CN101906427A

CN101906427A - Rice blast resistance gene Pi1 and application thereof

Info

Publication number: CN101906427A
Application number: CN 201010212200
Authority: CN
Inventors: 潘庆华
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2010-06-25
Filing date: 2010-06-25
Publication date: 2010-12-08

Abstract

The invention discloses clone and application of rice blast resistance gene Pi1. The rice blast resistance gene Pi1 comprises gene Pi1-1, or Pi1-2, or tandem sequence of the Pi1-1 and the Pi1-2, the nucleotide sequence of the Pi1-1 is shown as SEQIDNO:1, the nucleotide sequence of the Pi1-2 is shown as SEQIDNO:2, and the nucleotide sequence of the tandem sequence is shown as SEQIDNO:3. The two genes of Pi1-1 and Pi1-2 belong to members of CC-NBS-LRR resistance gene family and are constitutive expression genes. The rice blast resistance gene Pi1 can endue plants with specific disease resistance response to disease caused by rice blast fungus (Magnaporthe oryzae), and is suitable for the plants sensitive to pathogens. By connecting the Pi1 gene sequence with plants transformation carriers to be introduced to plant cells, genetically modified resistant varieties can be obtained so as to be applied to farm production.

Description

Rice blast resistance gene Pi 1 and application thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to clone and the application thereof of a kind of resistance gene of rice blast Pi1.

Background technology

Plant usually is subjected to the infringement of multiple pathogen in the process of growth, plant then takes multiple defence policies to protect self, avoids being subjected to it to attack.A most important defense mechanism is exactly the defence answering system that can discern the existence of obligate pathogenic microorganism and start self in the plant.Plant is mediated by disease-resistant gene the identification of pathogenic bacteria.Therefore, enantiopathy gene product structure is analyzed and is studied, and is the basis of understanding plant disease-resistant mechanism, also has important directive significance for the prevention and the control of its disease.

Up to now, from plant, separated more than 80 disease-resistant gene.To the structure of these disease-resistant genes and discovering of product, though host plant difference, pairing pathogen also has fungi, bacterium, differences such as virus and nematode, but the structure of disease-resistant gene and product have many common constitutional featuress, there is rich leucine tumor-necrosis factor glycoproteins (leucine-rich repeat as the C-end, LRR), there is nucleotide binding site (nucleotide binding site in the N-end, NBS), and leucine zipper (leucine zipper, LZ), coiled coil structural domain (coiled-coil, CC), and membrane spaning domain (transmembrane domain, TM), protein kinase (protein kinase, PK), and fruit bat Toll albumen and Mammals interleukin-1 receptor (Toll andinterleukin-1 receptor, TIR) etc.According to they coded proteic constitutional featuress, disease-resistant gene can be divided into 7 classes (Hammond-Kosack ﹠amp; Jones, 1997; Dangl ﹠amp; Jones 2001; Iyer ﹠amp; McCouch 2004).

The first kind, toxin reduction enzyme disease-resistant gene.As corn disease-resistant gene Hm1, it is the 1st plant disease resistance genes that quilt is cloned, and its control is to the resistance of fungi Cochliobolus carbonum microspecies 1.Hm1 coding separate the HC toxin that toxenzyme can the passivation pathogenic fungi be produced, and the HC toxin is the virulence factor that fungi C.carbonum microspecies 1 produce, it determines this germ can only infect some genotype of corn (Johal etc., 1992).Second class, NBS-LRR class disease-resistant gene.The nearly N end of their encoded protein is NBS, and nearly C end then is made up of LRR.As RPS2 (Bent et al., 1994), RPM1 (Grant etal., 1995), I2 (Simon et al., 1998); RPP5 (Parker et al., 1997), N (Doddet al., 2001), L6 (Lawrence et al., 1995), Mla1 (Zhou et al., 2001), Mla6 (Halterman et al., 2001); Disease-resistant gene of paddy rice such as Xa1 (Yoshimura et al., 1998), Pib (Wang et al., 1999), Pita (Bryan et al., 2000) etc.The 3rd class, PK class disease-resistant gene.As tomato Pto gene, its product is a kind of intracellular serine-threonine protein kinase enzyme that is positioned at, and does not have LRR structural domain (Martin et al., 1993).The 4th class, LRR-TM class disease-resistant gene.Gene C f-2 (the Dixon et al. of the different physiological strains of the anti-leaf mold of tomato, 1996), Cf-4 (Thomas et al., 1997), Cf-5 (Dixon et al., 1998), Cf-9 (Jones et al., 1994), and the gene Hs1 of the anti-Cyst nematode of beet ^Pro-1(Cai et al., 1997) etc.The 5th class, LRR-TM-PK class disease-resistant gene is representative with rice bacterial blight resistance gene Xa21 (Song et al., 1995).The 6th class is representative with the RPW8 of Arabidopis thaliana, and its encoded protein only contains complete CC and NBS structural domain (Xiao et al., 2001).The 7th class is representative with the xa5 gene of paddy rice, and its encoded protein is a transcription factor (TFIIA γ) (Iyer﹠amp; McCouch, 2004).

