CN107012142A - A kind of molecular labeling of wheat feature NAM B1 genes and its application - Google Patents
A kind of molecular labeling of wheat feature NAM B1 genes and its application Download PDFInfo
- Publication number
- CN107012142A CN107012142A CN201710332782.2A CN201710332782A CN107012142A CN 107012142 A CN107012142 A CN 107012142A CN 201710332782 A CN201710332782 A CN 201710332782A CN 107012142 A CN107012142 A CN 107012142A
- Authority
- CN
- China
- Prior art keywords
- nam
- wheat
- feature
- genes
- spnam
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to wheat feature NAM B1 gene molecule markers and its application.The present invention provides wheat feature NAM B1 gene molecule marker SpNAM B1, and the primer pair sequence of the mark is expanded as shown in SpNAM B1 F and SpNAM B1 R for specific PCR.Can identify in wheat whether contain feature NAM B1 genes using the mark.The mark can be used for wheat high protein molecular breeding, pass through the marker assisted selection, it can help to cultivate high protein, the new variety of wheat of high ferro Zn content by the feature NAM B1 gene transfers for controlling grain protein content into the acceptor material for lacking the functioning gene.
Description
Technical field
The present invention relates to a kind of molecular labeling of wheat feature NAM-B1 genes and its in wheat breed identification and molecule
Application in marker-assisted breeding.
Background technology
Wheat（Triticum aestivum）It is important cereal crops, is the staple food of about 30% population in the world, accounts for complete
Nearly the 20% of ball calorie total quantity consumed（IWGSC, 2014; Pfeiferet al., 2014）.Wheat is allohexaploid,
Genome is by three sets of genomes（AABBDD）Composition, is the wild emmer by tetraploid（T. turgidum, genome
Type AABB）With the Triticum tauschii of diploid（A. tauschii, genome type DD）Hybridization is obtained, and that comes by domestication is small
Wheat has worldwide accounted for more than the 95% of different type wheat crops cultivated area（IWGSC, 2014; Marcussen
et al., 2014）.
Wheat is important protein and trace elements iron, the source of zinc, and the protein provided accounts for total quantity consumed
25% there is provided iron, zinc account for the 16% and 12% of average ordinary meal amount to obtain respectively（FAO, 2015；Bates et al.,
2014）.Due to being influenceed by factors such as environment, heredity and the negative correlation between yield, Protein Content of Wheat Kernel is improved
Progress it is slow（Simmonds, 1995）.Early in 1978, Avivi et al. was wild two small in wheat progenitor species
A control grain protein and iron, the character site of Zn content are found that in wheat.2006, Uauy et al. passed through map based cloning
Technology is found that NAM-B1 genes in the character site, and the gene belongs to the transcription factor gene of NAC types.Research shows,
In most wheats, NAM-B1 genes are due to there occurs gene delection（Genome is free of the gene order）Or nucleotide variation
（There is Individual base site in the gene order, but gene order in genome to undergo mutation）Lose function, and feature
In the wheat breed for being present in wheat progenitor species wild emmer and a small number of Northern Europe sources NAM-B1 genes more
（Uauyetal., 2006; Asplund et al., 2010; Hagenblad et al., 2012）.Pass through molecular labeling
The method of assisted Selection will be from feature NAM-B1 channel genes NAM- present in wild emmer or a small number of wheats
In the wheat that B1 genes morph, the micronutrient levels such as grain protein and iron, zinc is significantly increased（Tabbita et
al., 2017）.Therefore, screen, identify the Wheat Germplasm Resources containing feature NAM-B1 genes, and it is auxiliary by molecular labeling
The method for helping breeding, will improve small
The important channel of wheat grain protein content and nutritional quality.
Since the character site containing feature NAM-B1 genes in 1978 is found, forefathers have just carried out the work(
Research in energy property channel genes common wheat, and some molecular labelings are developed for assisted selection.At present in report
Used molecular labeling and not according to feature NAM-B1 gene its own sequence characteristic Designs, but according to feature NAM-
The mutually chain other sequence sites design of B1 gene locis, has the following disadvantages in the application：1, dyed during mitosis
Body weight group, may cause molecular labeling to be separated with chain feature NAM-B1 gene locis, i.e. molecular labeling can not be after
Continuous grappling feature NAM-B1 genes, especially when molecular labeling design site range capability NAM-B1 gene locis farther out
The possibility that Shi Erzhe is separated is higher；2, these molecular labelings are to be directed to a certain specific wheat donor material and acceptor material
Material design, due to the difference of Wheat Germplasm Resources genetic background, it is impossible to ensure these molecular labelings in other wheat lines
The stability of place site feature, i.e. molecular labeling site feature there may be difference between different materials, cause other
Do not applied in material so that the molecular labeling is only applicable between a certain specific donor material and acceptor material；3, as described above,
These molecular labelings are not suitable for screening and being identified containing the small of feature NAM-B1 genes from substantial amounts of Wheat Germplasm Resources
Wheat material.4, these molecular labelings are generally CAPS（Cleavage Amplified Polymorphic Sequences）Type,
Also need to cumbersome, time-consuming in specific restriction endonuclease reaction, operation after being expanded through PCR, cost is higher.
