CN106350515B - With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage - Google Patents
With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage Download PDFInfo
- Publication number
- CN106350515B CN106350515B CN201510420998.5A CN201510420998A CN106350515B CN 106350515 B CN106350515 B CN 106350515B CN 201510420998 A CN201510420998 A CN 201510420998A CN 106350515 B CN106350515 B CN 106350515B
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- rice
- gene
- resistance
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, specifically, being related to a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, which contains sequence shown in Seq ID No.1.The invention further relates to expand the purposes and a kind of rice breeding method of primer, the molecular labeling and the primer of the molecular labeling in Gene For Resistance To Rice Bacterial Blight positioning or Genetic and breeding in rice.Molecular labeling of the invention connects genomic dna sequence and Gene For Resistance To Rice Bacterial Blight, is conducive to the foundation of rice molecular marker-assisted breeding system；The hereditary close linkage of the molecular labeling and Gene For Resistance To Rice Bacterial Blight distance is 0.5cM.Molecular labeling and molecular labeling amplimer of the invention can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Description
Technical field
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, more particularly to a kind of and white leaf of Rice Resistance
The molecular labeling of blight gene close linkage.The invention further relates to the primer, the molecular labeling and the primers that expand the molecular labeling
Purposes in Gene For Resistance To Rice Bacterial Blight positioning or Genetic and breeding in rice.
Background technique
Rice (Oryza sativa) is one of most important cereal crops in China, and paddy is 60% or more population of China
Staple food.Therefore, the horizontal raising of Rice Production is always the significant problem that relationship China's agricultural development and the people's livelihood are stabilized.
Bacterial blight of rice is a kind of global important disease.It is a kind of vascular bundle diseases, under field conditions (factors), disease
Bacterium is usually invaded by water hole or wound, generates white scab along vein.Bacterial leaf-blight occur when can lead to the rice underproduction 20%~
30%, it even has no harvest when serious.To guarantee rice high yield, stable yields, people mainly use two kinds of Prevention Techniques, first is that anti-with chemistry
Method is controlled, second is that cultivating and planting disease-resistant variety.Since chemical prevention is at high cost and pollution environment, cultivates and plant disease-resistant
Kind becomes the main target of rice breeding.
Traditional breeding for disease resistance is selected according to the performance of segregating population and the experience of breeder, usually by environment item
The influence for the factors such as part, aobvious recessive relationship, gene be upper, it is time-consuming, laborious, inaccurate, from one Genes For Plant Tolerance disease of identification to training
Time more than ten years need to be spent by bringing out disease-resistant breeding, and pathogen once invades, and diffusion velocity is more faster than breeding speed.
The application of the development of biotechnology in recent years, especially molecular marking technique brings huge to Genetic and breeding in rice
Variation.Molecular marker assisted selection provides the effective means that selection is carried out to objective trait for breeder, it is greatly accelerated
Breeding process improves breeding selection efficiency, while reducing a large amount of wastes of blindly selection and human and material resources, shows pole
Its wide application prospect.
Current identified Bacterial blight resistance gene comes from long medicine wild rice (Oryza up to more than 30
Longistaminata the time of infertility of wide spectrum bacterial blight-resisting Xa21 gene and common wild-rice O.rufipogon) resists white
Leaf blight Xa23 gene is concerned.
Although currently, located some genes relevant to rice bacterial blight resistance and QTLs, due to Rice Resistance
The genetic mechanism of bacterial leaf-blight is more complex, still lacks sufficient amount of QTLs relevant to bacterial blight-resisting and molecular labeling.
With the development of genomics and biological information, by gene order-checking, exploitation and the SV of bacterial blight-resisting close linkage are marked,
New idea and method will be opened up for the genetic research of rice and breeding.
Summary of the invention
The object of the present invention is to provide a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labelings.
It is a further object of the present invention to provide a kind of points that can be used for expanding with Gene For Resistance To Rice Bacterial Blight close linkage
The primer pair of son label.
