CN111154911B - Molecular marker of wheat grain zinc content QTL qZn-3B - Google Patents

Abstract

The application belongs to the technical field of wheat molecular breeding, and particularly relates to a molecular marker SNP2471 closely linked with QTL qZnC. Hnaas-3B related to zinc element content in wheat grains and a patent application of the application thereof. The SNP2471 marker is located on a wheat 3B chromosome, the 36 th basic group of the SNP2471 marker is a 36A-36G polymorphic site, the polymorphism of A/G exists, when the site is AA, the content of zinc element in wheat grains is high, and when the site is GG, the content of zinc element in wheat grains is low. In the application, the inventor analyzes the correlation between the accumulation phenotype and the genotype of the zinc element in the wheat grains by using the genotype identification result of the high-density SNP chip and combining with a common correlation analysis method in quantitative character identification, finally screens and identifies to obtain the locus and the gene which are closely linked with the accumulation of the zinc element in the wheat grains, and can develop a corresponding functional marker based on the locus and the gene, thereby laying a certain technical foundation for the cultivation of new varieties of zinc-rich wheat.

Description

Molecular marker of wheat grain zinc content QTL qZn-3B

Technical Field

The application belongs to the technical field of wheat molecular breeding, and particularly relates to a SNP molecular marker with a zinc element content related QTL closely linked in wheat grains and a patent application of the SNP molecular marker.

Background

Wheat (A), (B)Triticum aestivum L.) is one of the most important cereal crops in the world, the product of which provides 20% of the energy and protein in the human diet. However, nutritional statistics indicate that about 20 million people worldwide cannot take enough mineral elements from the daily diet, resulting in relatively common malnutrition. Among them, insufficient intake of zinc is a typical representative of insufficient intake of mineral elements. Research shows that the zinc element in human body can bring serious influence on human health when being insufficiently ingested, typically: can cause the problems of infantile dysgenesis, mental retardation and reduced fertility of women of proper age. Therefore, the cultivation of the new wheat variety rich in nutrient elements is an important technical approach for relieving the problem of insufficient mineral element intake.

The existing research shows that the content of zinc element in wheat grains is a complex quantitative character and is controlled by polygene. Therefore, for cultivating new wheat varieties rich in zinc elements, if the zinc-rich wheat germplasm resources are screened by using a traditional breeding means, the defects of low selection efficiency, long period, poor stability and the like are bound to exist. Molecular marker assisted breeding is an effective means for solving the technical problem. However, it should be noted that the precondition for improving the zinc element content of wheat grains by using molecular marker breeding technology is to obtain a practical molecular marker which is beneficial to the accumulation of zinc element in wheat grains. Therefore, QTL positioning and molecular marker development research of zinc element accumulation in wheat grains are carried out, and the method has positive effects on improving the nutritional and healthy quality of wheat and accelerating the breeding work of new zinc-rich wheat varieties.

Disclosure of Invention

The main purpose of the application is to provide two SNP molecular markers qZnC.hnaas-3B (SNP 2471) and qZnC.hnaas-5A (SNP 1014) which are closely linked with QTL related to the content of zinc element in wheat grains, and to lay a certain technical foundation for the cultivation of zinc-rich wheat varieties.

The technical scheme adopted by the application is detailed as follows.

An SNP molecular marker SNP2471 closely linked with a zinc element content trait QTL qZnC. Hnaas-3B (abbreviated as: QTL qZn-3B) in wheat grains is positioned on a wheat 3B chromosome, takes a reference sequence of a reference genome v1.1 version of Chinese spring as a reference, and particularly at the 376,625,452 nucleotide, and has the following specific nucleotide sequence:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCT[A/G]ATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT，

wherein the 36 th base (i.e. "[ A/G ]" indicates the form) is a polymorphic site of 36A-36G, and has an A/G polymorphism; specifically, the method comprises the following steps:

when the locus is AA, the content of zinc element in the wheat grains is relatively high, and the wheat grains are beneficial to the genotype rich in zinc (namely, the wheat grains can be considered as high-zinc wheat); the nucleotide sequence is shown as SEQ ID NO.1 (72 bp), and specifically comprises the following components:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCTAAATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT；

when the locus is GG, the content of zinc element in the wheat grains is lower; an unfavorable genotype that is zinc-rich (i.e., wheat that can be considered to have a low zinc content); the nucleotide sequence is shown as SEQ ID NO.2 (72 bp), and specifically comprises the following components:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCTGGATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT。

the SNP molecular marker SNP1014 closely linked with the zinc element content character QTL qZnC. Hnaas-5A (short for: QTL qZn-5A) in wheat grains is positioned on a wheat 5A chromosome, and the specific nucleotide sequence is as follows by taking the reference sequence of the reference genome version v1.1 of 'Chinese spring' as reference, particularly at the 650,240,330 th nucleotide:

GGTGTTTCCATTGTGCTCCAGTTGAGCTCCTTAAG[A/C]TATCGCACCATTTTACCCCTCTTCATCTCGCATGA；

wherein the 36 th base (namely, "[ A/C ]" indicates a form) is a polymorphic site of 36A-36C and has A/C polymorphism; specifically, the method comprises the following steps:

when the locus is AA, the content of zinc element in the wheat grains is relatively high, and the wheat grains are beneficial to the genotype rich in zinc (namely, the wheat grains can be considered as high-zinc wheat); the nucleotide sequence is shown as SEQ ID NO.3 (72 bp), and specifically comprises the following components:

GGTGTTTCCATTGTGCTCCAGTTGAGCTCCTTAAGAATATCGCACCATTTTACCCCTCTTCATCTCGCATGA；

when the locus is CC, the content of zinc element in the wheat grains is relatively low; an unfavorable genotype that is zinc-rich (i.e., wheat that can be considered to have a low zinc content); the nucleotide sequence is shown as SEQ ID NO.4 (72 bp), and specifically comprises the following steps:

GGTGTTTCCATTGTGCTCCAGTTGAGCTCCTTAAGCCTATCGCACCATTTTACCCCTCTTCATCTCGCATGA。

the molecular marker SNP2471 or SNP1014 is applied to the auxiliary selection of the molecular marker of the wheat zinc-rich variety, or is used for distinguishing the wheat varieties with high zinc content and low zinc content.

In the prior art, there have been preliminary studies on other genes which are accumulated with Zinc element in crops, for example, swamy, etc. locates the genes which affect the accumulation of Zinc element in Rice, and applies them to the genetic improvement process of crops (Swamy et al, advances in breeding for high grain Zinc Rice,2016, rice); descalasota et al, hindu et al, utilize correlation analysis methods to detect QTL for accumulation of zinc elements in various crops such as Rice, corn, etc. (Descalasota GIL et al, genome-Wide Association Mapping in a Rice MADIC Plus detection QTLs and Genes Useful for Bioformation, 2018, front. Plant Sci.; hindu et al, identification and Identification of genetic regions in a Rice field and corn, 2018, the gene application).

In the application, the inventor analyzes the correlation between the accumulation phenotype and the genotype of the zinc element in the wheat grains by using the genotype identification result of the high-density SNP chip and combining with a common correlation analysis method in quantitative character identification, finally screens and identifies to obtain the locus and the gene which are closely linked with the accumulation of the zinc element in the wheat grains, and can develop a corresponding functional marker based on the locus and the gene, thereby laying a certain technical foundation for the cultivation of new varieties of zinc-rich wheat.

Drawings

FIG. 1 is a normal distribution of the phenotype data of zinc element content in different environment-associated populations; the left side is the result of Shangqiu area, and the right side is the result of Yuanyang area;

fig. 2 is a manhattan graph of whole genome association analysis of zinc element accumulation traits of wheat grains in different environments, and a middle red dotted line is a threshold line of-log 10P = 4; the middle red circle represents that the molecular marker screened by the invention is identified in two environments at the same time, and the marker is positioned at 376,625,452 bases on the 3B chromosome of wheat; the upper graph is the result of Shangqiu area, and the lower graph is the result of Yuanyang area;

FIG. 3 is a Manhattan diagram of whole genome association analysis of zinc element accumulation traits of wheat grains in different environments, and a middle red dotted line is a threshold line of-log 10P = 4; the middle red circle represents that the molecular marker screened by the invention is identified in two environments at the same time, and the marker is positioned at 650,240,330 th base on the wheat 5A chromosome; the upper graph is the result of the Shangqiu area, and the lower graph is the result of the Yuanyang area;

