CN116064896A - Primer group for screening anti-spot wilt tobacco chromosome 8 background and application thereof - Google Patents

Abstract

The invention belongs to the field of tobacco breeding, and relates to a primer set for screening a tobacco No. 8 chromosome background for resisting spot wilt and application thereof. Providing a PCR primer combination for screening a tobacco breeding background for resisting the spot wilt, wherein the PCR primer combination comprises a first PCR primer group and/or a second PCR primer group; the first PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 1-3; the second PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 4-6; the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco. The primer group can be used for screening the tobacco with the background of K326 tobacco in the early generation, greatly shortens the breeding period of directional improvement of the K326 tobacco with the background of the K326 tobacco, and improves the breeding efficiency.

Description

Primer group for screening anti-spot wilt tobacco chromosome 8 background and application thereof

Technical Field

The invention belongs to the field of tobacco breeding, and relates to a primer group for identifying donor parent Polalta and backcross parent K326 genotypes in the backcross breeding process of anti-leaf blight tobacco, in particular to a primer group for screening the background of No. 8 chromosome of anti-leaf blight tobacco and application of the primer group in oriented improvement of anti-leaf blight of K326 tobacco or breeding of anti-leaf blight tobacco varieties.

Background

In crop production, some good varieties are outstanding in important characters such as yield, agronomy and the like, however, the individual characters (such as disease resistance, insect resistance and the like) are not good, so that the yield and quality potential are difficult to fully exert, and large-area planting is restricted. The directional improvement of the variety is to introduce excellent target characters from a donor to a recurrent parent through backcross breeding aiming at individual defect characters of the existing main cultivated variety or special variety, and other excellent characters of the recurrent parent are maintained, so that the method is an effective and important breeding method for improving single or few bad characters of the variety by breeders. The genetic background and other characters of the variety after directional improvement are consistent with those of the original fine variety, and the variety is an upgrade version of the original fine variety.

In modern breeding, the progress of directional improvement breeding is greatly accelerated by molecular marker assisted selection. In particular to molecular marker assisted backcross background selection, which can utilize molecular markers to select single plants consistent with recurrent parent genome in backcross offspring, reduce backcross generation and achieve the aim of directional improvement in short generation. Theoretically, molecular marker assisted backcross breeding is the fastest and optimal breeding scheme for directional improvement of single or multiple traits controlled by major genes. Compared with the conventional backcross breeding directional improvement, the molecular marker assists backcross background selection to enable improved varieties to enter the market in advance.

Tobacco leaf spot disease (Tobacco spotted wilt disease, TSWD) is a serious disease caused by infection with orthotomato leaf spot virus (orthosporvirus). Tomato spotted wilt virus (Tomato spotted wilt virus, TSWV) is a representative species of the genus orthotomato spotted wilt virus. Tobacco pterocarpus (N.alata) is a wild tobacco of the genus Nicotiana, has good resistance to TSWV, and is the only tobacco leaf spot resistance available so far. Gajos et al successfully used the anti-spot wilt gene locus (RTSP site) using Nicotiana tabacum (N.otophora) as a bridging parent, wherein RTSP isResistance to TSWV for short) was transferred from wild tobacco (n.alata) into cultivated tobacco (n.tabacum l.), resulting in a breeding material 'Polalta' for tobacco resistant to spot blight. 'Polalta' is a European line containing dark-colored air-cured tobacco pedigrees, and has a large background difference from the dominant flue-cured tobacco lines in China and International markets. The Polalta is used as a male parent and the flue-cured tobacco main cultivated variety K326 is used as a female parent for hybridization, and although the tobacco with the spot wilt resistance, which has no obvious difference between the agronomic characters and the main cultivated variety, can be obtained, the tobacco with the spot wilt resistance still has the difference between in-vivo metabolites and chemical components, and the risk that the style characteristics can not fully meet the production requirements of flue-cured tobacco industry is caused. In order to circumvent this risk in tobacco leaf spot improvement cured tobacco cultivars, backcrossing with leaf spot resistant tobacco is requiredBreeding, and directionally improving the spot blight resistance of the main-cultivated flue-cured tobacco variety. The molecular marker is utilized to carry out backcross auxiliary background selection, so that the progress of directional improvement of the spot blight resistance of the flue-cured tobacco can be accelerated.

The single nucleotide polymorphisms (single nucleotide polymorphism, SNPs) are quite widely distributed in the genome, being the most common form of genetic variation among plant individuals, and frequently occurring single nucleotide polymorphisms include base substitutions, transversions, insertions and deletions. SNPs widely distributed in the genome are mostly not directly responsible for the phenotype, but can be developed as important molecular markers because they are closely linked to the site responsible for the phenotype. SNPs have become one of the most ideal molecular markers for genetic studies of complex traits in plants.

