CN113207684B - Method for creating wheat germplasm with different hardness types by using synthetic wheat C615 - Google Patents

Abstract

The inventionDiscloses a breeding method for creating germplasm with different hardness types by utilizing synthetic wheat C615, which comprises the following steps: 1) parental selection and F₁Obtaining a substitute; 2) selecting breeding offspring: f₂To F₆Instead, single-particle transmission or mixed selection is adopted, and quality screening is not added; f₇And detecting two hardness-controlling genes/QTLs, namely Pinb-D1b and QHA. yaas-4AL, for the target individual family. F₇And simultaneously carrying out hardness detection on seeds harvested from different QTL/genome family-building materials. Families carrying two markers of Pinb-D1b + QHA. yaas-4AL are determined as hard candidate materials, families without two markers are determined as soft candidate materials, and only one marker is a soft-hard transition type group. The invention provides materials and technical support for the genetic improvement of wheat quality by utilizing the synthetic wheat C615.

Description

Method for creating wheat germplasm with different hardness types by using synthetic wheat C615

Cross Reference to Related Applications

The present application claims priority from a patent application having patent application number 202011302787.9, filed on 19.11.2020 to the chinese national intellectual property office, the entire contents of which are incorporated herein by reference.

Technical Field

The invention belongs to the field of wheat molecular breeding, and particularly relates to a method for creating wheat germplasm with different hardness types by using synthetic wheat C615.

Background

The grain hardness is an important factor influencing the final processing quality of the wheat and is also a main selection index of wheat quality breeding. Previous researches show that the major genes Pina and Pinb for controlling the hardness of wheat grains are located at the similar physical positions of the 5D short arm of the wheat chromosome, researchers find the genes for controlling the hardness of the grains on the seventh homologous group and the 5D long arm successively, and Wang and other researches find that the chromosomes 4B and 4D have major effective sites for controlling the hardness and the flour yield of the soft wheat grains and are close to the positions of the dwarf genes Rht-B1 and Rht-D1. Other reported micro-effect genes for controlling wheat grain hardness are mainly located on chromosomes 1A, 2D, 3B, 3A, 5B and 6D.

The international corn wheat improvement Center (CIMMYT) successfully creates artificially synthesized wheat and derivative lines thereof by utilizing a wheat wild ancestor species, is widely applied to global wheat genetic improvement, and greatly widens the genetic diversity of the wheat. C615 is the artificially synthesized wheat derived line from CIMMYT, and the genealogy is SABUF/3/BCN// CETA/AE.SQUARROSA (895), wherein CETA is durum wheat (AABB), AE.SQUARROSA (895) is aegilops tauschii (DD), SABUF is the derived line of Shanghai No. three, and BCN is foreign common wheat. Through years of research, the hardness value of C615 grains is always higher, so that the C615 is an excellent source for creating wheat germplasms with different hardness types. But at present, there is no report on the genetic basis of C615 hardness and how to create wheat germplasm with different hardness types.

Disclosure of Invention

In order to accelerate the utilization of the favorable gene resources of the synthetic wheat C615, the invention provides technical reference for breeding new varieties by utilizing the favorable gene of the synthetic wheat C615 by summarizing and breeding methods of germplasms with different hardness types on the basis of C615 hardness positioning.

In a first aspect, the invention provides a substance for detecting whether the 51 st deoxyribonucleotide of a gene fragment shown in SEQ ID No.1 on chromosome 4A in a wheat genome is A or C, wherein the substance is a primer set or a reagent or a kit containing the primer set, the primer set contains an upstream primer and two downstream primers, and the upstream primer is designed according to the upstream sequence of the 51 st deoxyribonucleotide of the gene fragment shown in SEQ ID No.1 on chromosome 4A in the wheat genome; the downstream primers are designed according to the 51 st deoxyribonucleotide of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome and a downstream sequence thereof, the 3 'terminal deoxyribonucleotide of one downstream primer is the 51 st deoxyribonucleotide A of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome, and the 3' terminal deoxyribonucleotide of the other downstream primer is the 51 st deoxyribonucleotide C of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome.