The disease-resistant proteic disease-resistant gene of coding NBS-LRR class is a class disease-resistant gene maximum in the plant disease resistance genes, constructional feature according to the disease-resistant protein N terminal of NBS-LRR class, this genoid can be divided into two big class TIR-NBS-LRR and CC-NBS-LRR (Meyers et al., 2002 again; Pan et al., 2000; Cannon et al., 2002; Richly et al., 2002).TIR-NBS-LRR class disease-resistant gene is mainly found in dicotyledons, does not also find (Bai et al., 2002 so far in the monocotyledons genome; Meyerset al., 2002).The disease-resistant gene that in monocotyledons, identifies the at present disease-resistant albumen of CC-NBS-LRR class of mainly encoding, also there is a large amount of CC-NBS-LRR class disease-resistant genes in the dicotyledons, comparatively speaking, CC-NBS-LRR class disease-resistant gene in the monocotyledons is than more rich and varied (Cannon et al., 2002) in the dicotyledons.

Studies show that NBS, CC, TIR structural domain may participate in signal conduction (Hammond-Kosack﹠amp; Jones 1997), although this class R albumen does not have the intrinsic kinase activity, NBS can activate kinases or G albumen, NBS has in conjunction with ATP or GTP and hydrolytic enzyme activities (Traut et al., 1994).The signal conduction (Jones et al., 1994) in the disease-resistant defense response of TIR structure possibility involved in plant downstream.Nearest evidence shows that the L family diversity of flax selects to also occur in the TIR zone, and this zone forms specificity (Luck et al., 2000) with corresponding LRR zone coevolution.The function of LRR structural domain be mainly concerned with protein-protein and with interaction (the Jones ﹠amp of part; Jones, 1996; Kajava et al., 1998), be product or the indirect interactional position of product (Bent, 1996 that the disease-resistant gene product is direct and the pathogenic bacteria nontoxic gene is encoded by inference; Baker et al., 1997).Jia et al. (2000) is processed as one 176 amino acid whose activated protein AVR-Pita by yeast two-hybrid proof AVR-Pita encoded protein ₁₇₆The specific exciton of microspecies is delivered to plant cytoplasm and combines with the LRD zone of Pita acceptor specifically, thus the defense response of Pita mediation in the activating cells.Av-rPita after the Ala among the Pita becomes Ser ₁₇₆Can not combine with LRD, thereby show susceptible.This result has proved that directly the LRR structural domain may be exactly the zone of pathogenic bacteria identification; Mutual " gene pairs gene " relation of making to have verified from molecular level for the first time paddy rice and Pyricularia oryzae of Pita and AvrPita.

Paddy rice is one of most important food crop in the world, and it is staple food with rice that population over half is arranged approximately.(no condition: Pyricularia oryzae) rice blast that causes is that Rice Production is endangered one of severe diseases, annually all causes serious grain loss by pathogenic fungi Magnapothe oryzae.From the viewpoint of Sustainable development of environment protection with agricultural, breed and the utilization of disease-resistant variety is the safe and effective procedure of control rice blast.But, because the diversity and the volatility of rice blast fungus population, people lack effective utilization of antagonism gene in addition, and antagonism mechanism lacks understanding fully, so that the susceptibleization problem of disease-resistant variety not only is not resolved, and becomes thremmatology man stubborn problem the most because of the shortage of effective anti-source gene and short-livedization of disease-resistant variety on the contrary.Therefore, excavate, identify and clone disease-resistant gene and reasonably be applied to breeding for disease resistance in the works, become the preferential major issue that solves in the agri-scientific research.

Along with molecular biological fast development, so far, have at least more than 80 rice blast master to imitate resistant gene and be in the news, wherein located for 60 by molecule.At present, also not identified the rice blast master on the 3rd karyomit(e) of paddy rice imitates the resistant gene, all identified the main resistant gene site of imitating on remaining 11 karyomit(e), and contain a plurality of rice blast resistances site on the karyomit(e) that has, and the resistant gene of some gene locus is that cluster exists.At present, aspect clone's research of rice blast resistance gene, existing 13 resistant genes of formal report, Pib (Wang et al., 1999), Pita (Bryan et al., 2000), Pi9 (Qu et al., 2006), Pid2 (Chen et al., 2006), Piz-t and Pi2 (Zhou et al., 2006b), and Pi36 (Liu et al., 2007a), Pi37 (Lin et al., 2007), Pik-m (Ashikawa et al., 2008), Pit (Hayashi et al., 2009), Pi5 (Lee et al., 2009), Pid3 (Shang et al., 2009) and pi21 (Fukuoka et al., 2009).

Clone's disease-resistant gene is the prerequisite to the further investigation of paddy rice resistance mechanism, discloses the molecule mechanism of rice anti-rice blast and can control and reduce the harm of Pyricularia oryzae to paddy rice better.Simultaneously, clone's disease-resistant gene is modified and transformed, can control and increase the disease resistance of plant artificially, widen the anti-spectrum of plant.These aspects are that employing conventional plant breeding and improving technology institute are inaccessiable.

Summary of the invention

The purpose of this invention is to provide a kind of resistance gene of rice blast and the dna fragmentation that comprises the promotor of regulating and control this gene.Another object of the present invention provides the coded protein of above-mentioned rice blast resistance gene.Another object of the present invention provides the above-mentioned carrier that contains above-mentioned resistant gene.Another object of the present invention provides the host cell of above-mentioned carrier.Another object of the present invention provides the application of said gene in the preparation transgenic plant.Further purpose of the present invention provides molecule marker that above-mentioned resistant gene produces and rice blast is had application in the paddy rice of disease resistance in seed selection.