It is a further object of the present invention to provide a kind of molecular labelings for screening Gene For Resistance To Rice Bacterial Blight close linkage
Method, it is characterised in that: 1) obtain homozygous male parent, female parent gene group；2) sequencing obtains male parent, female parent gene group sequence respectively
Column；3) compare male parent, female parent gene group sequence, obtain difference site；4) it constructs genetic group and collects phenotypic data；5) to group
Individual in body carries out genotyping；6) genotype and phenotypic data are combined, in the genome by target gene positioning；7) exist
The molecular labeling candidate close to the section selection of target gene.The rice bacterial blight resistance molecular labeling of screening is further done more
State property and repeated pruning: in the upstream and downstream design primer of the molecular labeling of screening, PCR amplification is carried out, the difference of band is passed through
Carry out polymorphism judgement；Stability verifying is carried out using recombinant inbred lines.
The purpose of the present invention further includes a kind of detection method of the molecular labeling of rice bacterial blight resistance close linkage, including
Step: in the upstream and downstream design primer of the nucleotide sequence of molecular labeling；Expanded using being detected oryza sativa genomic dna as template
Increase；Judge in amplified production with the presence or absence of the molecular labeling.
The purpose of the present invention further includes providing a kind of recombinant vector including above-mentioned molecular labeling, and carry containing the recombination
The recombinant cell of body.
The purpose of purpose of the present invention further include provide above-mentioned molecular labeling Gene For Resistance To Rice Bacterial Blight positioning, detect with
And the detection method of the purposes and above-mentioned molecular labeling in rice assistant breeding.
To achieve the goals above, the invention adopts the following technical scheme:
The invention discloses a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, the molecular labeling packets
Sequence shown in the No.1 of ID containing Seq；The preferred molecular labeling has sequence shown in Seq ID No.1.
Draw for expanding with the molecular labeling of Gene For Resistance To Rice Bacterial Blight close linkage the invention also discloses a kind of
Object pair, sequence shown in the target sequence Seq ID No.1 of the primer pair amplifies.Specifically, the primer 1 of the primer pair includes
Sequence shown in Seq ID No.2, primer 2 include sequence shown in Seq ID No.3；More specifically, the primer 1 has Seq ID
Sequence shown in No.2, primer 2 have sequence shown in Seq ID No.3；
The invention discloses a kind of methods for screening claim rice bacterial blight resistance molecular labeling, it is characterised in that:
1) homozygous male parent, female parent gene group are obtained；2) sequencing obtains male parent, female parent gene group sequence respectively；3) compare male parent, female parent
Genome series, obtains difference site；4) it constructs genetic group and collects phenotypic data；5) gene is carried out to the individual in group
Type analysis；6) genotype and phenotypic data are combined, in the genome by target gene positioning；7) in the section close to target gene
Select candidate molecular labeling.Polymorphism and repeated pruning are further done to the rice bacterial blight resistance molecular labeling of screening:
In the upstream and downstream design primer of the molecular labeling of screening, PCR amplification is carried out, different by band carry out polymorphism judgement；Benefit
Stability verifying is carried out with recombinant inbred lines.In order to further verify this phenotype of bacterial blight-resisting with it is corresponding between molecular labeling
Relationship discloses rice leaf spot bacteria inoculation experiments result.The invention also discloses a kind of and Gene For Resistance To Rice Bacterial Blights
The molecular labeling of close linkage, the molecular labeling are to be with the oryza sativa genomic dna of bacterial blight-resisting by above-mentioned primer pair
Template is obtained through PCR amplification.