In certain embodiments, the primer set is a primer set consisting of the single-stranded DNA molecule shown in SEQ ID No.2, the single-stranded DNA molecule shown in positions 22-52 of SEQ ID No.3 or a derivative thereof, and the single-stranded DNA molecule shown in positions 22-52 of SEQ ID No.4 or a derivative thereof.

In some embodiments, the derivative of the single-stranded DNA molecule shown in the 22 nd to 52 th positions of SEQ ID No.3 is that the 5' end of the single-stranded DNA molecule shown in the 22 nd to 43 th positions of SEQ ID No.3 is connected with a specific fluorescent tag sequence A; the derivative of the single-stranded DNA molecule shown in 22 th to 52 th positions of SEQ ID No.4 is that the 5' end of the single-stranded DNA molecule shown in 22 nd to 52 th positions of SEQ ID No.4 is connected with a specific fluorescent label sequence B.

In certain embodiments, the reagent or kit further comprises fluorescent probe a, fluorescent probe B, quenching probe a, and quenching probe B; the fluorescent probe A is a sequence consistent with the specific fluorescent label sequence A, and the 5' end is connected with a fluorescent reporter group A; the quenching probe A is a reverse complementary sequence of the specific fluorescent label sequence A, and the 3' end is connected with a fluorescent quenching group; the fluorescent probe B is a sequence consistent with the specific fluorescent label sequence B, and the 5' end is connected with a fluorescent reporter group B; the quenching probe B is a reverse complementary sequence of the specific fluorescent label sequence B, and the 3' end is connected with a fluorescent quenching group; the specific fluorescent label sequence A is a fluorescent label sequence FAM, and the specific fluorescent label sequence B is a fluorescent label sequence HEX; the fluorescence reporter group A is FAM, and the fluorescence reporter group B is HEX; the fluorescence quenching group is BHQ.

In a second aspect, the present invention provides the use of a substance according to the first aspect of the invention in any one of the following characterised in that the use is

(A) Identifying or assisting in identifying the hardness of the wheat grains;

(B) comparing the seed hardness of the wheat to be detected;

(C) breeding or screening wheat germplasm with different grain hardness types;

(D) preparing a product for identifying or assisting in identifying the hardness of the wheat grains;

(E) preparing a product for comparing the seed hardness of wheat to be tested;

(F) preparing the wheat germplasm for breeding or screening different grain hardness types.

In a third aspect, the invention also provides a breeding method for creating wheat germplasm with different hardness types by using the synthetic wheat C615, which is characterized by comprising the following steps:

1) parental selection and generation F1: one of the parents is artificially synthesized wheat C615, and the other one is soft wheat variety (line) as the parent to carry out hybridization matching to obtain a hybrid F1 generation;

2) and (3) selecting offspring: f2 generation to F6 generation, single particle transmission or mixed selection is adopted, and quality screening is not added; selecting single plants in the F7 generation, detecting two hardness-controlling genes/QTLs, namely Pinb-D1b and QHA. yaas-4AL, by a family division, and classifying the combination types of Pinb-D1b and QHA. yaas-4AL according to the detection result;

3) and (4) carrying out hardness detection on seeds harvested from different QTL/genome family-line materials simultaneously in the F7 generation, and screening a target family.

In certain embodiments, the detecting in step 2) is, in particular, detecting the hardness-controlling QTL qha.yaas-4AL using a substance provided in the first aspect of the invention.

In certain embodiments, the detection in step 2) is specifically to detect Pinb-D1b by using the sequences shown as SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7 as primer sequences.

In some embodiments, the classification of the combination type in step 2) is specifically to determine two markers carrying Pinb-D1b + qha.yaas-4AL as a hard candidate group, determine a family not carrying both markers as a soft candidate group, and classify the family carrying only one marker as a soft-hard transition type group.

In certain embodiments, the criteria selected in step 3) are families with a hardness value > 50 for the two markers triticale, or families without a hardness value < 30 for the two markers.