The present invention separates from rice varieties C101LAC and obtains the Pi1 gene, the gene Pi 1-1 and the Pi1-2 that comprise 2 coding NBS-LRR proteinoids, its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, their aminoacid sequences shown in SEQ ID NO.3 and the SEQ ID NO.4 of encoding respectively, structure as shown in Figure 6 and Figure 7.Their albumen all comprises 2 main structural domain: NBS and LRR zone, wherein Pi1-1 NBS structural domain contains conservative kinase 1a:GLPGGGKTTVAR, kinase2:NKKYLIVIDDIW, kinase3a:DLGGRIIMTTRLNSI, GLPL:EDSPCYDIVNMCYGMPLALI; Pi1-2 NBS structural domain contains conservative kinase1a:VLSIVGFGGVGKTTIA, kinase2:LEQLLAEKSYILLIDDIW, kinase3a:GGRIIVTTRFQAV, GLPL:EQVPEEIWKICGGLPLAIV, RNBS-D:CLLYLSIFPKGWK, MHDV:KTFQVHDMVLEYI.And the proteic C-end of Pi1-1 is 16 incomplete LRR repetitions, and its leucine content is 14.0% (Fig. 6); The proteic C-end of Pi1-2 is that 13 incomplete LRR repeat, and its leucine content is 17.0% (Fig. 7).

Be to be understood that, under the prerequisite that does not influence protein-active (not in proteic active centre), those skilled in the art can carry out various replacements, interpolation and/or lack the aminoacid sequence that one or several amino acid obtains to have same function the aminoacid sequence shown in SEQ ID NO.3 or the SEQ ID NO.4.In addition, consider the degeneracy of codon, for example can be in its coding region, under the condition that does not change aminoacid sequence, or at its non-coding region under the condition that does not influence protein expression, above-mentioned proteic gene order is made amendment to encoding.Therefore, the present invention also comprises replacement, the interpolation that the above-mentioned proteic gene order of encoding is carried out and/or lacks one or more Nucleotide, has the nucleotide sequence that has identical function with above-mentioned encoding gene.The present invention also comprises just sequence or the antisense sequences based on described gene, comprises the host cell that contains described nucleotide sequence or its segmental cloning vector or expression vector, contain described carrier, contains described nucleotide sequence or its segmental plant transformed cell and transgenic plant.

The present invention comprises that equally the primary structure part with the Pi1 resistant gene connects the upward formed mosaic gene of proper regulation sequence effectively, and comprises the plant of this gene and the seed of this kind of plant in genome.This gene can be natural or chimeric.For example, will comprise the fragment of this gene and the promotor of a constitutive expression and be connected, this promotor can and be expressed under any condition cytocerastic any period.The promotor of this constitutive expression comprises the 35S promoter of cauliflower mosaic virus etc.On the other hand, also promotor that can the promotor of this gene and a tissue specific expression or developmental stage is specific expressed or accurately the promotor of environmental induction be connected, these promotors are referred to as inducible promoter.Like this, the change of environment, the difference of developmental stage can change this expression of gene.Similarly, also this expression of gene can be limited in some tissues, make by this gene induced disease resistance response and obtain artificial control.Wherein envrionment conditions comprises attack, anaerobic condition and the light etc. of pathogenic bacteria, and tissue and developmental stage comprise leaf, fruit, seed and flower etc.

The present invention also further clones the promotor that obtains described gene, and the dna fragmentation that comprises the promotor of regulating and control this gene is respectively shown in SEQ ID NO.5 and SEQ ID NO.6.

According to Pi1 gene order information provided by the invention (SEQ ID No.1 and SEQ ID No.2), those skilled in the art can easily obtain the gene that is equal to Pi1 by the following method: (1) obtains by database retrieval; (2) with the Pi1 gene fragment be genomic library or the acquisition of cDNA library of probe Screening of Rice or other plant; (3) according to Pi1 gene order information design oligonucleotides primer, from genome, mRNA and the cDNA of paddy rice or other plant, obtain with the method for pcr amplification; (4) on the basis of Pi1 gene order, obtain with the gene engineering method transformation; (5) method with chemosynthesis obtains this gene.

Rice blast resistance gene Pi 1 provided by the invention has important use and is worth, and it is given plant the caused disease of Pyricularia oryzae (Magnaporthe oryzae) is produced specific disease resistance response.It is applicable to that these plants comprise monocotyledons and dicotyledons to all plants to this pathogenic bacteria sensitivity.One of application is that described Pi1 gene order is connected to any plant conversion carrier, with any method for transformation the Pi1 disease-resistant gene is imported paddy rice or other plant cell, can obtain the transgenosis disease-resistant variety of expressing said gene, thereby be applied to produce.Of the present invention gene constructed in plant conversion carrier, can do suitable modification to described gene or its regulating and controlling sequence, also can before its transcription initiation codon, replace the original promotor of described gene, thereby widen and strengthen the resistance of plant pathogenic bacteria with other promotor.