Competitive allele-specific PCR (Kompetitive Allele Specific PCR, KASP) is the typing of SNPs by specific matching of primer end bases. The basic principle is that two primers with different terminal bases respectively carry fluorescent linker sequences, and a large number of samples can be rapidly detected according to different fluorescent signals carried by amplified products, so that the genotype of the sample can be accurately judged. Since the advent of the KASP technology, the market was rapidly preempted with its ultra-high flexibility, accuracy and cost performance, and it has an important role in crop assisted breeding.

At present, no report on background selection by using co-dominant KASP markers is found in tobacco anti-leaf spot back cross transformation. The co-dominant specific KASP molecular marker based on the foreground donor parent and the background backcross parent is developed, so that the detection of the background recovery rate of the backcross individual plant can be realized rapidly, accurately, with low cost and high flux and automatically, and the directional improvement of the spot blight resistance of the main cured tobacco cultivated variety is accelerated.

Disclosure of Invention

The invention aims to solve the technical problem of providing SNP markers, primer combinations and methods for screening the background of tobacco No. 8 chromosome for resisting the spot wilt so as to promote the directional improvement of the tobacco with K326 for resisting the spot wilt.

In order to solve the technical problems, the invention provides a PCR primer combination for screening the background of tobacco breeding for resisting spot wilt, which comprises a first PCR primer group and/or a second PCR primer group;

the first PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 1-3; the second PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 4-6;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco;

the first PCR primer group is used for amplifying SNP locus of 638952bp on chromosome 8 of tobacco, the genotype of K326 tobacco at the locus is C, and the genotype of Polalta tobacco is T;

the second PCR primer group is used for amplifying SNP locus of 715449bp on chromosome 8 of tobacco, the genotype of K326 tobacco at the locus is A, and the genotype of Polalta tobacco is T;

wherein the position of the SNP site on the chromosome is determined based on the whole genome sequence of K326 tobacco.

The invention also provides a KASP primer combination for use in anti-spot wilt tobacco breeding background screening comprising a first KASP primer set and/or a second KASP primer set;

the first KASP primer group consists of three primers F1-1, F1-2 and R1, wherein F1-1 is formed by connecting a first tag sequence with a nucleotide sequence shown in SEQ ID NO. 1 in series from a 5 'end to a 3' end; f1-2 is formed by connecting a second tag sequence with a nucleotide sequence shown in SEQ ID NO. 2 in series from the 5 'end to the 3' end; the nucleotide sequence of R1 is shown as SEQ ID NO. 3;

the second KASP primer group consists of three primers F2-1, F2-2 and R2, wherein the F2-1 is formed by connecting a first tag sequence with a nucleotide sequence shown in SEQ ID NO. 4 in series from the 5 'end to the 3' end; f2-2 is formed by connecting a second tag sequence with a nucleotide sequence shown in SEQ ID NO. 5 in series from the 5 'end to the 3' end; the nucleotide sequence of R2 is shown as SEQ ID NO. 6;

the nucleotide sequences of the first tag sequence and the second tag sequence are different and are different from the tobacco genomic sequence;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco;

the first KASP primer group is used for amplifying an SNP locus of 638952bp on a tobacco chromosome 8, the genotype of K326 tobacco at the locus is C, and the genotype of Polalta tobacco is T;

the second KASP primer group is used for amplifying an SNP locus of 715449bp on a tobacco chromosome 8, wherein the genotype of K326 tobacco is A, and the genotype of Polalta tobacco is T;

wherein the position of the SNP site on the chromosome is determined based on the whole genome sequence of K326 tobacco.

The invention provides a kit comprising the above PCR primer combination or the above KASP primer combination.

In some embodiments of the invention, the kit comprises a KASP primer combination as described above and a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

the nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of a first tag sequence in the KASP primer group, and the 5' end of the first fluorescent probe is connected with a first fluorescent group; the nucleotide sequence of the first quenching probe is reversely complementary with the nucleotide sequence of the first tag sequence, and the 3' -end of the first quenching probe is connected with a quenching group;

the nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of a second tag sequence in the KASP primer group, and the 5' end of the second fluorescent probe is connected with a second fluorescent group; the nucleotide sequence of the second quenching probe is reversely complementary with the nucleotide sequence of the second tag sequence, and the 3' -end of the second quenching probe is connected with a quenching group.