FIG. 4 is a genotyping and phenotyping profile of SNP2471 marker in the cohort of associations: orange (left) represents the phenotype distribution of AA genotype individuals, green (right) represents the phenotype distribution of GG genotype, and the difference between the zinc element contents of the two genotype wheat grains reaches a very significant level;

FIG. 5 is a genotyping and phenotyping profile of SNP1014 markers in the cohort of associations: orange (left) represents the phenotype distribution of AA genotype individuals, green (right) represents the phenotype distribution of GG genotype, and the difference between the zinc element contents of the two genotype wheat grains reaches a very significant level.

Detailed Description

The present application is further explained below with reference to the drawings and examples. Before describing the specific embodiments, a brief description will be given of some experimental background cases in the following embodiments.

The wheat materials in the following examples are provided by the wheat research institute of agricultural academy of sciences in Henan province (also all publicly available wheat varieties), the related group materials used for analysis consist of 207 parts of different wheat varieties, the related group materials are planted in the areas of Yuanyang base and Shangqin city of agricultural academy of sciences in Henan province in 2017 respectively, and the related group materials are harvested after physiological maturity and used for the related analysis in the application.

Example 1

Firstly, it should be explained that, based on the existing research, the inventor considers that the zinc element content belongs to an accumulation character controlled by a quantitative gene, therefore, before screening and determining SNP molecular markers, further screening can be carried out only after obtaining a proper sample group, therefore, the inventor takes the example that a part of typical wheat varieties are planted in different areas and harvested grains in the prior art as an example, and measures the zinc element content in wheat grains of different varieties to determine whether the constructed sample group is suitable for screening and identifying subsequent molecular markers. The wheat planting process is a conventional process, so the determination and analysis conditions of the zinc element accumulation phenotype data in the wheat grains under different environmental planting conditions are briefly introduced as follows.

(I) determination of accumulation phenotype of zinc element in wheat grains

In the application, the digestion and spectrophotometry method is used for measuring the content of the zinc element in the wheat grains, and the method comprises the following specific steps:

(1) Sample pretreatment:

crushing wheat grains by a small crusher, and sieving the crushed wheat grains by a sieve with the aperture of 0.15 mm;

putting 0.5g of sample into a digestion tube, sequentially adding 5mL of nitric acid and 2mL of hydrogen peroxide, slightly shaking, uniformly mixing, standing for 20min, and putting the sample into a microwave digestion instrument for digestion;

finally filtering the digestion solution and fixing the volume to 50mL by using 1% nitric acid solution;

(2) Establishment of a standard curve:

preparing 4 gradients (0.02 mg/mL, 0.05mg/mL, 0.1mg/mL and 0.2 mg/mL) of a standard sample (purchased from the national center for Standard substances) of the element (zinc) to be detected for establishing a standard curve of the zinc element;

(3) Determination of mineral elements:

the method comprises the steps of measuring the content of zinc element in a wheat sample by using a flame-atomic absorption method by using a Japan Shimadzu atomic absorption spectrophotometer AA-6300, and repeating the measurement for 3 times.

The final association between the zinc content of each wheat variety grain in the sample population and the wheat variety is shown in table 1 below.

TABLE 1 wheat variety marker locus genotypes and grain zinc element content

The following table is continued:

the following table is continued:

the table is continued:

the following table is continued:

note: n is unknown genotype.

(II) phenotypic data analysis

The phenotype data obtained from the investigation of different environments of the related population are subjected to descriptive processing, and the results are shown in the following table 2, and are plotted in fig. 2.

TABLE 2 descriptive statistics of zinc element content for different environment-related groups

Note: SD, standard deviation; kurtosis, which is the characteristic number of the probability density distribution curve at the peak value height of the average value; skewness, a measure of the direction and degree of skew of the statistical data distribution, is a numerical characteristic of the degree of asymmetry of the statistical data distribution.

From the results in the table, it can be seen that the variation range of the zinc element content in the wheat grains under different environmental conditions is 31.87-128.22 mg/kg, and the variation range and the average value of the zinc element content in the wheat grains at different places have certain differences, which are presumed to be caused by environmental influences. As can be seen from FIG. 1, the zinc element content accumulation phenotype data of the related population under different environments all conform to normal distribution, and the wheat varieties contained in the population have wide phenotypic diversity and are ideal populations for subsequent correlation analysis.

