGGGCACTGATGATGATGAATCAAACAAAACTGAAGTGGAGTCTGCCTTGAGGACTGCAATTCGCAAGCATCCGACGCCGAGCACTCTTATGGTTGATATACAATGGGTGGATTGGATCTTTGGTGCTGAAGGGAGAGACTTGGATGAAGATTTGGCACAACAAGATGATCACGGGTATGGATTTTTCATTCTATTCCCAGGTTACAACTTACAAGGATTATTGAGCTTCTTTCTTTCTCTGCCGTGGCTTCTATCTTTACCTGCTATGCATCTTCAACCTGACTTGATGATTGTTTGA

Ptr sequence (SEQ ID NO. 3) in Nipponbare (Nip) of susceptible variety

ATGGATAGGCTCTGGGCGGCTCCTCCACTCTCCTCCCCTCTCTCATATCCAGTGGCTCGGGGTGGTGGGGCGTGGCCGACGCATCCGGCGGCGGAGCTCGGGTGTTTAGCGGAGGAAGGATCGATGTCCGGCGCCGGACAGAGCCGTGGTCATCGCCTTGGATTACACATTGATTCGGATTGGCCAGAGGTCTTGTTGATCAATGACTATGCGGTGTTCATGGGGTACCTGTCGATGGTTGTCACCGGGACGGGGTTCCTGGTGCTCACGTGGTCCACCGTCATCCTCCTCGGTGGATTCGTCTCCATGCTATCCAACAAGGACTTCTGGAGTCTCACGGTGATCACGCTCGTTCAAACAAGGATATTCGATGTTTTTCTGAATGGAAAAGTAAGCCACATTGGGTACTCATTGAAGCGCTTGTGCAAGGCCGCACGCTTCATCGCGTTGCCCCATAACCATAAGAAGGTTGGGTTCAGGGGTGCTGTTCGAGTGCTTGTCTTCACCATCGTCTTGTGTCCGCTGTTCCTGCTCTACATGTTTGGGCTCTTCGTTTCCCCCTGGATTTCGCTGTGGCGTCTAATCCAGCAGGATTACGGCGTGACGGCCGGAGACAGCAGCAGCAAGGCACACCTGCAGCCTGCGCTGGTGGTTCTCTACTCCCTGGCCCTGTTCCAGGGCGTCCTCTTCTACTACAGGGCCATCTCTGCTTGGGAAGAACAGAAGCTAGTGAAAGATGTGGCCGACAAATACATGTTTGATACAGTGTCGCGCAGTTCAGTTTCGGACTATTTACATGAGATCAAGGTCGGATGTGAGAATGACCCGTCCTTTGCCAGAGGGAGGAACCTGATCACATACGCTGTCAAGCTGATGGAATCCACATCACCGGATGGGTACCTTTCAGGTGCACGGATTCTTGATACACTCATCAAGTTTAATAGAGATGATGCATCGGGGAGCGAATTACCGGGGCAGAGTATGCAGATATACAATATGATTGGATCTGCATCCTCCAGTCCCATACTCCACAACTTAGTTCAGATGCTGGATTTCAAAAGTGCATATGATGGAGAGATCAGGTTGCGAGCCGCAAGGATTGTTGAGCACTTTGCTGGTGAGGTCCGTTTAGACAAAATCCTGCAGGGGATTCGATGTGTATCTTCCTTGCTTGAACTCGAGCAGAAAGGATTTCAGAATGACCACCATAGTTCTTTCCAAGAAGACGACGGCGACCAACTTTCTTTTGAAGAAGAGGATGATCACCAGATTTCTGTCAAAGAAAAGGATTATTACCCCAAAGATTATAAACAGATGCAACTTACAGGCATGCAGATCCTTTTAAAGCTCTCCTACGACAAGAACAACTTGTTCCTCATGAGCAACACAGATGATCCGGCCTTGATCAACAAGATTGTGGCACTTATAACGTCCAAGGGATCACTTCACAAAAAACAACATAACGAATGGTCCTGTATGGCAGAGCTCGGGGTGAAGATACTAAGCCGATTTATGCGATTTATGTATGGCCCTACAAAATCAAACAATATTCTGTGGCATGAAATATCAACAAGCAGCAAAGCAATCGGCACCTTGGAGAGTATTCTTGAGTGTGACCAATGTGACTCTGTGCTGAAGAAACACGCCATAAGGATTCTCAAAAGGATATTCATGGATACATCTTCGGCTATGGGTGAAGGAGACAGAGAAAGGTTCATTGGCTCCTTGATGGACATGTCTCTTCACAACAGTAATGGTGACTTTCAAAATCTGGCAGGTGTAGATCTGGCGCTCAAGAAACAAGGGTTAAGCATTCTCAAAGAAATATACTTGAATCCATCTTCGATTATGGGCGAAGGAGACAGAGAAAGGTTCATCGGCTCCCTGATGGACATGTTTCTTGACAACAGTAAGGGCGACTTTGGAAATCTGCCAGGTGAAGATCTGGACCTCAAGAAACAAGAGTTAAGTATTCTCAAAGAAATATGCATGGATCCATCTTCGTTTATGGGCGAAGGTGACAGAGAAAAATTCATCGGCACCCTGATGGACATGTTTCTTCACAACAGCAAGGGCGACTTGTTTGAAAAACTAGCAGGTGATGATCTGGTGCAGATATGTAGAAGAAGTGGAAGCAGTGCCACGATCATATTGAGGAAATATGGTCATGATATTGTTGATTGTATTGCTGATACTCGTTCAAGCGTATATAGCAGCATGCACAGAAAAATTGCAGCAAAGATCCTCAATCATCTGTGTAGTCCCTACTCCACTGACGAGGAACATCTTCAGAATCTGAAGGAGGCCATCATTGATTTGATACCCAAGGTGCTAAGAGAAGCACTTGGTTGGGGGTTGACAGGAGAAGAGATACTGCGAGTGGCAGTTTCAGGCCTTGAAGGTACCCAAGATGATGACTGGAAATTGCAGGAAGCATTGGCGTCCCTCTGTGCAACCGTGTTTAACAGAATTGTCAGCAAGGATGCAGATTTGACTGCTCGGTTCAACAACATCGCCGCTGGTATCTGCGACCAGACAACGAAGCCTCGCATGACCTTCGCAGACCTCATCAATGAAGCTGTAAAAGTTCATCGCATCGAATTTAAAAAACCAGAAAAACCAAAACCAGCTGCCAGGCCGGAACTGTACGAGTTTGTGACTGCGAAATACACCCCGCCCCACTTTATGTTTTTGGGCGAGGAAGATCCCAACGCGTGTTGTATCTCTTGA