The clone of NAM-B1 genes（Uauyetal., 2006）To design molecular labeling according to NAM-B1 genes its own sequence
There is provided possibility, but such molecular labeling is not found also at present, it is understood that there may be following reason：1, NAM-B1 gene exists
There are three kinds of situations in wheat, that is, lack（The gene order is not contained）, base mutation and feature NAM-B1 genes.In feature
Only has the difference of Individual base between NAM-B1 gene orders and the NAM-B1 gene orders of mutation so that according to NAM-B1 genes
Its own sequence characteristic Design molecular labeling, which distinguishes feature NAM-B1 genes and the NAM-B1 genes of mutation, has certain difficulty；
2, wheat is allohexaploid, there is 3 sets of genomes（AABBDD）Composition, in addition to NAM-B1 genes, also exist NAM-A1,
The functional cognate gene such as NAM-D1, NAM-B2 and NAM-D2.Feature NAM-B1 genes are free of different from most wheats,
Four functional cognate genes of the above are present in wheat, and have very high similitude with NAM-B1 gene orders（Point
Wei 94.6%, 95.5%, 85.1% and 84.6%）.Wheat acquisition feature NAM-B1 genes are made further to improve seed egg
In the molecular mark of white matter and iron Zn content, NAM-A1, NAM-D1, NAM-B2 and NAM-D2 etc. are present in wheat
In functional cognate gene order, the molecular labelings of only specific amplification feature NAM-B1 genes is proposed it is higher will
Ask.
Xie Chaojie etc.（Number of patent application：CN201610305899.7）According to NAM-A1 in wheat, NAM-B1, NAM-D1,
Conserved domains between NAM-B2 and NAM-D2 sequences devise molecular labeling, can detect simultaneously in wheat whether there is with
Upper five genes.Because molecular labeling design is in conservative region, it is impossible to the feature NAM- to only existing Individual base difference
B1 genes and the NAM-B1 genes of variation are effectively distinguished.Further, since wheat existing NAM-A1, NAM-D1, NAM-B2
With the functioning gene such as NAM-D2, without making wheat obtain these genes by the method for molecular marker assisted selection again, with
Upper deficiency greatly limit it and be excavated in wheat in feature NAM-B1 genes and molecular mark
Using.Xie Chaojie etc.（Number of patent application：CN201610305899.8；CN201610305899.8）Respectively in haynaldia villosa（H. villosa, genome type VV）Goatweed is held in the palm with this inferior that is intended（ASpeltoides, genome type SS）In cloned it is small
The homologous gene NAM-V1 and NAM-S1 of wheat feature NAM-B1 genes, and devise specific point according to gene sequence characteristic
Son mark.Can be by heterologous NAM-V1 and NAM-S1 channel genes wheats, to improving by these molecular marker assisted selections
The trace element such as Wheat Grain Protein and iron, zinc has potential function.But, demonstrate,proved for the research that wheat itself is present
It is bright to significantly improve the feature NAM-B1 genes of the micronutrient levels such as grain protein and iron, zinc, according to its sequence signature
Design is with the specific molecular marker applied to feature NAM-B1 genetic tests and molecular marker assisted selection breeding in wheat.
The content of the invention
There is provided wheat feature NAM-B1 gene molecule markers SpNAM- for the deficiencies in the prior art by the present invention
B1, the mark directly can identify in wheat lines whether contain feature NAM-B1 genes by the amplification of PCR primer, without
The operation such as digestion parting is carried out to PCR primer again, a large amount of wheat lines can be carried out easily and fast, accurately using the mark
Ground is identified, to excavate the wheat lines containing feature NAM-B1 genes.
It is another object of the present invention to above-mentioned molecular labeling is used for into marker assisted selection breeding.Because the molecular labeling is
According to feature NAM-B1 gene its own sequence characteristic Designs, therefore, its application is not limited to donor material and acceptor material
Selection, with wide applicability., can be accurately by feature NAM-B1 gene transfers by the marker assisted selection breeding
Into acceptor material, the new variety of wheat for cultivation high protein, high ferro Zn content provides technological means.