In some embodiments of the invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM and the second fluorescent group is HEX.

The application of the PCR primer combination or the KASP primer combination or the kit in tobacco breeding for resisting spot wilt also belongs to the protection scope of the invention.

The invention provides a screening method of a tobacco breeding background for resisting spot wilt, which comprises the following steps:

a) Extracting DNA of tobacco with spot wilt resistance;

b) Performing PCR amplification on the DNA of the tobacco with the spot blight resistance by using the PCR primer group;

c) Detecting an amplification result, determining the genotype of the SNP locus of the anti-spot-wilt tobacco amplified by each PCR primer group, and screening the anti-spot-wilt tobacco with the SNP locus of K326 tobacco genotype;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco.

The invention also provides a screening method of the tobacco breeding background for resisting the spot wilt, which comprises the following steps:

a) Extracting DNA of tobacco with spot wilt resistance;

b) Adding the KASP primer group and the PCR premix to the DNA of the tobacco with the spot blight resistance, and carrying out KASP amplification;

the PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

the nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of a first tag sequence in the KASP primer group, and the 5' end of the first fluorescent probe is connected with a first fluorescent group; the nucleotide sequence of the first quenching probe is reversely complementary with the nucleotide sequence of the first tag sequence, and the 3' -end of the first quenching probe is connected with a quenching group;

the nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of a second tag sequence in the KASP primer group, and the 5' end of the second fluorescent probe is connected with a second fluorescent group; the nucleotide sequence of the second quenching probe is reversely complementary with the nucleotide sequence of the second tag sequence, and the 3' -end of the second quenching probe is connected with a quenching group;

c) Detecting fluorescent signals, determining genotypes of SNP loci amplified by the anti-spot wilt tobacco in each KASP primer group, and screening the anti-spot wilt tobacco with the SNP loci of K326 tobacco genotypes;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco.

In some embodiments of the invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT; the second tag sequence is GAAGGTCGGAGTCAACGGATT; the first fluorescent group is FAM and the second fluorescent group is HEX.

In some embodiments of the invention, in the KASP amplification,

the PCR system comprises: DNA template, KASP primer working solution and KASP-TF V4.0.2X Master Mix;

the PCR procedure was as follows: firstly, pre-denaturation at 95 ℃ for 15min; secondly, denaturation at 95 ℃ for 20s, 65-57 ℃ (1 ℃ for each cycle down) for 60s, for 9 cycles; third, denaturation at 95℃for 20s, renaturation at 57℃for 1min,32 cycles.

Experiments prove that the KASP primer group developed by the invention is utilized to carry out PCR amplification by taking the genomic DNA of tobacco to be detected as a template, then the PCR amplification product is subjected to genotyping by fluorescent signal detection, and the anti-spot wilt tobacco with backcross parent K326 tobacco No. 8 chromosome background can be rapidly and accurately screened by the genotyping result. Through SNP marker screening of continuous distribution on one chromosome, the whole chromosome can be ensured to only contain the backcross parent genotype. Compared with the traditional marker screening, the SNP-KASP primer set developed by the invention has the advantages of high accuracy, low cost, high detection efficiency and the like, and is suitable for large-scale screening of tobacco breeding with spot blight resistance. The identification method of the SNP-KASP primer group can be used for screening the tobacco breeding background against the spot wilt for early generation, greatly shortening the breeding period of the directed improvement of the spot wilt of K326 tobacco and improving the breeding efficiency.

The term "RTSW locus" or "antiplaque gene locus" as used herein refers to a DNA fragment comprising an RTSW gene that confers on tobacco plants the trait of resisting tobacco leaf blight, either in heterozygous or homozygous state. "RTSW gene" refers to a gene derived from the tobacco (N.alata) genome and conferring on a plant an anti-leaf spot trait.

Drawings

FIG. 1 shows the result of SNP genotyping using the 2 SNP-KASP primer sets of the invention. In the typing result of each primer group, the parent 1 genotype is typed after 2 Polalata homozygous donor parents are amplified, the parent 2 genotype is typed after 2K 326 homozygous recurrent parents are amplified, the heterozygous genotype is typed after 3 Polalata multiplied by K326 hybridization F1 generation are amplified, and negative ultra-pure water without DNA is amplified.