Example 2

In the embodiment 1, the zinc content in different varieties is detected, and the inventors use the Axiom Wheat 660K SNP chips to carry out genotype judgment on all varieties in a sample population. It should be noted that the chip contains over 630,000 specific SNP sites uniformly distributed in the whole wheat genome, and can provide sufficient SNP marker density, so that the chip can be used for whole genome association analysis. The specific process is briefly described as follows.

Firstly, extracting wheat leaf genome DNA by a CTAB (Cetyltrimethyl alamonium bromide) method, and referring to the following specific steps:

taking 0.5g of wheat leaf sample, quickly freezing in liquid nitrogen, and quickly grinding and smashing;

adding 700 μ L CTAB extractive solution at 65 deg.C, water bathing for 30min, and performing tissue lysis;

cool to room temperature and add an equal volume of chloroform: isoamyl alcohol (24;

centrifuging at room temperature for 5min (12000 rpm/min), sucking 450. Mu.L of supernatant, and transferring to a 1.5mL centrifuge tube;

adding equal volume of frozen isopropanol to precipitate flocculent DNA; centrifuging for 5min (12000 rpm/min), and pouring off the supernatant to obtain DNA precipitate;

adding 75% ethanol solution, and rinsing twice; air drying for 8 hr, adding 400 μ L ddH ₂ O lysis of DNAStandby;

the solubilized DNA was tested for concentration and purity using a NanoDrop ™ how (Thermo Fisher Scientific, wilmington, DE, USA) system to ensure that the requirements for subsequent analysis were met.

(II) referring to the SNP chip specification to judge the genotype; further performing quality control on 207 parts of associated population genotype data, removing SNP markers with a detectable rate lower than 90% (genotype deletion data less than 10%) and a Minimum Allele Frequency (MAF) less than 0.05, and finally screening to obtain 244,508 effective SNP markers which can be used for subsequent GWAS research (Genome-Wide Association Studies).

Example 3

Based on examples 1 and 2, the inventor utilizes the existing MLM (Mixed Linear Model, which can effectively correct the influence of population structure and affinity relation on the analysis result) to perform genome-wide association analysis by combining 207 different wheat varieties with zinc element phenotype data and genotype data under different environments, and the Model specifically comprises the following steps:

Y = Xα + Zβ + μ + e

wherein: y is a table type value, X is a group structure matrix, and alpha is a fixed effect estimation parameter; z is a genetic relationship matrix, beta is a molecular marker effect, mu is a random effect estimation coefficient, and e is a random deviation.

It should be noted that there may be close linkage between different markers, and therefore an effective number of independent markers needs to be estimated to reduce the probability of false positives.

In the screening and marking process, the significance threshold value of the correlation analysis is determined to be 1.0e-04.

The final analysis result shows that the 376,625,452 nucleotides positioned on the 3B chromosome on the gene chip are significantly related to the accumulation of the zinc element content of the wheat grains (P <1.0 e-04) and are simultaneously identified in 2 different environments (the result is shown in figure 2), while the phenotype interpretation rates of the SNP2471 marker are 14.75% and 19.07% respectively under the different environments (the result is shown in table 3). Meanwhile, the 650,240,330 th nucleotides located on the 5A chromosome of the gene chip are significantly related to the accumulation of the zinc element content of wheat grains (P <1.0 e-04), and are simultaneously identified in 2 different environments (the result is shown in figure 3), and the phenotype interpretation rates of the SNP1014 marker are respectively 15.59% and 15.89% under the different environments (the result is shown in table 4).

TABLE 3 SNP2471 marker association analysis results

。

TABLE 4 SNP1014 marker Association analysis results

。

After further analysis, the specific nucleotide sequence of the SNP2471 marker is:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCT[A/G]ATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT，

a 36 th base of the sequence has a 36A-36G polymorphic site;

the specific nucleotide sequence of the SNP1014 marker is as follows:

GGTGTTTCCATTGTGCTCCAGTTGAGCTCCTTAAG[A/C]TATCGCACCATTTTACCCCTCTTCATCTCGCATGA，

A36A-36C polymorphic site is present at the 36 th base of this sequence.