The invention also discloses a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular mark detection methods, including
Step: in the nucleotide sequence upstream and downstream design primer of molecular labeling Seq ID No.1, it is to be detected oryza sativa genomic dna
Template is expanded, using bacterial blight-resisting in the result of identical primer pair amplifies rice than not bacterial blight-resisting amplification
The big 382bp of molecule, this molecular size are the size of molecular labeling.Utilize preferred primer Seq ID No.2, Seq ID No.3
Expand the rice of bacterial blight-resisting and the rice genome of not bacterial blight-resisting, the size of amplified production be respectively 985bp,
603bp。
In one embodiment of the invention, it discloses and sequence verification is carried out to each amplified production with 3730 sequenators
Method, so those skilled in the art can use after carrying out PCR amplification it is understood that in order to detect Seq ID No.1 molecular labeling
The method that sequencing can also be used in electrophoresis detection is detected.It will be understood to those skilled in the art that detection molecules flag sequence
The method that whether there is is not limited to PCR gel electrophoresis, sequencing, and the methods of quantitative fluorescent PCR can also carry out target sequence detection.
Those skilled in the art it is also to be understood that detection target sequence the design of primers primer sequence that does not limit to and provide, in mesh
The upstream and downstream design primer for marking sequence carries out PCR amplification, can reach detected through gel electrophoresis or sequencing or quantitative fluorescent PCR
The purpose of detection.
The invention also discloses a kind of carriers, contain molecular labeling of the invention.The carrier can be inserted with this
The expression recombinant vector or clone's recombinant vector of the molecular labeling of invention.After obtaining above-mentioned recombinant vector, those skilled in the art
Member is appreciated that the size of the segment containing molecular labeling is different with the difference of design of primers position, while this field skill
Art personnel are appreciated that according to different needs, recombinant vector is transformed into suitable cell, obtain containing the recombinant vector
Recombinant cell.Therefore, the invention also discloses a kind of recombinant cells containing the recombinant vector.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in Seq ID No.1
DNA fragmentation) included Seq ID No.1 5 ' end and/or 3 ' end be operably connected have artificial sequence and/or control sequence
Column, such as promoter, enhancer, terminator, restriction enzyme site, primer sequence etc..Wherein, term " operationally " is in the present invention
In be defined as a kind of following conformation, in the conformation, control sequence such as promoter is appropriately placed the one of Seq ID No.1
On a position, so that the generation for the polypeptide that the control sequence instructs Seq ID No.1 to encode.
In one embodiment of the invention, the molecular labeling includes sequence and Seq shown in Seq ID No.1
5 ' the ends of ID No.1 and/or the upstream and downstream sequence at 3 ' ends.It will be understood by those skilled in the art that as long as amplification or detection are anti-
The molecular labeling in the oryza sativa genomic dna of bacterial leaf-blight, is necessarily able to detect or expands and obtain containing Seq ID No.1 institute
The sequence shown.The length of the upstream and downstream sequence at the 5 ' ends and/or 3 ' ends of Seq ID No.1 is suitable length, is not particularly limited,
For example, meet the length of molecular labeling less than 10,000bp, less than 5,000bp, less than 2,000bp, less than 1,500bp, be less than
1,200bp, it is less than 1,000bp or is less than 800bp.
The invention also discloses the preparation method of the molecular labeling, include the following steps: the water using bacterial blight-resisting
The genomic DNA of rice carries out PCR amplification, obtained 985bp as template, with Seq ID No.2 and Seq ID No.3 primer pair
Amplified production contains the molecular labeling；Preferably, further include the steps that purifying pcr amplification product.This field
Technical staff is appreciated that the PCR product size of the label containing molecule changes with the change of design of primers position.
To those skilled in the art, it will be understood that molecule of the invention can also be obtained in the chemically synthesized method of DNA
Label.
The invention also discloses purposes of the molecular labeling in Gene For Resistance To Rice Bacterial Blight is positioned or detected.
The invention also discloses a kind of methods of Gene For Resistance To Rice Bacterial Blight positioning, and the method includes using the present invention
Molecular labeling the step of.
The invention also discloses purposes of the molecular labeling in rice assistant breeding.
The invention also discloses a kind of rice auxiliary breeding means, the method includes detect molecular labeling of the invention or
The step of molecular labeling primer pair.