The Another application of resistant gene provided by the invention is to produce specific molecule marker according to described gene order information, includes but not limited to SNP (mononucleotide polymorphic), SSR (simple sequence repeats polymorphic), RFLP (restriction enzyme length is polymorphic), CAPS (the cutting amplified fragments is polymorphic).Can identify the resistant gene type of paddy rice or other plant with this mark, be used for the molecular marker assisted selection breeding, thereby improve the efficiency of selection of breeding.

The present invention has tangible advantage and effect.Change clone's disease-resistant gene over to susceptible plant, help to produce new disease-resistant plants.Particularly can be with transformation technology a plurality of disease-resistant genes that in plant, add up, and can not produce the chain problem of bad gene in the genome of following appearance in the traditional breeding technology, and can shorten breeding time.The clone of disease-resistant gene overcomes the prerequisite that can not shift the problem of disease-resistant gene in the traditional breeding method between plant species.

The present invention can further provide or use disease-resistant transfer-gen plant and the corresponding seed that obtains based on above-mentioned dna fragmentation, and with gene of the present invention or based on the recombinant chou plants transformed of this gene or the seed that obtains by this class plant.Can gene of the present invention be changed in other the plant with the mode of sexual hybridization.

Description of drawings

Fig. 1. the map based cloning technological line figure of resistance gene of rice blast Pi1.

Fig. 2 .Pi1 and Pik bunch allelotrope is to the comparison of the anti-spectrum of 8 rice blast fungus populations.Ordinate zou is a fastness frequency among the figure, and X-coordinate is 8 rice blast fungus populations (GD, Guangdong; FJ, Fujian; HN, the Hunan; YN, Yunnan; GZ, Guizhou; SC, Sichuan; JS, Jiangsu; LN, Liaoning; JL, Jilin; HLJ, Heilungkiang).5 Pik bunch allelotrope (C101LAC, Pi1; CO39, pi1; K60, Pik-p; Kusabue, Pik; Tsuyuake, Pik-m).This shows that Pi1 is to the resistance of 8 rice blast fungus population apparent altitudes except Liaoning and Jilin.

The linked marker figure of Fig. 3 A.Pi1 gene locus.Numeral above the horizontal line is the genetic distance [with centimorgan (cM) expression] between the mark; Recombinant chou/gametophyte that numeral in the bracket goes out for this marker detection.

6 disease-resistant candidate genes that Fig. 3 B.Pi1 gene locus exists on the fine type gene group of Japan with NBS-LRR conserved structure.

6 candidate genes that Fig. 3 C.Pi1 gene locus exists on C101LAC/Tsuyuake type gene group, wherein 2 typical NBS-LRR albumen of coding with disease-resistant conserved structure.This shows, have two types genome, have very big disappearance/insertion each other at the Pi1 gene locus; The Pi1 gene have 6 candidate genes (Pi1-1, Pi1-2, Pi1-3, Pi1-4, Pi1-5, Pi1-6).

Fig. 4. the genetic complementation T of resistance gene of rice blast Pi1 (forming) by Pi1-1 and Pi1-2 ₀The resistance of plant is identified pictorial diagram.Solid arrow refers to disease-resistant plant among the figure, and disease plant that dotted arrow refers to illustrates that resistance gene Pi 1 is made up of Pi1-1 and Pi1-2 to show disease-resistant function.

Fig. 5. the part T of resistance gene of rice blast Pi1 genetic complementation ₀The PCR of the selective marker HPT gene of transformant detects figure.Among the figure from left to right, swimming lane 1 and swimming lane 15: molecular weight marker DL2000; Swimming lane 2:Pi1 clones (Vector), positive control; Swimming lane 3: acceptor kind Q1063, negative control; Swimming lane 4:H ₂O, negative control; Swimming lane 5-14:T ₀Transformant.The result shows, all disease-resistant transformant have all detected the pcr amplification product of selective marker HPT gene, susceptible transformant does not then detect, and illustrates that disease-resistant transformant is to have obtained in the acceptor kind of high sense to express to have recovered resistance owing to transformation construct has been incorporated into.R: high anti-; MR: in anti-; MS: middle sense; S: susceptible.

The gene structure figure of the constitutive gene Pi1-1 of Fig. 6 A. resistance gene of rice blast Pi1.

Band oblique line box indicating 5 ' and 3 '-UTR among the figure; Dark box indicating exon; Lines are represented intron; The size (bp) in the promotor of this gene coding region (ATG) and terminator (TAG) and each zone also is shown in wherein.

Constitutive gene Pi1-1 amino acids coding peptide sequence and the structure iron of Fig. 6 B. resistance gene of rice blast Pi1.

Italics among the figure in the CC structural domain represents to form the amino acid of CC motif, and aminoacid sequence conservative among the NBS represented in the boldface type of NBS zone band underscore.The amino-acid residue that independently list the lower section is the terminal LRR of C-zone; The conservative motif of xLDL in LRR zone represented to form in the boldface type of band underscore; Back, LRR zone also has one section CNL (C holds non-LRR zone) aminoacid sequence.Two aminoacid sequences of indicating of rolling off the production line be the special amino acid of Pi1 replace [substitution, with other allelotrope of Pik bunch (Pik-p, Pik-h Pik-m) compares for Pik, Pik-s].

The gene structure figure of another constitutive gene Pi1-2 of Fig. 7 A. resistance gene of rice blast Pi1.