Compared with the prior art, the invention has the technical effects that:

1) the invention utilizes a 90K SNP chip to excavate the QTL for controlling the seed hardness, and detects 2 QTLs for controlling the seed hardness which are distributed on 4AL and 5 DS. Wherein the QH A.yaas-4AL mark interval is RAC875_ c56535_256-Tdurum _ contig11613_561, and no hardness-related locus with the same or similar physical position is reported by comparison, so that the QTL related to the grain hardness is new. Yaas-5DS is located between the functional marker of the hardness gene Pinb-D1 and Excalibur _ c4699_215, and is identified as or closely linked to the hardness major gene Ha.

2) Screening of offspring families for different hardness types using different combinations of the two hardness-related QTL/genes provides material and technical support for genetic improvement of quality using synthetic wheat C615.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 is a schematic diagram showing the results of the amplification detection of the test markers of the RIL family of the KASP marker QHA-4A-KASP validation section in example 1.

Detailed Description

Hereinafter, embodiments of the present invention will be described in detail. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby. It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the present invention pertains.

Example 1

One of the parents is an artificially synthesized wheat derived line C615 from CIMMYT, the hardness value is above 40 in years of planting detection, in addition, soft wheat varieties (lines) with low hardness of germplasm resource materials are screened and identified as the parents to carry out hybridization matching, the soft wheat variety Yangmai 13 is selected according to the results of years of detection, and the hardness value of the results of the years of detection is below 15. Yangmai 13 is a high-quality weak gluten wheat variety bred by agricultural departments in the region of Ri and the river of Jiangsu, is continuously listed as a national leading variety by the Ministry of agriculture in 2005-2010, is popularized for 3100 ten thousand mu in an accumulated way, becomes one of core varieties for building the dominant industrial zone of weak gluten wheat in the lower reaches of Yangtze river, is also one of weak gluten wheat varieties with the largest planting area in China, and is a high-quality supply source of biscuits and cakes.

Yangmai 13 is taken as a male parent, C615 is taken as a female parent for hybridization, and a RIL population containing 198 families is obtained by a single seed transmission method. 90K SNP marker detection is carried out by utilizing an Illumina SNP Genotyping technology test platform bead chip technology, and 2 QTLs for controlling seed hardness are excavated and positioned by a high-density genetic map constructed by a 90K SNP chip and distributed on 4AL and 5 DS. Wherein the QHA.yaas-4AL mark interval is RAC875_ c56535_256-Tdurum _ contig11613_ 561. Yaas-5DS is located between the functional marker of the hardness gene Pinb-D1 and Excalibur _ c4699_215, and was identified as or closely linked to the major gene Ha with known hardness.

Further preliminarily screening SNP markers from the QTL interval according to marker homology, selecting the SNP marker with high specificity and highest correlation with the hardness phenotype value in the interval to carry out KASP marker transformation, determining that the RAC875_ c56535_256 marker on 4A has the best genome specificity and the most obvious correlation with the grain hardness, the flanking sequences are SEQ ID NO:1, using Polymarker (http:// Polymarker. tgac. ac. uk /) to design KASP primer, the corresponding variation site is A/C, namely, the nucleotide sequence 5- ' ACGATGCCGACCCTGTTCACAAGGCCACCATTATGCCTAGGGG ATATACTRTTGGCATGGTGGCGCAGCTGCCGGGGGAAGACAGC GAGCTCGAAGTCTCG-3 ' (SEQ ID NO.1) (wherein R is [ A/C ]) has an A/C allele (SNP) site from the 51 st base of the 5' end, in the wheat breeding, the gibberellic disease resistance is dominant allelic variation, the wheat derivative line C615 carries the dominant allelic variation A, and the wheat grain hardness value of the wheat carrying the allele A is higher than that of the wheat containing the allele C.