The present invention is based on following design：According to genes such as NAM-B1 genes and NAM-A1, NAM-D1, NAM-B2 and NAM-D2
Polymorphism and feature NAM-B1 genes between sequence and the SNP site between the NAM-B1 genes of variation separately design forward direction
Performing PCR amplification is only entered in primer and reverse primer, the primer combination of formation to feature NAM-B1 gene orders.Due to that can exclude
Already present functional cognate base in the wheats such as NAM-B1 genes and NAM-A1, NAM-D1, NAM-B2, NAM-D2 to variation
The amplification of cause, the inventive method can be used for excavating feature NAM-B1 genes in Wheat Germplasm Resources and by feature NAM-
The other marker assisted selection breedings without the functioning gene wheat of B1 channel genes.
In order to realize the object of the invention, the present invention provides a kind of wheat feature NAM-B1 gene molecule markers SpNAM-
B1, the mark can specifically detect in wheat whether contain feature NAM-B1 genes.
The primer for expanding the molecular labeling for specific PCR is：Forward primer SpNAM-B1-F 5'-
CATAGAAGGAAGTGGCGGAATACT -3' and reverse primer SpNAM-B1-R 5'-
GGATTATTCGATTATTTAATTGCAGCG -3'。
Whether the present invention also provides the molecular labeling in detection wheat breed containing answering in feature NAM-B1 genes
With
Specifically, the application comprises the following steps：
1) genomic DNA of plant to be measured is extracted；
2) using the genomic DNA of plant to be measured as template, using the primer SpNAM-B1-F and SpNAM-B1-R, performing PCR is entered
Amplified reaction；
3) pcr amplification product is detected.
PCR reaction systems：50-100ng/uLDNA templates 1uL, 10 pmol/uL primers SpNAM-B1-F, SpNAM-B1-R
The ul of each 0.5uL, 2 × PCR mix 10（Buffer containing PCR, dNTP, Taq DNA polymerase, Mg2+Deng）, add water to 20
uL。
PCR response procedures：95℃ 3min；94 DEG C of 30s, 62 DEG C of 30s, 72 DEG C of 30s, 35 circulations；72℃2min.
Wherein, step 3) using 1.5% agarose gel electrophoresis and ethidium bromide staining detection pcr amplification product, amplify
Clip size be 773bp, corresponding to sequence of the feature NAM-B1 genes between primer SpNAM-B1-F and SpNAM-B1-R
Column-slice section.
The present invention also offer being used for containing the primer SpNAM-B1-F and SpNAM-B1-R detects work(in wheat breed
The kit of energy property NAM-B1 genes, the kit is made up of following component：The gene molecule markers of NAM-B1 containing feature
The PCR reaction premixed liquids of SpNAM-B1 primers（Also include PCR buffer, dNTP, Taq DNA polymerase, Mg2+Deng）Make respectively
For positive control（The gene orders of NAM-B1 containing feature）And negative control（Without feature NAM-B1 gene orders）Plasmid.
The present invention further provides applications of the molecular labeling SpNAM-B1 in wheat molecular marker assistant breeding.
The molecular labeling SpNAM-B1 that the present invention is provided, can specifically detect in wheat whether contain feature NAM-
B1 genes.Using the mark can easily and fast, it is accurate feature NAM-B1 genes are excavated from a large amount of Wheat Germplasm Resources,
The mark can be used for wheat high protein molecular breeding, can be by feature NAM-B1 channel genes by the marker assisted selection
In other acceptor materials without the functioning gene, help to cultivate high protein, the new variety of wheat of high ferro Zn content.
Brief description of the drawings
Fig. 1 is molecular labeling SpNAM-B1 forward primers SpNAM-B1-F and reverse primer in the embodiment of the present invention 1
SpNAM-B1-R designs the selection in site；Wherein, a：Forward primer SpNAM-B1-F designs site, selection ATG upstream 424bp-
446bp site（Red-label）Forward primer is designed, for distinguishing NAM-B1 gene orders and other four functional cognates
Gene（NAM-A1, NAM-D1, NAM-B2 and NAM-D2）；b：Reverse primer SpNAM-B1-R designs site, with feature NAM-
SNP site of the NAM-B1 gene orders of B1 gene orders and variation the 301st, ATG downstreams（C/A）Held for reverse primer 3 '
Last base, while 3rd bit base adjacent with this site is changed into base mismatch G.Site where reverse primer is ATG
Downstream 301bp -327bp, is mainly used in distinguishing the NAM-B1 gene orders of feature NAM-B1 gene orders and variation.
The feature NAM-B1 gene orders length that SPNAM-B1-F and SPNAM-B1-R are amplified is 773bp.