Ptr sequence in disease-resistant variety Katy (SEQ ID NO. 4)

ATGGATAGGCTCTGGGCGGCTCCTCCACTCTCCTCCCCTCTCTCATATCCAGTGGCTCGGGGTGGTGGGGCGTGGCCGACGCATCCGGCGGCGGAGCTCGGGTGTTTAGCGGAGGAAGGATCGATGTCCGGCGCCGGACAGAGCCGTGGTCATCGCCTTGGATTACACATTGATTCGGATTGGCCAGAGGTCTTGTTGATCAATGACTATGCGGTGTTCATGGGGTACCTGTCGATGGTTGTCACCGGGACGGGGTTCCTGGTGCTCACGTGGTCCACCGTCATCCTCCTCGGTGGATTCGTCTCCATGCTATCCAACAAGGACTTCTGGAGTCTCACGGTGATCACGCTCGTTCAAACAAGGATATTCGATGTTTTTCTGAATGGAAAAGTAAGCCACATTGGGTACTCATTGAAGCGCTTGTGCAAGGCCGCACGCTTCATCGCGTTGCCCCATAACCATAAGAAGGTTGGGTTCAGGGGTGCTGTTCGAGTGCTTGTCTTCACCATCGTCTTGTGTCCGCTGTTCCTGCTCTACATGTTTGGGCTCTTCGTTTCCCCCTGGATTTCGCTGTGGCGTCTAATCCAGCAGGATTATGGCGTGACGGCCGGAGACAGCAGCAGCAAGGCACACCTGCAGCCTGCGCTGGTGGTTCTCTACTCCCTGGCCCTGTTCCAGGGCGTCCTCTTCTACTACAGGGCCATCTCTGCTTGGGAAGAACAGAAGCTAGTGAAAGATGTGGCCGACAAATACATGTTTGATACAGTGTCGCGCAGTTCAGTTTCGGACTATTTACATGAGATCAAGGTGGGATGTGAGAATGACCCGTCCTTTGCCAGAGGGAGGAACCTGATCACATACGCTGTCAAGCTGATGGAATCCACATCACCGGATGGGTACCTTTCAGGTGCACGGATTCTTGATACACTCATCAAGTTTAATAGAGATGATGCATCGGGGAGCGAATTACCGGGGCAGAGTATGCAGATATACAATATGATTGGATCTGCATCCTCCAGTCCCATACTCCACAACTTAGTTCAGATGCTGGATTTCAAAAGTGCATATGATGGAGAGATCAGGTTGCGAGCCGCAAGGATTGTTGAGCACTTTGCTGGTGAGGTCCGTTTAGACAAAATCCTGCAGGGGATTCGATGTGTATCTTCCTTGCTTGAACTCGAGCAGAAAGGATTTCAGAATGACCACCATAGTTCTTTCCAAGAAGACGACGGCGACCAACTTTCTTTTGAAGAAGAGGATGATCACCAGATTTCTGTCAAAGAAAAGGATTATTACCCCAAAGATTATAAACAGATGCAACTTACAGGCATGCAGATCCTTTTAAAGCTCTCCTACGACAAGAACAACTTGTTCCTCATGAGCAACACAGATGATCCGGCCTTGATCAACAAGATTGTGGCACTTATAACGTCCAAGGGATCACTTCACAAAAAACAACATAACGAATGGTCCTGTATGGCAGAGCTCGGGGTGAAGATACTAAGCCGATTTATGCGATTTATGTATGGCCCTACAAAATCAAACAATATTCTGTGGCATGAAATATCAACAAGCAGCAAAGCAATCGGCACCTTGGAGAGTATTCTTGAGTGTGACCAATGTGACTCTGTGCTGAAGAAACACGCCATAAGGATTCTCAAAAGGATATTCATGGATACATCTTCGGCTATGGGTGAAGGAGACAGAGAAAGGTTCATTGGCTCCTTGATGGACATGTCTCTTCACAACAGTAATGGTGACTTTCAAAATCTGGCAGGTGTAGATCTGGCGCTCAAGAAACAAGGGTTAAGCATTCTCAAAGAAATATACTTGAATCCATCTTCGATTATGGGCGAAGGAGACAGAGAAAGGTTCATCGGCTCCCTGATGGACATGTTTCTTGACAACAGTAAGGGCGACTTTGGAAATCTGCCAGGTGAAGATCTGGACCTCAAGAAACAAGAGTTAAGTATTCTCAAAGAAATATGCATGGATCCATCTTCGTTTATGGGCGAAGGTGACAGAGAAAAATTCATCGGCACCCTGATGGACATGTTTCTTCACAACAGCAAGGGCGACTTGTTTGAAAAACTAGCAGGTGATGATCTGGTGCAGATATGTAGAAGAAGTGGAAGCAGTGCCACGATCATATTGAGGAAATATGGTCATGATATTGTTGATTGTATTGCTGATACTCGTTCAAGCGTATATAGCAGCATGCACAGAAAAATTGCAGCAAAGATCCTCAATCATCTGTGTAGTCCCTACTCCACTGACGAGGAACATCTTCAGAATCTGAAGGAGGCCATCATTGATTTGATACCCAAGGTGCTAAGAGAAGCACTTGGTTGGGGGTTGACAGGAGAAGAGATACTGCGAGTGGCAGTTTCAGGCCTTGAAGGTACCCAAGATGATGACTGGAAATTGCAGGAAGCATTGGCGTCCCTCTGTGCAACCGTGTTTAACAGAATTGTCAGCAAGGATGCAGATTTGACTGCTCGGTTCAACAACATCGCCGCTGGTATCTGCGACCAGACAACGAAGCCTCGCATGACCTTCGCAGACCTCATCAACGAAGCTGTAAAAGTTCATCGCATCGAATTTATGCCTGAACCACCTGCCAAGCCGGAACCGTACGAGTTTATGCCTGCGAAATACCCCCCGCCCCACTATATGTTTTTGGTCGAGGAAGATCCCAACGCGTGTTGTATCTCTTGA。