FIG. 2 is a result of chromosome 8 background screening of offspring segregating populations of tobacco for spot wilt using the 2 SNP-KASP primer sets of the invention. In the typing result of each primer group, the sample in the upper left virtual circle is Polalta homozygous genotype, the sample in the lower right virtual circle is K326 homozygous genotype, the sample in the middle diagonal position of the dotted circle is heterozygote, and the sample in the lower left virtual circle is unamplified sample. 384 samples contained 376 copies of the DNA sample of tobacco with resistance to spot wilt, 2 copies of the DNA sample of Polalta, 2 copies of the DNA sample of K326, 2 copies of the DNA sample of Polalta X K326F 1, and 2 copies of ultra pure water without DNA added (as a negative control).

Detailed Description

The present invention will be described in further detail with reference to examples. It will be apparent that the described embodiments are only some, but not all, embodiments of the invention.

The specific techniques or conditions not specified in the examples below are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The reagents or apparatus used were conventional products available commercially without the manufacturer's attention.

Tobacco material used in the following examples:

polalta is an anti-TSWV tobacco material comprising an antiplaque gene locus (RTSW locus), which has been described in the non-patent literature (Laskowska D,

A,2010.TSWV resistance in DH lines of tobacco(Nicotiana tabacum L.)obtained from a hybrid between‘Polalta’and/>

plant Breeding 129,731-3.). The public may obtain the tobacco material from a tobacco germplasm resource conservation unit.

K326 is a variety of cured tobacco cultivated in a main plant which does not contain an antiplaque gene locus (RTSP locus) and is disclosed in non-patent literature (Edwards et al, 2017,A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Bmc Genomics 18,448.). The public can obtain its reference genomic sequence from a website (https:// solgenomics. Net/organization/nicotiana_tabacum/genome), and can obtain the tobacco material from a tobacco germplasm resource conservation unit.

The F1 generation plants (K326X Pollta F1) obtained by crossing Pollta and K326 (female), the separation population (K326X Pollta BC7F 1) obtained by crossing K326 (female) back 7 generation, the spot wilt-resistant tobacco (individual 12 with the genotype of RTSP W/RTSW) without linkage encumbering obtained by screening K326X Pollta BC7F1, the separation population (K326X Pollta BC8F 1) obtained by crossing individual 12 (female) and K326 (female) back 1 generation are all made by the subject group, and are stored in the tobacco agricultural science institute of Yunnan province. Wherein, the screening process of the tobacco (single plant No. 12) with the anti-spot wilt disease is referred to as PCT/CN2021/129382, the international patent application with the invention of 'the tobacco plant with the anti-spot wilt disease without linkage encumbrance and the breeding method thereof', and the Chinese patent application with the invention of 202111311707.0, the invention of 'the molecular marker for screening the tobacco plant with the anti-spot wilt disease without linkage encumbrance and the application thereof', which are all incorporated herein by reference. The early research result shows that the agronomic characters of the tobacco with the spot blight resistance breaking the linkage encumbering have no obvious difference with K326, and the tobacco can be used for the breeding of the tobacco with the spot wilt resistance and formally enter a commercial breeding program.

The main reagents used in the following examples:

KASP-TF V4.0X Master Mix reagent (cat# LGC-KBS-1050-132) was purchased from LGC Biosearch company. The magnetic bead method universal genomic DNA extraction kit (product number DP 705) was purchased from Tiangen Biochemical technology Co., ltd.

EXAMPLE 1 acquisition of SNP markers for use in anti-Spot tobacco Breeding background screening

In order to obtain the anti-leaf spot tobacco with the chromosome background as consistent as possible with K326 except for the RTSP site from the filial generation and the backcross generation of Polalta and K326, the SNP marker for screening the breeding background of the anti-leaf spot tobacco needs to be developed. Therefore, we used donor parent Polalta, acceptor parent K326 and previously obtained tobacco resistant to leaf spot for marker development.

We performed whole genome re-sequencing of Polalta, K326 and anti-leaf spot tobacco (individual No. 12). The project sequencing platform is BGISEQ-500, and the sequencing strategy is PE100. Filtering the original data, comparing the reference genome of cultivated cigarettes, detecting SNP variation information, and filtering the obtained SNPs of the two parents (K326 and Polalta), thereby obtaining 50009 SNPs with high quality (GQ (quality value) > =40) between the two parents, and distributing the SNPs in all 24 chromosomes (table 1).

TABLE 1 SNP distribution of two parents and Single plant No. 12

/>

The sequencing result of single plant No. 12 shows that most SNP loci are heterozygous, and the characteristics of SNP genotypes accord with the characteristics of backcrossing. After 7 generations of backcrossing, more than 97% of the sites in the genome have been identical to the backcrossed parent K326. In addition to the 106 SNP heterozygous sites comprising the RTSW site on chromosome 12 (chr 12), there are 1257 SNP homozygous or heterozygous sites consistent with the donor parent Polalta, requiring the design of markers for selection in the next segregating population.