The primer group designed by the embodiment aims at the SNP locus QHA-4A-KASP marker, and comprises a forward primer with a nucleotide sequence shown as SEQ ID NO.2, a reverse primer 1 with a nucleotide sequence shown as SEQ ID NO.3 and a reverse primer 2 with a nucleotide sequence shown as SEQ ID NO. 4. Wherein, the primer 1 is used as a common primer and is an upstream primer, and the primer 1 and the primer 2 are downstream primers. The primer sequences are shown in the following table.

TABLE 4 QHA-4A-KASP marker primer sequence information

Preparation of KASP labeled primer working solution:

taking 30 μ L (100 μ M) of the upstream primer (nucleotide sequence shown as SEQ ID NO. 2), taking 12 μ L (100 μ M) of the downstream primer (nucleotide sequence shown as SEQ ID NO.3 and SEQ ID NO. 4), supplementing to 100 μ L with sterile ultrapure water, and mixing well to obtain KASP labeled primer working solution for later use.

PCR amplification reaction System: 2 muL (about 30 ng/muL) of wheat DNA template to be detected, 0.08 muL of primer working solution and 2.5 muL of KASP Master Mix (LGC company, KBS-1016-;

PCR reaction procedure: firstly, pre-denaturation at 95 ℃ for 15 min; secondly, changing the temperature at 95 ℃ for 20s, and changing the temperature at 65-57 ℃ (reducing the temperature by 1 ℃ in each cycle) for 60s for 10 cycles; thirdly, denaturation at 95 ℃ for 20s, renaturation at 57 ℃ for 1min, 29 cycles; storing at 10 deg.C. The experiment was also set with a blank control (NTC) without template DNA added to the reaction system, and multiple blanks were set for each plate.

Wheat seedlings were harvested and genomic DNA of wheat to be tested was extracted by the CTAB method (reference document: Standard J, Isaac P G. isolation of DNA from plants. methods mol. biol.1994,28: 9-15.)

And (3) performing PCR amplification by using the wheat genome DNA to be detected as a template and adopting the KASP primer group and the PCR reagent to obtain a PCR amplification product. The fluorescence values were read by scanning the PCR amplification products with a multifunctional microplate reader (PHERAStar Plus, BMG LABTECH, Germany). Genotyping is carried out by using Kluster Caller software (KBioscience), and the genotype of the SNP marker RAC875_ c56535_256 linked with the site related to the resistance to gibberellic disease is determined according to the analysis result.

198 parts of the "C615X Yangmai 13 recombinant inbred line" and the two parents were amplified as above, and the detection results are shown in FIG. 1. The fluorescence signal data of the amplified product is analyzed by Kluster Caller software and gathered at the position (blue) close to the X axis in the fluorescence signal coordinate system of the typing result, and the fluorescence signal data is the same as the fluorescence signal data of C615, namely the genotype of the wheat at the 51 st base (SNP site) of the nucleotide sequence (such as SEQ ID NO.1) flanking the molecular marker RAC875_ C56535_256 is proved to be A; and the fluorescence signal data of the amplified products is analyzed by Kluster Caller software and gathered at the position (red) close to the Y axis in the coordinate system, and the genotype of the wheat at the SNP site is proved to be C if the wheat is different from the C615 genotype; the sample shown in black in the lower left corner of FIG. 1 is blank. The 198 families along with the KASP test results for both parents, the two year average results of grain weight determined after harvest for the 2015 and 2016 field trials are shown in table 1 and figure 1.

The KASP typing results of QHA. yaas-4AL are shown in tables 1 and 2,

TABLE 1198 pedigrees and seed hardness and KASP typing results

As can be seen from table 1, wheat grain hardness was higher with allele a than with allele C.

TABLE 2 average grain hardness T test results for RIL families of different genotypes

The genotype and phenotype of 198 RIL families were tested in table 2 using a two-sample T of Excel 2019 and the results indicated: the average grain hardness of the 198 families with the genotype of A is 33.19 percent higher than that of the families with the genotype of C, and the difference is obvious on the level that p is less than 0.01, which indicates that the primer group of the KASP marker QHA-4A-KASP and the genotype detection system can be applied to wheat grain hardness molecular marker assisted breeding.