Fig. 2 is screened in Wheat Cultivars for molecular labeling SpNAM-B1 in the embodiment of the present invention 2, is identified feature
The amplification situation of NAM-B1 genes.Wherein, a：Microsatellite marker（WMS261）The amplification situation of primer, b：NAM-B1 genes are general
The amplification situation of primer, c：Feature NAM-B1 gene molecule markers SpNAM-B1 amplification situation；Print is numbered and correspondence is small
Wheat variety is as follows：1-peaceful wheat No. 3,2-peaceful wheat No. 9,3-peaceful wheat No. 10,4-peaceful wheat 11,5-peaceful wheat 13,6-peaceful wheat 16,
7-peaceful wheat 17,8-peaceful wheat 19,9-peaceful wheat 20,10-peaceful wheat 21,11-peaceful wheat 22,12-peaceful wheat 23,13-raises wheat No. 9,
14-raising wheat 16,15-raise wheat 20,16-China wheat No. 5,17-magnificent wheat No. 6,18-peaceful glutinous wheat No. 1,19-peaceful salt 1,20-
Agriculture rich 126,21-town wheat No. 5,22-town wheat No. 6,23-Jathti. keratchna, 24-Tankokeratchua.
NAM-B1 gene orders and feature NAM-B1 gene orders that Fig. 3 contains for 13 parts of wheat breeds in embodiment 2
Compare；Chinese Wheat Cultivars：Peaceful wheat No. 10, peaceful wheat 11, peaceful wheat 17, peaceful wheat 21, peaceful wheat 23, raise wheat No. 9, raise wheat 16, magnificent wheat 5
Number, magnificent wheat No. 6, peaceful glutinous wheat No. 1, agriculture rich 126
Finland's wheat breed：Jathti. keratchna, 24:Tankokeratchua.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Unless otherwise specified, following real
Example is applied according to conventional laboratory conditions, such as Sambrook equimoleculars Cloning: A Laboratory Manual (NewYork:
ColdSpringHarborLaboratoryPress, 1989) described in operating technology code, or according to proposed by manufacturer
Experiment condition；Raw materials used is commercial goods.
The exploitation of the wheat feature NAM-B1 gene molecule markers of embodiment 1
Forward primer：According to Wu Dan etc.（2015）The NAM-A1 cloned in wheat（KM820886）、NAM-B1（KM820887）、
NAM-D1（KM820889）、NAM-B2（KM820888）And NAM-D2（KM820890）The cDNA sequence of gene, in wheat cdna
Group database（http://www.wheatgenome.org/）Middle progress BLAST compares analysis, obtains each member gene's sequence.
Because these genes have of a relatively high homology between initiation codon ATG and terminator codon TGA, and positioned at both sides
Sequence homology it is relatively low, selection ATG upstream promoter region NAM-B1 gene orders and other 4 functional cognates gene sequences
The positive pcr amplification primer thing of difference site design of row（Fig. 1 a）, to ensure the specific amplification to NAM-B1 gene orders.Primer
Sequence is SpNAM-B1-F：5'-CATAGAAGGAAGTGGCGGAATACT-3', positioned at NAM-B1 gene order ATG upstreams
424bp - 446bp。
Reverse primer：According to feature NAM-B1 gene orders and the NAM-B1 gene orders of variation in ATG downstreams the 301st
Position forms C/A type SNP sites, using this site as last base at the end of reverse primer 3 ', this site and variation
The amplification for the NAM-B1 gene orders that the mispairing of NAM-B1 gene orders makes a variation effective suppression.Meanwhile, hold the 3rd in primer 3 '
Introduce base mismatch G（Guanine deoxyribonucleotide）, although this site introduces base mismatch to feature NAM-B1 genes
The amplification of itself can also produce certain influence, but will further suppress the amplification of variation NAM-B1 gene orders（Fig. 1 b）.Primer
Sequence is SpNAM-B1-R：5'-GGATTATTCGATTATTTAATTGCAGCG-3', positioned at feature NAM-B1 gene orders
ATG downstreams 301bp -327bp.
Molecular labeling primer SpNAM-B1-F and SpNAM-B1-R enters the fragment of performing PCR amplification to feature NAM-B1 genes
Length is 773bp.
Embodiment 2 utilizes molecular labeling SpNAM-B1 screenings, wheat lines of the identification containing feature NAM-B1 genes.