Molecular labeling of the invention can be used in molecular mark from now on, and those skilled in the art can manage
Solution, for example screen whether rice contains Bacterial blight resistance gene by detecting whether that there are molecular labelings of the invention.It is described
Specifically the primer pair of above-mentioned molecular labeling of the invention can be used in the method that detection can be PCR detection.The inspection
Survey can also be carried out by sequencing approach.The rice auxiliary breeding means have the advantages that easy, quick, high-throughput.
In the present invention, specifically, the rice is 801, bacterial blight-resisting；R15, not bacterial blight-resisting.801 and R15
Filial generation be F1.F1 generation is RIL group, i.e. F7 generation by the recombinant inbred lines that single seed descent obtains.
Beneficial effect
The present invention provides the molecular labeling with Gene For Resistance To Rice Bacterial Blight close linkage, the molecular labeling is by genome
DNA sequence dna is connected with Gene For Resistance To Rice Bacterial Blight, is conducive to the foundation of rice molecular marker-assisted breeding system；It is described
The hereditary close linkage of molecular labeling and Gene For Resistance To Rice Bacterial Blight distance is 0.5cM.Molecular labeling and molecule of the invention
Mark amplimer that can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Detailed description of the invention
Fig. 1: using molecular labeling primer (Seq ID No.2 and Seq ID No.3) to Parent and RIL group 188
Rice single plant carries out the part electrophoresis result figure of the amplified production of PCR amplification.Wherein:
Swimming lane 1-5 is the pcr amplification product of the rice single plant of 5 plants of bacterial blight-resistings in RIL group；Swimming lane 7-11 is
The pcr amplification product of 5 plants of not rice single plants of bacterial blight-resisting in RIL group.Swimming lane 6 is marker, is 2000bp DNA
Ladder；Its molecular weight includes:, 2000bp, 1000bp, 750bp, 500bp, 200bp and 100bp.
Term
As used herein, molecular labeling (Molecular Markers), which refers to, can reflect gene between bion or population
The DNA fragment specific of certain species diversity in group is the heredity mark based on inhereditary material inner nucleotide sequence variations
Note, is the direct reflection of DNA level genetic polymorphism.
Specific embodiment
Below by specific embodiment and in conjunction with attached drawing, invention is further described in detail.Following embodiment is only right
The present invention is further detailed, and should not be construed as limiting the invention.Particular technique or condition are not specified in embodiment
, according to the literature in the art described technology or conditions (such as write with reference to J. Pehanorm Brooker etc., what Huang Peitang etc. was translated
" Molecular Cloning:A Laboratory guide ", the third edition, Science Press) or carry out according to product description.Agents useful for same or instrument are not
Production firm person is indicated, being can be with conventional products that are commercially available, such as can purchase from Illumina company.
Embodiment 1: the building of rice RIL group
Rice paddy seed is purchased from: Shenzhen Huada Agriculture & Circular Economy Technology Co., Ltd..
Male parent: 801, bacterial blight-resisting；
It is maternal: R15, not bacterial blight-resisting；
Male parent and hybridization of female parent obtain F1 generation；
F1 generation passes on method by simple grain and obtains 188 recombinant inbred lines RIL groups (F7 generation).
Embodiment 2: rice leaf spot bacteria inoculated identification
The representative strain of Hunan Province's rice leaf spot bacteria advantage pathological form IV type bacterium is selected (to be studied by Hunan hybrid rice
It gives at center).Bacterial strain is cultivated 72 hours under the side of body 28 DEG C of constant temperature of Ben Zheshi potato semisynthetic medium, under sterile washing
Bacterial suspension is diluted to 108~109 cells/milliliter bacterium solution with wheat formula turbidimetry by lawn.Culture medium prescription: potato 300
Gram, 15 grams of sucrose, 5 grams of peptone, Ca (NO3)2.4H20.5 gram of O, Na2HPO4.12H22.0 grams of O, 16 grams of agar powder, distilled water
It is adjusted to 1000 milliliters.