Another constitutive gene Pi1-2 amino acids coding peptide sequence and the structure iron of Fig. 7 B. resistance gene of rice blast Pi1.Look italics among the figure in the CC structural domain represents to form the amino acid of CC structure, and aminoacid sequence conservative among the NBS represented in the boldface type of NBS zone band underscore.The amino-acid residue that independently list the lower section is the terminal LRR of C-zone; The conservative motif of xLDL in LRR zone represented to form in the boldface type of band underscore.Two 1 aminoacid sequence indicating of rolling off the production line are that allele specific oligonucleotide amino acid replaces that (substitution is with Pik bunch allelotrope (Pik-p, Pik-h Pik-m) compares for Pik, Pik-s).

Fig. 8. the quantitative RT-PCR of resistance gene of rice blast Pi1 expression characterization detects figure.Left side figure is that constitutive gene Pi1-1 is in different inoculation time points (0h, 12h, 24h, 72h, relative expression's level 120h).This shows that this gene is higher at 12h and 24 expression levels, 72h is minimum; Overall expression level is lower than Pi1-2.Right figure is the relative expression level of another constitutive gene Pi1-2 at different inoculation time points.This shows that this expression of gene level progressively raises, and is minimum in 72h, raise again then.2 constitutive genes all show as constitutive expression because the inoculation before and can both detect 2 expression of gene afterwards.

Fig. 9. utilize the genotype identification figure of resistance gene of rice blast Pi1 specific molecular marker.This shows, utilize this molecule marker can be the genotype of resistant variety C101LAC (Pi1/Pi1); The genotype of susceptible variety Q1063 (pi1/pi1); Contain genotype (Pik-m/Pik-m) with the homotopic resistant variety Tsuyuake of Pi1; The genotype of resistant variety K3 (Pik-h/Pik-h); The genotype of resistant variety Kusabue (Pik/Pik); The genotype of resistant variety K60 (Pikp/Pikp); And be the T of acceptor with susceptible variety Q1063 ₀The genotype of transformant is differentiated out.Among the figure, R: high anti-; S: susceptible.

Embodiment

Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.If do not specialize the conventional means that used technique means is well known to those skilled in the art among the embodiment.In the embodiments of the invention part, we have set forth the sepn process (Fig. 1) of Pi1 gene and the characteristics of this gene, and isolating Pi1 gene can be connected with appropriate carriers, changes in the plant materials, makes this plant materials have certain resistance.

The resistance feature of embodiment 1 resistance gene Pi 1

At first, for relatively and clearly 5 allelotrope (Pi1, Pik-p on the Pi1 site, Pik, Pik-m, anti-spectrum pi1), utilization is (GD, 60 bacterial strains) from Guangdong, Fujian (FJ, 40), Hunan (HN, 40), Yunnan (YN, 43), Guizhou (GZ, 60), Sichuan (SC, 66), Jiangsu (JS, 72), Liaoning (LN, 108), Jilin (JL, 60), Heilungkiang (HLJ, 63), 612 bacterial strains of the total of collection (are respectively C101LAC to above-mentioned 5 kinds that allelotrope is held, K60, Kusabue, Tsuyuake and CO39) carried out anti-spectrum comparative analysis.The result shows, Pi1 is to the resistance except 8 rice blast fungus population apparent altitudes in Liaoning and Jilin.Illustrate that thus this gene can use in above-mentioned area.Rice varieties C101LAC and CO39 document (Inukai et al.Allelism of blastresistance genes in near-isogenic lines of rice.Phytopathology, 1994, open in 84:1278-1283).All the other rice varieties are at document (Wang et al.Characterization of riceblast resistance genes in the Pik cluster and fine mapping of the Pik-p locus.Phytopathology, 2009, open in 99:900-905).

The location of embodiment 2 resistance gene of rice blast Pi1 and electronics physical mapping

The present invention is to the F by the cross combination origin of long-grained nonglutinous rice disease-resistant variety C101LAC and japonica rice susceptible variety K1 ₂Colony, inoculation is to bacterial strain CHL930 (the Wang et al.Characterization of rice blast resistance genes in the Pik cluster andfine mapping of the Pik-p locus.Phytopathology of the clearly demarcated non-affinity/compatible host response of parents' kind performance, 2009,99:900-905).The result shows, this F ₂Disease-resistant plant and disease plant separates than meeting 3: 1 in the colony.Infer that thus the resistance that C101LAC showed is controlled by a pair of dominant gene.Therefore, made up by 230 individual mapping populations (being equivalent to 460 gametophytes) of forming.

The genetic analysis in early stage shows that Pi1 gene and Pik cluster gene are closely linked (Inukai et al.1994, Phytopathology, 84:1278-1283), and the research department at applicant place has carried out Fine Mapping (Li et al.2007 to the Pik-m gene, Molecular Breeding, 20:179-188).Therefore, the applicant utilizes the molecule marker of Li et al (2007) exploitation to carry out linkage analysis.The result shows, has detected 5 and 1 recombinant chou (Fig. 3) respectively at mark K37 and K28.For the chromosomal region that dwindles the Pi1 site and find with it isolating mark (mark that does not have recombinant chou) altogether, further at K37---in the K28 zone, from the mark of Li et al (2007) exploitation, obtained 1 polymorphism mark (K33), and 3 CRG mark (CRG11-5 have been developed according to reference sequences, CRG11-6 CRG11-7) and to above-mentioned 6 different recombinant chous has carried out linkage analysis.The result shows that mark CRG11-7 has detected 3 recombinant chous, K33, CRG11-5, the performance of CRG11-6 and Pi1 site be divided into completely from.Therefore, the Pi1 site finally is defined in CRG11-7---in the zone between the K28, wherein 3 marks be divided into fully with it from.