Select 22 parts of Chinese Wheat Cultivars（It is peaceful wheat No. 3, peaceful wheat No. 9, peaceful wheat No. 10, peaceful wheat 11, peaceful wheat 13, peaceful wheat 16, peaceful
Wheat 17, peaceful wheat 19, peaceful wheat 20, peaceful wheat 21, peaceful wheat 22, peaceful wheat 23, wheat No. 9 is raised, wheat 16 is raised, raises wheat 20, magnificent wheat No. 5, magnificent wheat 6
Number, peaceful glutinous wheat No. 1, peaceful salt 1, agriculture rich 126, town wheat No. 5, town wheat No. 6）Northern Europe is come from 2 parts（Finland）Wheat breed
（Jathti. Keratchna and Tankokeratchua）As research material, each wheat breed genomic DNA is extracted.Utilize
Microsatellite marker（microsatellite marker）WMS261 enters performing PCR amplification to all samples with the complete of detection template DNA
Whole property（Fig. 2 a）；Enter performing PCR amplification to detect whether containing NAM-B1 gene orders using the universal primer of NAM-B1 genes（Figure
2b）；Enter performing PCR amplification to detect whether containing feature NAM-B1 gene orders using molecular labeling SpNAM-B1（Fig. 2 c）.
To the wheat breed containing NAM-B1 gene orders, the PCR primer of amplification is sequenced, with feature NAM-B1 gene orders
It is compared to verify molecular labeling SpNAM-B1 testing result（Fig. 3）.
Wheat volatiles DNA extraction method is as follows：
1) the 0.1 fresh blade of g wheats is taken, with liquid nitrogen grinding into powder, is placed in 2 ml Eppendof pipes of precooling；
2) CTAB extract solutions (2%CTAB, 1.4 mol/L NaCl, 20 mmo/L EDTA are preheated in 65 DEG C of water-baths
(pH8.0), 100 mmol/L Tris-HCl (pH8.0), 2% PVP-40)；
3) the CTAB extract solutions of 700 μ L preheatings are added in every 100 mg samples, it is rapid to mix, in 65 DEG C of 15~20min of warm bath, phase
Between mix 3~5 times；
4) chloroform/isoamyl alcohol (volume ratio 24 of 1 times of volume is added:1), mix；
5) 12000rpm room temperatures centrifugation 10min；
6) supernatant is transferred in a new centrifuge tube；
7) chloroform/isoamyl alcohol (volume ratio 24 is used:1) repeat step (4)~(6)；
8) add isometric isopropanol, overturn and mix, -20 DEG C of 10 min of placement；
9) 12000 rpm room temperatures centrifugation 15min；
10) supernatant is outwelled, precipitation is washed with 75% ethanol 1ml, ethanol is discarded, repeated 2~3 times；
11) air drying is precipitated, with 50 μ l deionized waters or TE dissolving DNAs, be placed in -20 DEG C it is standby；
12) DNA concentration is determined, the amount of deionized water for needing to add is calculated, genomic DNA is diluted stand-by.
Microsatellite marker WMS261 and NAM-B1 gene universal primer sequence is respectively with reference to Korzun etc.（1998）And Uauy
Deng（2006）Report.
Pcr amplification reaction system is as follows：50-100 ng/uL DNA profilings 1uL, 10 pmol/uL primers Fs, R each 0.5
The ul of uL, 2 × PCR mix 10（Buffer containing PCR, dNTP, Taq DNA polymerase, Mg2+ etc.）, add water to 20 uL.
PCR response procedures：95℃ 3min；94 DEG C of 30s, 58-62 DEG C of 30s, 72 DEG C of 30s, 35 circulations；72℃
2min.Wherein WMS261 labeled primers annealing temperature is 58 DEG C；NAM-B1 gene universal primers annealing temperature is 59 DEG C；Molecule mark
It is 62 DEG C to remember SpNAM-B1 primer annealing temperatures.
Using agarose gel electrophoresis detection detection pcr amplification product.
Prepare Ago-Gel（1.5%）Method is as follows：1.5g Ago-Gels are weighed, 100ml Ago-Gels electricity is added
Swimming buffer solution, after micro-wave oven dissolving, adds the ethidium bromide that 30ul concentration is 1mg/ml（EB）, glue plate is poured into after mixing.
Agarose gel electrophoresis buffer solution（TAE）Formula（10×）It is as follows：Successively dissolved in 800ml deionized waters
48.4g Tris and 3.72g Na2EDTA·2H2O, the glacial acetic acid for adding 11.4ml is stirred and evenly mixed, and is settled to deionized water
1L。
Running buffer system is：1 × TAE, 120V electrophoresis about 20 minutes.
Ago-Gel after electrophoresis is imaged using ultraviolet irradiation.