From the resequencing results, chromosome 8 (chr 8) contained a denser donor parental source fragment at its end, and 14 highly reliable SNPs were consecutively distributed at chromosomes 8 197201-1676680bp, approximately 1Mb in size (Table 2).

TABLE 2 distribution of SNP loci on chr8

Chromosome of the human body	Position of SNP site	K326	Polalta	Single plant No. 12
					chr8	197201	G	A	R
chr8	440278	A	C	M
					chr8	507629	C	A	M
chr8	515472	G	A	R
					chr8	572633	G	A	R
chr8	638952	C	T	Y
					chr8	715449	A	T	A
chr8	863674	C	T	Y
					chr8	891719	A	G	R
chr8	903514	G	A	R
					chr8	1052807	C	T	Y
chr8	1186561	A	C	M
					chr8	1543933	C	A	M
chr8	1676680	T	C	Y

R, M, Y in the table represents heterozygous genotypes, in particular r=a/G, M =a/C, Y =c/T. The position of the SNP site on chromosome 8 is determined based on the whole genome sequence of K326 tobacco. The whole genome sequence of K326 tobacco is described in https:// solgenomics.

To screen the exchange individuals from the segregating population, plants were finally obtained with the segment containing only recurrent parent K326 background, we selected 7 SNP loci to design SNP-KASP primer sets.

The 7 sets of SNP-KASP primers were screened using F1 generation plants obtained from two homozygous parents (K326 and Polalta) and their crosses, and DNA-free ultrapure water was used as negative control. The method comprises the following steps:

preparing KASP primer working solution: the upstream primers (first upstream primer, second upstream primer) were each taken at 12. Mu.L (100. Mu.M), the downstream primer was taken at 30. Mu.L (100. Mu.M), and the mixture was supplemented to 100. Mu.L with sterile ultra-pure water, and thoroughly mixed to obtain a KASP primer working solution.

PCR system: mu.L of the DNA template (about 30 ng/. Mu.L), 0.08. Mu. L, KASP-TF V4.0 2X Master Mix 2.5. Mu.L of KASP primer working solution (LGC Co., ltd., product No. LGC-KBS-1050-132) and 5. Mu.L of sterile ultra-pure water were used.

PCR procedure: firstly, pre-denaturation at 95 ℃ for 15min; secondly, denaturation at 95 ℃ for 20s, 65-57 ℃ (1 ℃ for each cycle down) for 60s, for 9 cycles; thirdly, denaturing for 20s at 95 ℃, renaturating for 1min at 57 ℃ for 32 cycles; preserving at 10 ℃.

The experiment was also performed with a blank (NTC) without DNA template added to the PCR system, and 1 blank was set for each primer set.

The PCR results were as follows: after the reaction, the obtained amplified product was subjected to fluorescent amplification by a fluorescent microplate detector (FLUOstar OPTIMA, BMGLabtech, germany), and the fluorescence signal data was read and the genotype was determined by using SNPviewer software. If fluorescence signal data of an amplification product of the tobacco to be detected is analyzed by SNPviewer software to be blue near an X axis, the genotype of the tobacco to be detected is a K326 parent type; if the fluorescence signal data of the amplification product of the tobacco to be detected is analyzed by SNPviewer software to be red near the Y axis, the genotype of the tobacco to be detected is a Polalta parent type; if the fluorescence signal data of the amplification product of the tobacco to be detected is analyzed by SNPviewer software to be green near the diagonal, the genotype of the tobacco to be detected is heterozygous; fluorescence signal data of the amplified product of the negative control was analyzed by SNPviewer software to appear black near the origin.

And the SNP typing result is screened to conform to the genotype, has good typing effect and is uniformly distributed on the chromosome. Finally, 2 SNP markers for background screening of the tobacco chromosome 8 with the resistance to the leaf spot are determined. The basic information of the KASP primer set for detecting these 2 SNP markers is shown in Table 3. The results of SNP genotyping using the 2 KASP primer sets are shown in FIG. 1.