In order to make up the electronics physical map in Pi1 site, chain with it mark is landed on the reference sequences of rice varieties Japan fine (Nipponbare) by bioinformatics method, and made up the contig of this gene locus thus.Can infer that by reference sequences the Pi1 site is defined in the scope of about 500kb between flank mark CRG11-7 and the K28.

The note and the sequential analysis of embodiment 3 resistance gene of rice blast Pi1 candidate genes

In order to determine the candidate gene of Pi1, the applicant utilizes the fine reference sequences of Japan, by 3 kinds of predictive genes software RiceGAAS (http://ricegaas.dna.affrc.go.jp), Gramene (http: // 143.48.220.116/resources/) FGENESH (http://www.softberry.com) with Softberry has carried out predictive genes and note analysis to the goal gene zone, the candidate resistance gene of tentatively having determined Pi1 is that 6 nucleotide binding sites and rich leucine repeat (nucleotidebinding site-leucine-rich repeat, NBS-LRR) candidate gene (Pi1-1N, Pi1-2N, Pi1-3N, Pi1-4N, Pi1-5N, and Pi1-6N).

6 candidate genes are carried out existence/disappearance (presence/absence based on the gene specific mark, P/A) analyze, the result shows, at 4 candidate gene (Pi1-1N of the fine reference sequences existence of Japan, Pi1-2N, Pi1-3N and Pi1-4N) be non-existent in C101LAC.According to Ashikawa et al. (2008, Genetics, the 180:2267-2276) information that is provided, Pi1 goal gene zone has comprised the 70kb sequence of being inserted, and predictive genes and note analysis have been carried out in new goal gene zone.The result shows, this regional prediction is to 6 genes (Pi1-1, Pi1-2, Pi1-3, Pi1-4, Pi1-5 and Pi1-6) with disease-resistant structure, wherein Pi1-1 and the Pi1-2 typical NBS-LRR albumen (Fig. 3) of encoding.Then, special SNP (single nucleotide polymorphisms) mark of exploitation candidate gene has carried out gene type assay to 6 candidate genes.The result shows, except Pi1-1 and Pi1-2, and the SNP genotype of all the other 4 candidate genes and the genotype (Pi1 of disease-resistant gene ⁺Or Pi1 ^-) corresponding (table 1) fully.Explanation thus, the candidate resistance gene of Pi1 has only Pi1-1 and Pi1-2.These presentation of results, Pi1 and Pik cluster gene are homotopic (Ashikawaet al.2008, Genetics, 180:2267-2276), therefore, next step will be with reference to Ashikawa et al. (Genetics, 2008, experimental program 180:2267-2276) directly is together in series 2 candidate genes and carries out the genetic complementation experiment, to determine its function.

Table 1 is based on the gene type assay of Pi1 candidate gene specificity SNP mark mark

^aPi1 ⁺Expression contains the Pi1 gene; Pi1 ^-Expression does not contain the Pi1 gene.

^b1:Pi1 ⁺The SNP genotype of type; 2:Pi1 ^-The SNP genotype of type; H: the SNP genotype of heterozygosis;-: the SNP genotype of disappearance; Pi1 genotype and the SNP genotype of candidate gene Pi1-12 are in full accord, therefore, infer that having only Pi1-12 is the candidate gene of Pi1.

The genetic complementation experiment of embodiment 4 resistance gene of rice blast Pi1 and the resistance of transformant are identified

At first, utilize high-fidelity enzyme phusion in conjunction with long segment PCR (long-range PCR, LR-PCR) technology, total DNA with C101LAC is a template, according to or with reference to Liu et al. (Genetics, 2007,176:2541-2549) with Lin et al. (Genetics, 2007,177:1871-1880) experimental technique of Miao Shuing and program increase, have cloned Pi1-1 and Pi1-2.The primer of amplification, clone Pi1-1 is:

Forward primer: TTTT GGCGCGCCGCCAGTGTCCACCAACCACAGTAATAAA;

Reverse primer:

TTTT GGCGCGCCGAACAGCCTGAGGAAGCAGAACATCGTC)

The primer of amplification, clone Pi1-2 is:

Forward primer:

TTTT GGCGCGCCGCAAGATCAGTACCATCACGAGTAATAGCA；

Reverse primer:

TTTT GGCGCGCCAGGGACAGAATGACAGTGTAAGTGAGTTTG)。

Then, 2 restriction endonucleases that the candidate gene overlapping region is suitable by amplification are spliced into a complete gene with above-mentioned 2 candidate genes.At last, utilize double base conversion carrier pCAMBIA1300 to carry out the genetic complementation experiment.The result has obtained the transformant that has complementary functions, sees Table 2 and Fig. 4.Utilize hygromycin gene (HPT) mark in the conversion carrier that transformant has been carried out the PCR detection.Detected result proof target gene fragment has imported in the disease-resistant transformant, and does not import in the susceptible transformant, sees Fig. 5.