According to Ago-Gel imaging results, NAM-B1 genes universal primer is expanded to the PCR primer obtained, each production is determined
Thing sequence, the homologous ratio of multisequencing is carried out using DNAMAN softwares to the fragment sequence of acquisition with feature NAM-B1 gene orders
It is right.
Analysis result shows that microsatellite marker WMS261 primers purposeful fragment in all samples genomic DNA goes out
It is existing, illustrate that all samples genomic DNA quality meets PCR detections；The universal amplification primer of NAM-B1 genes is in 13 parts of wheat product
PCR primer is amplified in kind, does not have PCR primer appearance in remaining 11 parts of wheat breed, illustrates that this 13 parts of wheat breeds contain
NAM-B1 gene orders, and remaining 11 parts of wheat breed missing NAM-B1 gene order；Molecular labeling SpNAM-B1 primers are only 2
Part Northern Europe（Finland）PCR primer is amplified in wheat breed（Fig. 2）, illustrate that only this 2 parts of Wheat Varieties Introduced from Abroad contain feature
NAM-B1 gene orders.In order to prove result above, by the PCR that NAM-B1 gene universal primers are amplified in 13 parts of wheat breeds
Product Sequence is compared with feature NAM-B1 gene orders（Fig. 3）, find to contain NAM-B1 gene orders at 13 parts
Wheat breed in, there are 2 SNP sites of identical in the NAM-B1 gene orders in 11 parts of Chinese Wheat Cultivars, with Uauy
Et al. the variant sites that are found in other wheat breeds it is consistent, illustrate the NAM-B1 bases that 11 parts of Chinese Wheat Cultivars contain variation
Because of sequence.And the NAM-B1 gene orders in remaining 2 parts of Wheat Varieties Introduced from Abroad are consistent with feature NAM-B1 gene orders, explanation
This 2 parts of wheat breeds contain feature NAM-B1 genes, it was demonstrated that molecular labeling SpNAM-B1 being capable of specific identification work(
Energy property NAM-B1 genes, so that excavation and molecular marker assisted selection breeding applied to wheat feature NAM-B1 genes.
Applications of the molecular labeling SpNAM-B1 of embodiment 3 in wheat molecular marker assistant breeding.
During wheat breeding, separation offspring can be selected using molecular labeling in each generation ,-can be accurate
The individual containing feature NAM-B1 genes really is obtained into next breeding generation, breeding efficiency can be greatly improved.
The experimental technique being related to and process are same as Example 2.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements.It is to be utilized respectively NAM-B1 genes in place of the feature of the present invention
With other 4 functional cognate genes（NAM-A1, NAM-D1, NAM-B2 and NAM-D2）Difference site and function between sequence
Property NAM-B1 genes and variation NAM-B1 gene orders between SNP site design forward primer and reverse primer, and pass through
Adjustment is adjacent with the end of reverse primer 3 ' base（3rd）Other base sequences with strengthen PCR amplification specificity.Selection is other
Specific regions, the adjustment other site bases adjacent with the end of reverse primer 3 ' or adjustment mispairing type can also be designed, screened
Other molecular labeling, this will be apparent to those skilled in the art.Therefore, in the base without departing from spirit of the present invention
These modifications or improvements on plinth, belong to the scope of protection of present invention.
Bibliography
1.International Wheat Genome Sequencing Consortium. A chromosome-based
draft sequence of the hexaploid bread wheat (Triticum aestivum) genome[J].
Science, 2014, 345(6194): 1251788.
2.Pfeifer M, Kugler K G, Sandve S R, et al. Genome interplay in the grain
transcriptome of hexaploid bread wheat[J]. Science, 2014, 345(6194): 1250091.
3.Marcussen T, Sandve S R, Heier L, et al. Ancient hybridizations among
the ancestral genomes of bread wheat[J]. Science, 2014, 345(6194): 1250092.
4.FAO, IFAD, WFP, 2015. The State of Food Insecurity in the World:
Meeting the 2015International Hunger Targets: Taking Stock of Uneven
Progress. FAO, Rome.http://www.fao.org/3/a-i4646e.pdf.
5.Bates B, Lennox A, Prentice A, et al. National Diet and Nutrition
Survey Results from Years 1, 2, 3 and 4 (combined) of the Rolling Programme
(2008/2009-2011/2012): A Survey Carried Out on Behalf of Public Health
England and the Food Standards Agency. 2014.
6.Simmonds N W. The relation between yield and protein in cereal grain
[J]. Journal of the Science of Food and Agriculture, 1995, 67(3): 309-315.
7.Avivi L. High protein content in wild tetraploid Triticum
dicoccoidesKorn[C]. Proceedings of the 5th International Wheat Genetics
Symposium. New Delhi, India: Indian Society of Genetics and Plant Breeding
(ISGPB). 1978: 372-380.