And the accumulation condition of the zinc element of the wheat grains under the conditions of the two markers with different genotypes is further counted, and the results are shown in the following tables 5 and 6.

Table 5, influence of SNP2471 marking different genotypes on accumulation of zinc element in wheat grains

Table 6, influence of SNP1014 marking different genotypes on accumulation of zinc element in wheat grains

Note that "1" is the mean value of the phenotype in 2 environments for individuals of different genotypes; "2" is the analysis of the significance of the difference between individuals with different genotypes.

As can be seen from the analysis of the above table 5, the accumulation capacity of zinc element in the grain of the wheat material with the genotype of AA is significantly higher than that of the GG material, wherein the zinc element content of the wheat grain of the AA haplotype is increased by 20.46 percent compared with that of the GG haplotype material. Therefore, the AA genotype wheat grains can be determined to have stronger capacity of accumulating the zinc element. The above results indicate that the AA genotype is a dominant haplotype relative to the GG genotype (as shown in FIG. 4).

As can be seen from the analysis of the above table 6, the zinc element accumulation capacity of the individual wheat grain with the genotype of AA is significantly higher than that of the individual CC, wherein the zinc element content of the wheat grain with the AA haplotype is increased by 16.28 percent compared with that of the individual CC haplotype material. Therefore, the AA genotype wheat grains can be determined to have stronger capacity of accumulating the zinc element. The above results indicate that the AA genotype is a dominant haplotype relative to the CC genotype (as shown in FIG. 5).

In conclusion, the inventor believes that the molecular marking technology can accurately and quickly predict the zinc element accumulation condition of wheat grains in the mature period in the seedling period, so that the time cost of breeding is reduced; meanwhile, the molecular marker detection technology has the advantages of high flux, high detection efficiency and the like, so the molecular marker obtained by screening can play a good application effect in the breeding of new zinc-rich wheat varieties and the screening of excellent germplasm resources.

SEQUENCE LISTING

<110> agricultural science institute of Henan province

Molecular marker of <120> wheat grain zinc content QTL qZn-3B

<130> none

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 72

<212> DNA

<213> Artificial design

<400> 1

aggtttccat attatacact ggtgcttcca aatctaaatt tttttggttc aatgaaataa 60

taactgcttc at 72

<210> 2

<211> 72

<212> DNA

<213> Artificial design

<400> 2

aggtttccat attatacact ggtgcttcca aatctggatt tttttggttc aatgaaataa 60

taactgcttc at 72

<210> 3

<211> 72

<212> DNA

<213> Artificial design

<400> 3

ggtgtttcca ttgtgctcca gttgagctcc ttaagaatat cgcaccattt tacccctctt 60

catctcgcat ga 72

<210> 4

<211> 72

<212> DNA

<213> Artificial design

<400> 4

ggtgtttcca ttgtgctcca gttgagctcc ttaagcctat cgcaccattt tacccctctt 60

catctcgcat ga 72

Claims (2)

1. The molecular marker of the wheat grain zinc content QTL qZn-3B is characterized in that the molecular marker is named as SNP2471, the marker is positioned on a wheat 3B chromosome, and the specific nucleotide sequence is as follows:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCT[A/G]ATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT，

wherein the 36 th base is a 36A-36G polymorphic site with an A/G polymorphism; specifically, the method comprises the following steps:

when the locus is AA, the zinc-rich favorable genotype of the wheat grain is obtained, and the nucleotide sequence is shown as SEQ ID NO.1 and specifically comprises the following steps:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCTAAATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT；

when the locus is GG, the locus is a zinc-rich unfavorable genotype of wheat grains, and the nucleotide sequence is shown as SEQ ID No.2 and specifically comprises the following steps:

AGGTTTCCATATTATACACTGGTGCTTCCAAATCTGGATTTTTTTGGTTCAATGAAATAATAACTGCTTCAT。

2. the application of the molecular marker of the wheat grain zinc content QTL qZn-3B in wheat variety cultivation in claim 1 is characterized in that the molecular marker is applied as a molecular marker assisted breeding of a zinc-rich wheat variety.

Images