The genetic complementation experiment of table 2.Pi1 gene

^aT ₀It is non-affinity that plant has inoculated Pi1, and is the bacterial strain CHL346 of affinity to the acceptor kind.R, disease-resistant; MR, in anti-; MS, middle sense; S, susceptible.

^bThe success ratio that has complementary functions (%) is R+MR/R+MR+MS+S*100.

The experimental result of above-mentioned genetic complementation shows that resistance gene Pi 1 is the same with Pik bunch allelotrope, is made up of 2 gene Pi 1s-1 and Pi1-2 to show its function.Rice varieties Q1063 and bioabsorbable carrier material pCAMBIA1300 are at document (Lin et al., The blast resistance gene Pi37encodes an NBS-LRR protein and is a member of a resistance gene cluster on ricechromosome 1.Genetics, 2007, open in 177:1871-1880).

The structure of embodiment 5 Pi1 genes

The employing method of moving one's steps is measured the dna sequence dna of Pi1.Utilize the RACE technology, obtained the full length cDNA sequence of Pi1 and it is checked order.Pi1 gene DNA length is 17.7kb (comprising Pi1-1 and Pi1-2), and wherein, the full length cDNA sequence of Pi1-1 is 3761bp, contains the opening code-reading frame of a 3432bp, and 5 ' and 3 ' non-translational region is respectively 110bp and 193bp.By icp gene group DNA and cDNA sequence, find that the opening code-reading frame of this gene contains 2 introns and 3 exons (Fig. 6 A).The full-length cDNA of another constitutive gene Pi1-2 is 3652bp, contains the opening code-reading frame of a 3066bp, and 5 ' and 3 ' non-translational region is respectively 245bp and 284bp.By icp gene group DNA and cDNA sequence, find that the opening code-reading frame of this gene contains 1 intron and 2 exons (Fig. 7 A).

The structure of embodiment 6 Pi1 resistance proteins

2 constitutive gene encoded protein sequences that the Pi1 gene comprises are shown in Pi1-1 SEQ IDNo.3 in the sequence table and Pi1-2SEQ ID No.4.1 protein polypeptide of forming by 1143 amino-acid residues of Pi1-1 genes encoding, molecular weight is 126.60KD, iso-electric point is 6.46.Utilize this protein polypeptide of COIL analysis revealed that CC (coiled-coil) structural domain is arranged.Pi1-1 albumen belongs to NBS-LRR albumen, and conservative kinase 1a (GLPGGGKTTVAR) is positioned at the 290th amino-acid residue of this polypeptide in the NBS structural domain; Kinase 2 (NKKYLIVIDDIW) is positioned at the 376th amino-acid residue of this polypeptide; Kinase3a (DLGGRIIMTTRLNSI) is positioned at the 402nd amino-acid residue of this polypeptide, and GLPL (EDSPCYDIVNMCYGMPLALI) is positioned at 461 amino-acid residues of this protein polypeptide.And 610-960 amino-acid residue of this proteic C-end is 16 imperfect LRR repetitions, and its leucine content is 14.0%, and its C-terminal also has the aminoacid sequence (Fig. 6 B) of a non-LRR structure (CNL).The amino acid that two aminoacid sequences of indicating of rolling off the production line are the Pi1 gene specific among the figure is replaced (substitution), can differentiate thus Pi1 gene and other allelotrope (Pik, Pik-m, Pik-p) difference.

1 protein polypeptide of forming by 1021 amino-acid residues of Pi1-2 genes encoding, molecular weight is 114.57KD, iso-electric point is 8.64.Utilize this protein polypeptide of COIL analysis revealed not have CC (coil-coil) structural domain, find to have the CC structural domain but utilize more powerful forecasting tool Paircoil2 to analyze.Pi1-2 albumen belongs to NBS-LRR albumen, and conservative kinase 1a (GFGGVGKTTIA) is positioned at the 211st amino-acid residue of this polypeptide in the NBS structural domain; Kinase 2 (KSYILLIDDIW) is positioned at the 330th amino-acid residue of this polypeptide; Kinase 3a (GGRIIVTTRFQAV) is positioned at the 358th amino-acid residue of this polypeptide, GLPL (EQVPEEIWKICGGLPLAIV) is positioned at the 415th amino-acid residue of this polypeptide, RNBS-D (CLLYLSIFPKGWK) is positioned at the 488th amino-acid residue of this polypeptide, and MHDV (KTFQVHDMVLEYI) is positioned at the 553rd amino-acid residue of this polypeptide.And the 610-960 of this a proteic C-end amino-acid residue is 13 imperfect LRR repetitions, and its leucine content is 17.0% (Fig. 7 B).