TABLE 3 SNP-KASP primer set for chr8 chromosome background selection

The SNP-KASP primer set used for chr8 chromosome background selection consists of 2 primer sets, referred to as SNP-KASP primer set 1 and SNP-KASP primer set 2, respectively. Each primer set consists of 3 primers, including a first upstream primer, a second upstream primer, and a downstream primer, for amplifying one SNP site. The last base at the 3' end of the first upstream primer is the SNP genotype of K326, and the genotype is indicated by capital letters in brackets of the primer names; the last base at the 3' end of the second upstream primer is the SNP genotype of Polalta, which is indicated in lowercase letters in brackets of the primer names. In each primer set, the 5 'end of the first upstream primer contained FAM fluorescent tag sequence (GAAGGTGACCAAGTTCATGCT) (SEQ ID NO: 11) and the 5' end of the second upstream primer contained HEX fluorescent tag sequence (GAAGGTCGGAGTCAACGGATT) (SEQ ID NO: 12). The fluorescent tag sequences in the primers are underlined in table 3, and the non-underlined sequences are genome-specific sequences. The numbers in the primer names indicate the positions of the SNP sites amplified by the primer set on chromosome 8. Wherein SNP-KASP primer set 1 amplifies SNP locus at 638952bp of chromosome 8 and SNP-KASP primer set 2 amplifies SNP locus at 715449bp of chromosome 8. The position of the above SNP site on the chromosome was determined based on the whole genome sequence of K326 tobacco. The whole genome sequence of K326 tobacco is described in https:// solgenomics.

Example 2 verification of SNP markers for use in anti-Spot tobacco Breeding background screening

SNP markers obtained in example 1 for use in anti-spot tobacco chromosome 8 background screening were verified using the isolated population BC1F1 of individual No. 12 (i.e., K326X Polalata BC8F 1) obtained by backcrossing individual No. 12 with K326.

Plants containing the RTSW site were first screened from the K326 x Polalta BC8F1 population. And (3) carrying out spot blight resistance identification on 800 single plants of the K326X Polalta BC8F1 segregating population by utilizing a nontoxic gene infiltration identification method established in the earlier stage. The non-toxic gene infiltration identification method is a method for identifying tobacco resistance by using tomato spotted wilt virus NSm gene described in Chinese patent (patent No. ZL 20171040414455. X, entitled "method for identifying tobacco resistance by using tomato spotted wilt virus NSm gene"), the entire contents of which is incorporated herein by reference. The specific operation steps are as follows:

(1) Culturing Agrobacterium EHA105 containing nontoxic gene NSm expression vector in Agrobacterium tumefaciens culture medium LB at 28deg.C for 24 hr, centrifuging to collect thallus, and soaking with buffer (10 mmol/L MgCl) ₂ 10mmol/L MES,200 μmol/L acelyrinone) to an OD600 = 0.5 cell suspension;

(2) Injecting 9.5-10.5 microliter of thallus suspension from the back of tobacco plant into veins to form a visible infiltration spot by using a sterile syringe without needle; the inoculated tobacco plants were placed in an environment of 20-28 ℃ and 80% humidity, alternately subjected to continuous illumination for 16 hours and continuous darkness for 8 hours, and observed for a total of 72 hours.

(3) Observing that if a cell necrosis allergic reaction (Hypersensitive reaction, HR) induced by an identified strain containing an expression vector of a non-toxic gene NSm is generated on the tobacco test host, the tobacco test host is identified as a disease resistant variety relative to the non-toxic gene NSm.

NSm-mediated disease resistance identification results show that 415 strains among 800 strains of the K326×Polallta BC8F1 segregating population produce HR responses, namely TSWV resistant strains (expressed by RTSW), 380 strains do not produce HR responses, namely TSWV susceptible strains (expressed by RTSW), and the other 5 strains are not included in statistics because plant development is too small for HR detection.

From 415 HR positive plants, 376 plants were selected, and total DNA of each plant was extracted using a magnetic bead method universal genomic DNA extraction kit (Tiangen Biochemical technology Co., ltd., DP 705). The NSm mediated disease resistance identification result is verified by utilizing a spot wilt resistance marker NaChr3_59M (see International patent application No. PCT/CN2021/129382 and Chinese patent application No. 202111311707.0) which is developed earlier, and the result shows that only three strains in 376 strains are inconsistent with the NSm mediated disease resistance identification result, and the accuracy of the NSm mediated disease resistance identification method is more than 99.2%.

The DNA of 376 HR positive plants was subjected to KASP detection using the 2 SNP-KASP primer sets shown in Table 3 in example 1, with the F1 generation plants obtained by crossing the two homozygous parents (K326 and Polalta) as a control, and ultrapure water without DNA as a negative control. The KASP detection method is the same as in example 1. The results of the detection are shown in Table 4 and FIG. 2.