Example 2

The selection method of the families with different hardness types of the offspring families is established by utilizing different combinations of the two QTL/genes related to hardness. Wherein, the information of the detection primer aiming at the Pinb-D1 is shown in the table 3:

TABLE 3 detection primer sequence information of Pinb-D1

After detection, according to the genotype distribution of the two hardness QTLs in 198 families of a population, see Table 4,

TABLE 4198 genotype distributions for two hardness QTLs in families

All families were classified into 4 types, and the hardness value of 300 grains per material was measured using a single grain meter model SKCS-4100 (Perten, sweden), and the values were averaged at two times. Hardness of 4 environments such as Wanfu test base (Yangzhou, Jiangsu) planted in agricultural science research institute in the lower river region of Jiangsu, from 2014 to 2015, from 2015 to 2016 and from 2016 to 2017, from the test base (Jing, Hubei) planted in the university of Changjiang river in 2015 to 2016 is detected, and the average value is subjected to type difference analysis, so that 13 families simultaneously carry Pinb-D1b and QHA.yaas-4AL hard genotypes, the hardness average value is 60.55, the maximum value is 69.98, the minimum value is 51.61, and the hardness of all families is more than 50. The 26 families carried Pinb-D1b alone, with an average hardness of 45.79, a maximum of 75.18, and a minimum of 27.35, with 11 families having a hardness > 50 and 6 families having a hardness < 30. 29 families carried only the QHA. yaas-4AL rigid genotype, with an average hardness of 31.27, a maximum of 69.54, a minimum of 13.35, 4 with hardness > 50, and 18 with hardness < 30. 130 families did not carry the hardness QTL/gene, the average hardness was 26.94, the maximum was 64.60, the minimum was 5.44, only 2 with hardness > 50, and 81 with hardness < 30. Therefore, as long as the family with two marks is selected, the hardness is more than 50, and the hardness requirement of the type variety above the Chinese standard is met; when selecting families which are not carried by two markers, the vast majority of families belong to soft types, and 128 families are less than 50 (meeting the national standard weak tendon hardness index requirement), wherein 81 families with hardness less than 30 are selected, and only 2 families have hardness more than 50.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions recorded in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; the modifications or substitutions do not cause the essence of the corresponding technical solutions to depart from the scope of the technical solutions of the embodiments of the present invention, and the technical solutions are intended to be covered by the claims and the specification of the present invention.

SEQUENCE LISTING

<110> institute of agricultural science in the region of Ri river of Jiangsu

<120> method for breeding wheat varieties with different hardness types by utilizing synthetic wheat C615

<130> 2021

<150> CN2020113027879

<151> 2020-11-19

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 101

<212> DNA

<213> Triticum aestivum

<220>

<221> misc_feature

<222> (51)..(51)

<223> R represents A or C

<400> 1

acgatgccga ccctgttcac aaggccacca ttatgcctag gggatatact rttggcatgg 60

tggcgcagct gccgggggaa gacagcgagc tcgaagtctc g 101

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

tgttcacaag gccaccatt 19

<210> 3

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

gaaggtgacc aagttcatgc tctgcgccac catgccaat 39

<210> 4

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

gaaggtcgga gtcaacggat tctgcgccac catgccaag 39

<210> 5

<211> 39

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

gaaggtgacc aagttcatgc tctcatgctc acagccgcc 39

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

gaaggtcgga gtcaacggat tcctcatgct cacagccgct 40

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

gtcacctggc ccacaaaatg 20

Claims (6)

1. A substance for detecting whether the 51 st deoxyribonucleotide of a gene fragment shown by SEQ ID No.1 on chromosome 4A in a wheat genome is A or C, which is characterized in that the substance is a primer set or a reagent or a kit containing the primer set, the primer set contains an upstream primer and two downstream primers, and the upstream primer is designed according to the upstream sequence of the 51 st deoxyribonucleotide of the gene fragment shown by SEQ ID No.1 on chromosome 4A in the wheat genome; the downstream primers are designed according to the 51 st deoxyribonucleotide of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome and a downstream sequence thereof, the 3 'terminal deoxyribonucleotide of one downstream primer is the 51 st deoxyribonucleotide A of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome, and the 3' terminal deoxyribonucleotide of the other downstream primer is the 51 st deoxyribonucleotide C of the gene fragment shown by SEQ ID No.1 on the chromosome 4A in the wheat genome.