Embodiment 7 Pi1 expression of gene specificity analysises

Utilize the quantitative RT-PCR technology that Pi1 expression of gene pattern is analyzed.The different time point in disease-resistant variety C101LAC inoculation back (0h, 12h, 24h, 72h 120h) goes up and gathers blade and extract its total RNA, utilizes reverse transcription test kit SuperScript ^TMReverse Transcriptase II carries out the synthetic of reverse transcription cDNA article one chain.The primer of RT-PCR is,

RRT5F：GAAGCTCTGATCAACGGTATTCC，

RRT5R：TCTTTGATCATCTTCGGGATACG；

RRT17F：TGAACTTCCACGATTGGATCCAC，

RRT17R：ACATGGTTCTTGAATACATCATGTC。

Real-time quantitative RT-PCR uses CFX96Real-time PCR detection system and SYBR Premix ExTaq test kit (precious biotech firm), and operation is carried out according to the test kit explanation.Fig. 8 (left side) is the relative expression level of constitutive gene Pi1-1 at different inoculation time points.This gene is higher at 12h and 24 expression levels, and 72h is minimum; Overall expression level is lower than Pi1-2.Fig. 8 (right side) is the relative expression level of another constitutive gene Pikh-2 at different inoculation time points.Right figure is the relative expression level of another constitutive gene Pi1-2 at different inoculation time points, this shows that this expression of gene level progressively raises, and is minimum in 72h, raises again then.In addition, 2 constitutive genes are at inoculation contrast (H ₂O) and between the pathogenic bacteria inoculation show visibly different inducible expression.2 constitutive genes all show as constitutive expression because the inoculation before and can both detect 2 expression of gene afterwards.The left and right figure ordinate zou of Fig. 8 all is relative expression's level, and X-coordinate is all represented the time, and unit is hour (h), and the twill block diagram is contrast (before the inoculation), and black surround figure is inoculation contrast (H ₂O), blank block diagram is the pathogenic bacteria inoculation.

Embodiment 8 transforms the application of the resistant plant of Pi1 gene generation

The Pi1 gene clone to plant conversion carrier pCAMBIA1300, is imported among the agrobacterium strains EHA105, be used to transform susceptible rice varieties Q1063, obtained 177 strain transformed plants, wherein 25 strains performance resistance reaction sees Table 2 and Fig. 4.This explanation can be used Pi1 gene transformation paddy rice susceptible variety, after a series of procedures of breeding such as selfing, purifying selection, can produce disease-resistant variety and is applied to produce.

Embodiment 9 application of Pi1 gene order in the molecular marker assisted selection breeding

Utilize Pi1 gene order information provided by the invention can develop molecule marker (the Pi1-1SNP-F:CGC CGGTGACCTAAGAATCGA of gene specific; Pi1-1SNP-R:CCGTTATCTCCTTCACATC, amplified production carries out enzyme with restriction enzyme Cla I and cuts), Pi1 gene and other allelotrope (Pik had both been can be used for differentiating, Pik-h, Pik-p, Pik-m) difference (band position difference), also can in transfer-gen plant, be used to identify the range gene type on the Pi1 site, it is the plant of Pi1/pi1 and pi1/pi1, these information can be applied in the molecular marker assisted selection breeding process, to improve the purpose and the efficient (Fig. 8) of breeding.

The sequence explanation

SEQ ID NO.1 ﹠amp; The 2nd, the nucleotide sequence of Pi1-1 and Pi1-2; SEQ ID NO.3 ﹠amp; The 4th, SEQ ID NO.1 ﹠amp; 2 coded product; SEQ ID NO.5 ﹠amp; The 6th, have the Pi1-1 and the Pi1-2 nucleotide sequence of promotor.SEQ ID NO.7 ﹠amp; 8 and SEQ ID NO.9 ﹠amp; The 10th, the primer of be used for respectively increasing Pi1-1 and Pi1-2 is right; SEQ ID NO.11 ﹠amp; 12 and SEQ ID NO.13 ﹠amp; 14 is respectively that primer is to RRT5F, RRT5R and RRT17F, RRT17R; SEQ ID NO.15 ﹠amp; The 16th, primer is to Pi1-1SNP-F and Pi1-1SNP-R; SEQ ID NO.17～26 are respectively kinase 1a, kinase 2, kinase 3a, GLPL, RNBS-D, the MHD sequences of kinase 1a, kinase2, kinase 3a, GLPL sequence and the Pi1-2 of Pi1-1.

Claims

1. a resistance gene of rice blast Pi1 separates obtaining from rice varieties C101IAC, comprises gene Pi 1-1 and Pi1-2, and the nucleotide sequence of Pi1-1 is shown in SEQ ID NO:1, and the nucleotide sequence of Pi1-2 is shown in SEQ ID NO:2.

2. the described resistance gene of rice blast Pi1 of claim 1 encoded protein, the aminoacid sequence that it is characterized in that described gene Pi 1-1 encoded protein is shown in SEQ ID NO:3; The aminoacid sequence of described gene Pi 1-2 encoded protein is shown in SEQ ID NO:4.

3. the cDNA sequence of the described resistance gene of rice blast Pi1 of claim 1.

4. an expression cassette is characterized in that described expression cassette is by the described resistance gene of rice blast Pi1 of claim 1 or described cDNA of claim 3 and promotor structure.

5. an expression vector is characterized in that described expression vector contains described resistance gene of rice blast Pi1 of claim 1 or the described cDNA of claim 3.

6. a molecule marker is characterized in that described molecule marker is produced by the described resistance gene of rice blast Pi1 of claim 1.

7. the application of the described resistance gene of rice blast Pi1 of claim 1 in the preparation transgenic plant.

8. the application of the described resistance gene of rice blast Pi1 of claim 1 in improving rice anti-rice blast.

9. the application of the described resistance gene of rice blast Pi1 of claim 1 is characterized in that described resistance gene of rice blast Pi1 produces molecule marker, is used for the assistant breeding of rice anti-rice blast.