Claims (10)

1. A rice Pi-ta and Ptr dominant functional molecular marker is characterized in that the Pi-ta molecular marker is positioned at the 2752 th nucleotide of a rice Pi-ta gene, and when the site is G, the Pi-ta molecular marker is a Pi-ta disease-resistant allele; when the locus is T, the locus is a Pi-ta susceptibility allele; the Ptr molecular marker is positioned at 2606 th and 2611 th nucleotide variations of a rice Ptr gene and 12 2608 th nucleotide insertion/deletion variations, namely, when 2606 th is T, 2612 th is G and 2608 th lacks a 12bp sequence, the Ptr molecular marker is a Ptr disease-resistant allele; and the gene is Ptr susceptible allele when the positions 2606 and 2612 are A and 2608 are inserted with 12bp sequence; the 12bp sequence is AAACCAGAAAA.

2. A primer of a rice Pi-ta and Ptr dominant functional molecular marker is characterized in that a nucleotide sequence containing the molecular marker is shown in SEQ ID NO. 1-4.

3. A primer of a rice Pi-ta and Ptr dominant functional molecular marker is characterized by comprising the following primer sequences:

pi-ta upstream primer: 5 'TGCCGTGGCTTCTATCTTTACCTG-3';

pi-ta downstream primer: 5 'GTTATGCTGTCCTCAAACACCTCG-3';

ptr upstream primer: 5 'CCAAGGTACGTTAGTAGTCGCTGTCATTTA-3';

ptr downstream primer: 5 'GCTTGGCAGGTGGTTCAGGCA-3'.

4. A method for detecting rice blast resistance, characterized in that the primer of claim 3 is used to perform PCR amplification on rice genomic DNA, and the resistance to rice blast contained in the DNA is judged according to the amplification result.

5. The method of detecting resistance to rice blast as claimed in claim 4, wherein if a band of 471bp in size is obtained after amplification, the Pi-ta resistance allele is carried; if a band with the size of 619bp is obtained after amplification, the band carries the Ptr disease-resistant allele; if the sample to be detected carries the Pi-ta disease-resistant allele and the Ptr disease-resistant allele at the same time, the rice blast resistance of the sample to be detected is stronger.

6. The method of detecting resistance to rice blast as claimed in claim 4, wherein the PCR reaction system is 20. Mu.L, and comprises 10. Mu.L of 2 XTAQA Master Mix,DNA template 2. Mu.L, 10. Mu. Mol/L upstream and downstream primers 1. Mu.L each, ddH ₂ Make up to 20. Mu.L of O.

7. The method for detecting rice blast resistance according to claim 4, wherein the reaction conditions are: (1) pre-denaturation at 98 ℃ for 5min; (2) Denaturation at 98 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 35s for 35 cycles; (3) extending for 5min at 72 ℃; and (5) carrying out 1% agarose gel electrophoresis on the amplification product, scanning and photographing by a gel imager, and recording an electrophoresis result.

8. The method for detecting rice blast resistance according to claim 4, wherein the DNA extraction method comprises: taking 100mg of rice leaves growing for two weeks, placing the rice leaves in a 2mL centrifuge tube containing steel balls, immediately freezing the rice leaves for 5min by using liquid nitrogen, placing the rice leaves in a ball mill, fully crushing plant tissues, and extracting genome DNA; the concentration and purity of the DNA sample were measured by a nucleic acid protein detector, and the DNA concentration was adjusted to 50 ng/. Mu.L and stored at-20 ℃ for further use.

9. A reagent or a kit comprising the primer according to claim 3.

10. The application of the rice Pi-ta and Ptr dominant functional molecular marker of claim 1 or the primer of claim 3 in the screening and identification of rice blast resistance rice germplasm resources or molecular marker assisted breeding.

Images