It for the RIL group obtained in embodiment 1, is inoculated with, is inoculated with using artificial leaf-cutting inocalation method in plant seedling stage
14~20d afterwards, the investigation when susceptible variety state of an illness tends towards stability, the percentage for using lesion area to account for blade area are anti-as anti-sense
Answer parameter.This test is with 15% for anti-sense boundary, and>15% is susceptible, 10%~15% be it is disease-resistant,<10% is highly resistance.
It is inoculated with result: the disease-resistant sex expression of parents and RIL group
After leaf spot bacteria bacterium solution is inoculated with 20d, the average scab length of male parent 801 is 4.3cm, is shown as to bacterial leaf-blight
Resistant reaction.The average scab length of maternal R15 reaches 22.4cm, is typical susceptible reaction.188 recombinant inbred lines inoculations
Afterwards, the scab length of blade is in continuous normal distribution, average value in group from most short 2.8cm to longest 23.6cm
For 6.13cm, two-way over parent segregation is extremely obvious, and distributed area is extensive, shows genetics of quantitative characters feature.
RIL group is divided into bacterial blight-resisting and not bacterial blight-resisting single plant according to inoculation result.
Embodiment 3: the extraction of genomic DNA
Extract the genomic DNA of male parent, female parent, F1 generation and RIL group single plant respectively with CTAB method, the specific method is as follows:
(1) the fresh blade of 1.0g is weighed, shreds and is put into mortar, with 1.5 × CTAB of 3mL is added after liquid nitrogen grinding, is ground into
Homogenate is transferred in the centrifuge tube of 15mL, and 1.5 × CTAB of 1mL flushing is then added into mortar and is transferred in centrifuge tube again.After mixing
In 65 DEG C of water-bath 30min, during which slowly shake up frequently.
Wherein 1.5 × CTAB is formulated following (1L):
| CTAB | 15g |
| (pH is the Tris.Cl of 1mol/L | 75mL |
| 8.0) | |
| The EDTA of 0.5mol/L | 30mL |
| NaCl | 61.4g |
Add deionized water to be settled to 1L, uses the preceding mercaptoethanol that final concentration of 0.2% (2ml) is added.
(2) it is cooled to room temperature, isometric chloroform/isoamyl alcohol (24:1) is added, mixes gently, until subnatant becomes dark green
Color.
(3) 4200rpm is centrifuged 10min, and upper strata aqueous phase is moved on to new 15mL centrifuge tube, adds the anhydrous of 2 times of volume pre-coolings
Ethyl alcohol mixes static 5min.DNA is precipitated in -20 DEG C of placement 30min.
(4) 4200rpm is centrifuged 10min, discards supernatant, and 75% ethanol washing of 1mL is added and precipitates 1 time, it is dry to be inverted centrifuge tube
200 μ L TE dissolving DNAs are added in dry DNA.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) by the genomic DNA of obtained male parent, female parent, F1 generation and RIL group single plant be stored in -20 DEG C it is spare.
Embodiment 4: genetic map construction, the assignment of genes gene mapping and molecular markers development
(1) genetic map construction
For the genomic DNA of the RIL individual obtained in embodiment 3, using RAD-seq (http: //
Www.bioon.com.cn/server/show_product.asp? id=12291 genotyping technique) is to RIL group
Individual carries out Genotyping, obtains the genotype data of RIL group.
With 3.0 software of MapMaker (Constructing genetic maps with MAPMAKER/EXP 3.0, S
Lincoln, M Daly, E Lander-Cambridge, MA:Whitehead Institute, 1992) carry out genetic linkage map
Spectrum is drawn, and genetic linkage map is obtained.