8.Uauy C, Distelfeld A, Fahima T, et al. A NAC gene regulating senescence
improves grain protein, zinc, and iron content in wheat[J]. Science, 2006,
314(5803): 1298-1301.
9.Asplund L, Hagenblad J, Leino M W. Re-evaluating the history of the
wheat domestication gene NAM-B1 using historical plant material[J]. Journal
of Archaeological Science, 2010, 37(9): 2303-2307.
10.Hagenblad J, Asplund L, Balfourier F, et al. Strong presence of the
high grain protein content allele of NAM-B1 in Fennoscandian wheat[J].
Theoretical and Applied Genetics, 2012, 125(8): 1677-1686.
11.Tabbita F, Lewis S, Vouilloz J P, et al. Effects of the Gpc‐B1 locus
on high grain protein content introgressed into Argentinean wheat germplasm
[J]. Plant Breeding, 2013, 132(1): 48-52.
12. solving super outstanding, Sun Qixin, Ni Zhongfu, wait wheat NAM gene molecule markers and its apply Chinese patents,
CN201610305899.7. 2016-07-27.
13. solving super outstanding, Sun Qixin, Ni Zhongfu, haynaldia villosa NAM-V1 genes and its molecular labeling and application China are waited specially
Profit, CN201610306058.8. 2016-09-28.
14. solving super outstanding, Sun Qixin, Ni Zhongfu, wait Ae.speltoides NAM-S1 genes and its molecular labeling and answer
Use Chinese patents, CN201610306056.9. 2016-08-03.
15. Wu Dan, Dong Jian, swallow outstanding, wait wheat China spring NAM transcription factor Gpc-1 and the Gpc-2 pustulation periods
Spatial and temporal expression profile analyzes [J] Scientia Agricultura Sinicas, 2015,48 (7): 1262-1276.
16.Korzun V, Röder M S, Ganal M W, et al. Genetic analysis of the
dwarfing gene (Rht8) in wheat. Part I. Molecular mapping of Rht8 on the short
arm of chromosome 2D of bread wheat (Triticum aestivum L.)[J]. TAG
Theoretical and Applied Genetics, 1998, 96(8): 1104-1109。
SEQUENCE LISTING
<110>Jiangsu Province Agriculture Science Institute
<120>A kind of molecular labeling of wheat feature NAM-B1 genes and its application
<130>
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence
<400> 1
catagaagga agtggcggaa tact 24
<210> 2
<211> 27
<212> DNA
<213>Artificial sequence
<400> 2
ggattattcg attatttaat tgcagcg 27
Claims (4)
1. a kind of molecular labeling SpNAM-B1 of wheat feature NAM-B1 genes, it is characterised in that for specific PCR amplification
The primer sequence of the molecular labeling is：Forward primer SpNAM-B1-F 5'- CATAGAAGGAAGTGGCGGAATACT-3' and
Reverse primer SpNAM-B1-R 5'- GGATTATTCGATTATTTAATTGCAGCG-3'.
2. the molecular labeling SpNAM-B1 described in claim 1 is applied to whether identification wheat breed contains feature NAM-B1 bases
Cause.
3. a kind of kit for being used to detect feature NAM-B1 genes in wheat breed, it is characterised in that contain in the kit
The primer sequence that specific PCR amplifier molecule marks SpNAM-B1 that is used for having the right described in requirement 1.