TABLE 4 SNP genotyping results for tobacco resistant to Spot wilt

/>

/>

/>

/>

/>

/>

/>

/>

In the table, the numbers 1 to 376 are DNA samples of 376 HR positive plants, the numbers 377 and 378 are DNA samples of Polalta, the numbers 379 and 380 are DNA samples of K326, the numbers 381 and 382 are DNA samples of Polalta X K326F 1, and the numbers 383 and 384 are ultrapure water without DNA (negative control). A represents a Polalta homozygous genotype; b represents a K326 homozygous genotype; h represents heterozygous; n represents negative; "? "means that the sample is not amplified. Pos indicates positive and Neg indicates negative.

The results showed that K326 homozygous genotype 177 strain and heterozygous genotype 197 strain were obtained by screening 376 individual strains of the isolated population using 2 SNP-KASP primer sets. The detection results of the SNP-KASP primer set 1 and the SNP-KASP primer set 2 are basically consistent, and the two markers in the same section are mutually verified, so that the accuracy is high.

To verify the accuracy of SNP markers, we selected 6 strains (numbered 11, 17, 24, 30, 102, 109) for resequencing, the project sequencing platform was BGISEQ-500, and the sequencing strategy was PE100. The obtained resequencing data was compared to high quality SNPs between parents by filtering the raw data, comparing the cultivated smoke reference genome, detecting SNP variation information, and obtaining the number of SNPs on chr8 for 6 individuals (table 5).

TABLE 5 resequencing results of 6 individuals identified by SNP-KASP primer set

	SNP number on chr8
		Single plant No. 12	14
Individual 12BC1F1-11	0
		Individual plant 12BC1F1-17	0
Individual 12BC1F1-24	0
		Individual 12BC1F1-30	0
Individual strain 12BC1F1-102	0
		Individual strain 12BC1F1-109	0

The result shows that the number of SNP (single nucleotide polymorphism) of 6 single plants obtained by screening is 0, wherein the SNP is consistent with the donor parent Polalta on chr8 chromosome. Therefore, it can be determined that the whole chr8 chromosome of the backcrossed single plant obtained by screening by using the SNP-KASP primer set 1 and the SNP-KASP primer set 2 is completely consistent with the backcrossed parent K326.

Therefore, the SNP-KASP primer group developed by the invention can effectively screen out the tobacco with the background of No. 8 chromosome of the backcross parent K326, has the advantages of reliability, simplicity, convenience and practicability, has important application prospect in tobacco germplasm resource evaluation and auxiliary selection of breeding marks, and provides reference basis for cultivating directionally improved tobacco varieties with high resistance to the leaf blight.

The above embodiments are only for illustrating the present invention, but should not be construed as limiting the scope of the present invention, and all equivalent changes and modifications that are made in accordance with the claims of the present invention shall fall within the scope of the present invention.

Claims (10)

1. The PCR primer combination for screening the background of tobacco breeding for resisting the spot wilt is characterized by comprising a first PCR primer group and/or a second PCR primer group;

the first PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 1-3; the second PCR primer group consists of three primers with nucleotide sequences shown as SEQ ID NO. 4-6;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco;

the first PCR primer group is used for amplifying SNP locus of 638952bp on chromosome 8 of tobacco, the genotype of K326 tobacco at the locus is C, and the genotype of Polalta tobacco is T;

the second PCR primer group is used for amplifying SNP locus of 715449bp on chromosome 8 of tobacco, the genotype of K326 tobacco at the locus is A, and the genotype of Polalta tobacco is T;

wherein the position of the SNP site on the chromosome is determined based on the whole genome sequence of K326 tobacco.

2. A KASP primer combination for use in screening a tobacco breeding background against spot wilt disease, comprising a first KASP primer set and/or a second KASP primer set;

the first KASP primer group consists of three primers F1-1, F1-2 and R1, wherein F1-1 is formed by connecting a first tag sequence with a nucleotide sequence shown in SEQ ID NO. 1 in series from a 5 'end to a 3' end; f1-2 is formed by connecting a second tag sequence with a nucleotide sequence shown in SEQ ID NO. 2 in series from the 5 'end to the 3' end; the nucleotide sequence of R1 is shown as SEQ ID NO. 3;

the second KASP primer group consists of three primers F2-1, F2-2 and R2, wherein the F2-1 is formed by connecting a first tag sequence with a nucleotide sequence shown in SEQ ID NO. 4 in series from the 5 'end to the 3' end; f2-2 is formed by connecting a second tag sequence with a nucleotide sequence shown in SEQ ID NO. 5 in series from the 5 'end to the 3' end; the nucleotide sequence of R2 is shown as SEQ ID NO. 6;

the nucleotide sequences of the first tag sequence and the second tag sequence are different and are different from the tobacco genomic sequence;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco;

the first KASP primer group is used for amplifying an SNP locus of 638952bp on a tobacco chromosome 8, the genotype of K326 tobacco at the locus is C, and the genotype of Polalta tobacco is T;

the second KASP primer group is used for amplifying an SNP locus of 715449bp on a tobacco chromosome 8, wherein the genotype of K326 tobacco is A, and the genotype of Polalta tobacco is T;

wherein the position of the SNP site on the chromosome is determined based on the whole genome sequence of K326 tobacco.