2. The substance according to claim 1, wherein the primer set is a primer set consisting of a single-stranded DNA molecule represented by SEQ ID No.2, a single-stranded DNA molecule represented by SEQ ID No.3 at positions 22-52 or a derivative thereof, a single-stranded DNA molecule represented by SEQ ID No.4 at positions 22-52 or a derivative thereof;

the derivative of the single-stranded DNA molecule shown in 22 th to 52 th positions of SEQ ID No.3 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 43 th positions of SEQ ID No.3 is connected with a specific fluorescent label sequence A; the derivative of the single-stranded DNA molecule shown in 22 th to 52 th positions of SEQ ID No.4 is that the 5' end of the single-stranded DNA molecule shown in 22 nd to 52 th positions of SEQ ID No.4 is connected with a specific fluorescent label sequence B.

3. A substance according to claim 2, characterized in that: the reagent or the kit also contains a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B; the fluorescent probe A is a sequence consistent with the specific fluorescent label sequence A, and the 5' end is connected with a fluorescent reporter group A; the quenching probe A is a reverse complementary sequence of the specific fluorescent label sequence A, and the 3' end is connected with a fluorescent quenching group; the fluorescent probe B is a sequence consistent with the specific fluorescent label sequence B, and the 5' end is connected with a fluorescent reporter group B; the quenching probe B is a reverse complementary sequence of the specific fluorescent label sequence B, and the 3' end is connected with a fluorescent quenching group; the specific fluorescent label sequence A is a fluorescent label sequence FAM, and the specific fluorescent label sequence B is a fluorescent label sequence HEX; the fluorescence reporter group A is FAM, and the fluorescence reporter group B is HEX; the fluorescence quenching group is BHQ.

4. Use of a substance according to any one of claims 1 to 3 in any one of the following applications

(A) Identifying or assisting in identifying the hardness of the wheat grains;

(B) comparing the seed hardness of the wheat to be detected;

(C) breeding or screening wheat germplasm with different grain hardness types;

(D) preparing a product for identifying or assisting in identifying the hardness of the wheat grains;

(E) preparing a product for comparing the seed hardness of wheat to be tested;

(F) preparing the wheat germplasm for breeding or screening different grain hardness types.

5. A breeding method for creating wheat germplasm with different hardness types by utilizing synthetic wheat C615 is characterized by comprising the following steps:

1) parental selection and F₁Generation and obtaining: one of the parents is artificially synthesized wheat C615, and the other is soft wheat variety (line) as the parent to carry out hybridization matching to obtain a hybrid F₁Generation;

2) and (3) selecting offspring: f₂To F₆Instead, single-particle transmission or mixed selection is adopted, and quality screening is not added; f₇Selecting individual plants, detecting two hardness-controlling genes/QTLs (quantitative trait loci) of Pinb-D1b and QHA. yaas-4AL by a family, and classifying the combination types of Pinb-D1b and QHA. yaas-4AL according to the detection result;

wherein the detection is specifically to detect the QTLQHA.yaas-4AL for controlling the hardness by adopting the substance as defined in any one of claims 1 to 3, detect Pinb-D1b by adopting the primers with the primer sequences of SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7, and classify the combination types into a hard candidate group by determining two markers carrying Pinb-D1b + QHA.yaas-4AL, a soft candidate group by determining families not carrying the two markers, and a soft-hard transition type group by classifying the families carrying only one marker;

3)F₇carry the substitute-time pairAnd (3) carrying out hardness detection on seeds harvested from the QTL/genome family material, and screening a target family.

6. The selective breeding method according to claim 5, wherein the step 3) is performed by selecting families with two markers of wheat hardness value > 50 or families without the two markers of wheat hardness value < 30.

Images