4. applications of the molecular labeling SpNAM-B1 in wheat molecular marker assistant breeding described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710332782.2A CN107012142A (en) | 2017-05-04 | 2017-05-04 | A kind of molecular labeling of wheat feature NAM B1 genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710332782.2A CN107012142A (en) | 2017-05-04 | 2017-05-04 | A kind of molecular labeling of wheat feature NAM B1 genes and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107012142A true CN107012142A (en) | 2017-08-04 |
Family
ID=59448940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710332782.2A Pending CN107012142A (en) | 2017-05-04 | 2017-05-04 | A kind of molecular labeling of wheat feature NAM B1 genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012142A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108570517A (en) * | 2018-06-12 | 2018-09-25 | 江苏省农业科学院 | The relevant specific primer of low with the peaceful wheat of weak-gluten wheat No. 9 albumen and its application |
| CN111154911A (en) * | 2020-03-06 | 2020-05-15 | 河南省农业科学院 | Molecular marker of wheat grain zinc content QTL qZn-3B |
| CN116121434A (en) * | 2022-09-26 | 2023-05-16 | 四川农业大学 | Amino acid locus and molecular marker for controlling wheat ZIP3A zinc transport function |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105802966A (en) * | 2016-05-10 | 2016-07-27 | 中国农业大学 | Wheat NAM gene molecular maker and application thereof |
| CN105969778A (en) * | 2016-05-10 | 2016-09-28 | 中国农业大学 | Haynaldia villosa gene NAM-V1 and molecular marker and application thereof |
-
2017
- 2017-05-04 CN CN201710332782.2A patent/CN107012142A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105802966A (en) * | 2016-05-10 | 2016-07-27 | 中国农业大学 | Wheat NAM gene molecular maker and application thereof |
| CN105969778A (en) * | 2016-05-10 | 2016-09-28 | 中国农业大学 | Haynaldia villosa gene NAM-V1 and molecular marker and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| HAGENBLAD J等: "Strong presence of the high grain protein content allele of NAM-B1 in Fennoscandian wheat", 《THEOR APPL GENET》 * |
| 吴丹 等: "小麦中国春NAM转录因子Gpc-1和Gpc-2灌浆期时空表达模式分析", 《中国农业科学》 * |
| 王栋: "野生二粒小麦NAM-B1基因导入川农16后的表达情况及对品质的影响", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108570517A (en) * | 2018-06-12 | 2018-09-25 | 江苏省农业科学院 | The relevant specific primer of low with the peaceful wheat of weak-gluten wheat No. 9 albumen and its application |
| CN108570517B (en) * | 2018-06-12 | 2021-10-01 | 江苏省农业科学院 | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer |
| CN111154911A (en) * | 2020-03-06 | 2020-05-15 | 河南省农业科学院 | Molecular marker of wheat grain zinc content QTL qZn-3B |
| CN111154911B (en) * | 2020-03-06 | 2023-01-24 | 河南省农业科学院 | Molecular marker of wheat grain zinc content QTL qZn-3B |
| CN116121434A (en) * | 2022-09-26 | 2023-05-16 | 四川农业大学 | Amino acid locus and molecular marker for controlling wheat ZIP3A zinc transport function |
| CN116121434B (en) * | 2022-09-26 | 2023-12-12 | 四川农业大学 | Amino acid locus and molecular marker for controlling wheat ZIP3A zinc transport function |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN117403003B (en) | Molecular marker of wheat TaCHLI-7B gene and application thereof | |
| CN111893209B (en) | Indel site detection marker related to thousand grain weight of wheat and application thereof | |
| AU2013205609A1 (en) | Cotton event pDAB4468.18.07.1 detection method | |
| WO2013112568A1 (en) | Cotton event pdab4468.18.07.1 detection method | |
| CN107012142A (en) | A kind of molecular labeling of wheat feature NAM B1 genes and its application | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN108018371A (en) | Identify molecular labeling, identification method and the application of Rice Resistance To Rice Blast character | |
| CN113207684B (en) | Method for creating wheat germplasm with different hardness types by using synthetic wheat C615 | |
| CN109182592B (en) | SNP molecular marker linked with rape multi-branch character major QTL locus and application thereof | |
| CN112695114B (en) | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof | |
| CN111560464B (en) | Molecular marker IWB59718 and application thereof in detection of wheat stripe rust resistance | |
| CN107447026B (en) | Specific molecular marker primer for identifying brown planthopper resistant gene BPH3 genotype of rice and application thereof | |
| KR101748366B1 (en) | Molecular marker for selecting tomato leaf mold resistant and selection method using the same molecular marker | |
| CN116516049A (en) | Soybean protein content QTL locus qPRO_11_1, molecular marker and application thereof | |
| CN111635957B (en) | Molecular marker for detecting wheat stripe rust resistance QTL and application of molecular marker in disease resistance breeding | |
| CN111607664B (en) | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust | |
| CN108570517B (en) | Specific primer related to Ning-Mai No. 9 low protein of weak gluten wheat and application of specific primer | |
| KR101481734B1 (en) | Microsatellite marker of Korean Astragalus mongholicus and primer set for amplifying the same | |
| CN108642204A (en) | The combination of SNP marker primer and its application of one anti-wheat yellow mosaic QTL QYm.nau-5A.1 | |
| KR101803077B1 (en) | Primer set and method for selection fusarium wilt resistant in cabbage | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN114231660B (en) | SNP locus related to thousand grain weight characters of wheat and application thereof | |
| CN111235292B (en) | Rye 4RS chromosome arm specific KASP molecular marker and application thereof | |
| CN113308566B (en) | Primer and application of InDel molecular marker related to soybean main stem node number | |
| CN110484651B (en) | Molecular marker in wheat yield related gene TaNRT2-6D and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170804 |