3. A kit comprising the PCR primer combination of claim 1 or the KASP primer combination of claim 2.

4. A kit according to claim 3, comprising the KASP primer combination of claim 2 and a PCR premix; the PCR premix comprises a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

the nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of a first tag sequence in the KASP primer group, and the 5' end of the first fluorescent probe is connected with a first fluorescent group; the nucleotide sequence of the first quenching probe is reversely complementary with the nucleotide sequence of the first tag sequence, and the 3' -end of the first quenching probe is connected with a quenching group;

the nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of a second tag sequence in the KASP primer group, and the 5' end of the second fluorescent probe is connected with a second fluorescent group; the nucleotide sequence of the second quenching probe is reversely complementary with the nucleotide sequence of the second tag sequence, and the 3' -end of the second quenching probe is connected with a quenching group.

5. The kit according to claim 4, wherein,

the first tag sequence is GAAGGTGACCAAGTTCATGCT;

the second tag sequence is GAAGGTCGGAGTCAACGGATT;

the first fluorescent group is FAM and the second fluorescent group is HEX.

6. Use of the PCR primer combination of claim 1 or the KASP primer combination of claim 2 or the kit of any one of claims 3-5 in tobacco breeding against spot blight.

7. The screening method of the tobacco breeding background for resisting the spot wilt is characterized by comprising the following steps of:

a) Extracting DNA of tobacco with spot wilt resistance;

b) Performing PCR amplification of the DNA of the anti-spot tobacco using the PCR primer set of claim 1;

c) Detecting an amplification result, determining the genotype of the SNP locus of the anti-spot-wilt tobacco amplified by each PCR primer group, and screening the anti-spot-wilt tobacco with the SNP locus of K326 tobacco genotype;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco.

8. The screening method of the tobacco breeding background for resisting the spot wilt is characterized by comprising the following steps of:

a) Extracting DNA of tobacco with spot wilt resistance;

b) Adding the KASP primer group and the PCR premix liquid in the method in the aspect 2 to the DNA of the tobacco with the spot blight resistance for KASP amplification;

the PCR premix contains a first fluorescent probe, a first quenching probe, a second fluorescent probe and a second quenching probe;

the nucleotide sequence of the first fluorescent probe is consistent with the nucleotide sequence of a first tag sequence in the KASP primer group, and the 5' end of the first fluorescent probe is connected with a first fluorescent group; the nucleotide sequence of the first quenching probe is reversely complementary with the nucleotide sequence of the first tag sequence, and the 3' -end of the first quenching probe is connected with a quenching group;

the nucleotide sequence of the second fluorescent probe is consistent with the nucleotide sequence of a second tag sequence in the KASP primer group, and the 5' end of the second fluorescent probe is connected with a second fluorescent group; the nucleotide sequence of the second quenching probe is reversely complementary with the nucleotide sequence of the second tag sequence, and the 3' -end of the second quenching probe is connected with a quenching group;

c) Detecting fluorescent signals, determining genotypes of SNP loci amplified by the anti-spot wilt tobacco in each KASP primer group, and screening the anti-spot wilt tobacco with the SNP loci of K326 tobacco genotypes;

the tobacco with the spot blight resistance is a filial generation of donor parent Polalta tobacco and acceptor parent K326 tobacco.

9. The method of claim 8, wherein the step of determining the position of the first electrode is performed,

the first tag sequence is GAAGGTGACCAAGTTCATGCT;

the second tag sequence is GAAGGTCGGAGTCAACGGATT;

the first fluorescent group is FAM and the second fluorescent group is HEX.

10. The method of claim 8, wherein in the KASP amplification,

the PCR system comprises: DNA template, KASP primer working solution and KASP-TF V4.0.2X Master Mix;

the PCR procedure was as follows: firstly, pre-denaturation at 95 ℃ for 15min; secondly, denaturation at 95 ℃ for 20s, 65-57 ℃ (1 ℃ for each cycle down) for 60s, for 9 cycles; third, denaturation at 95℃for 20s, renaturation at 57℃for 1min,32 cycles.

Images