(2) assignment of genes gene mapping
For RIL group in embodiment 2, a is denoted as by individual phenotype is similar with male parent type character, with maternal type character phase
As be denoted as b, character occupy and is denoted as h between male parent and female parent.The phenotypic data of all individuals is obtained, by the Phenotype Number of individual
It is compared according to the genotype data obtained before, so that Gene For Resistance To Rice Bacterial Blight is located in genetic linkage maps
On.The results show that Gene For Resistance To Rice Bacterial Blight is located in No. 11 chromosome 20802924bp to the section 20806518bp, it is long
Degree is about 3594bp.
(3) molecular markers development
Male parent and the maternal full-length genome that carries out respectively are resurveyed into sequence (10X), then according to the sequencing result of RAD-seq, benefit
It is compared and is sequenced with SOAP software (other sequence alignment programs also can be used in http://soap.genomics.org.cn/)
Then reads finds Parent genomic fragment sequence difference with SOAPsv (http://soap.genomics.org.cn/)
It is biggish to be used as molecular labeling, identify convenient for being distinguished with gel electrophoresis.
Select the 382bp diversity sequence of the section where the Gene For Resistance To Rice Bacterial Blight as candidate molecular marker SV3,
Nucleotide sequence is as shown in Seq ID No.1.
Seq ID No.1:
AGAGATGAGAGTGATCAGCTATGTACTGACTGCTTAAGAGTATATAGATGCAAGAGATGAAGGGCCTGT
TCACTTTGATGCCATTTTCAACCTTACCAAATTTTAGTAAAGTTGCTAAAAAAATGGCTATATTTAGTTTGCTGTCA
AATTTTGGTAACTATATAAGAAATCCTGCCAAAATTTTGATAACTATGCCAAAATTTGGTAAGGTTTTTTTTTGGCA
TCAAAGTGAACAGGCCCGAAAACTATATGATTGTATAAATTGCTACATTGCTTGCCTACCGGCAAGATTGGAGTGAT
CAAGGTTTATAACCACAGAACAGTAGTGAACAGTCAGGGTTGCACAATTGCACTTGTCTTTCACAACAAATGCAGAT
AAAAA
(382bp)
Embodiment 5: candidate molecular marker verifying
To the rice bacterial blight resistance candidate molecular marker SV3 (nucleic acid shown in SEQ ID NO:1 determined in embodiment 4
Sequence) it is verified, specific as follows:
For above-mentioned candidate molecular marker design primer, primer sequence is as follows:
Forward primer: 5 '-GCTTGTGCACAGCCACTTTG-3 ' (SEQ ID NO:2)；
Reverse primer: 5 '-GCATGCGGGTTGTTTTGATT-3 ' (SEQ ID NO:3).
Using above-mentioned primer, the candidate molecular marker are verified by PCR amplification and agarose gel electrophoresis detection more
State property and amplification stability.
Specifically, using extracted in embodiment 3 male parent, female parent, RIL group single plant genomic DNA as template, in utilization
It states amplimer and carries out PCR amplification, wherein
PCR reaction system is as follows:
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.It is saved at 4 DEG C after pcr amplification product is purified.
Then, part pcr amplification product is taken, is detected with 1% agarose gel electrophoresis, the result is shown in Figure 1.As shown in Figure 1, anti-
The single plant of bacterial leaf-blight amplifies the band of 985bp, and the single plant of bacterial blight-resisting does not amplify the band of 603bp.
Then, each amplified production is sequenced using 3730 sequenators, as a result, bacterial leaf spot resistant in male parent and RIL group
The single plant amplified band of disease, with not increasing 382bp's compared with the single plant amplified band of bacterial blight-resisting in maternal and RIL group
Sequence (nucleotide sequence is as shown in SEQ ID NO:1), as candidate molecular marker SV3.Thus, it was demonstrated that the candidate molecular marker
SV3 has polymorphism between Parent, which is closely related with rice bacterial blight resistance character, and with
The stability of Bacterial blight resistance gene linkage inheritance.
Candidate molecular marker has polymorphism, the stability with Bacterial blight resistance gene linkage inheritance, so the candidate point
The molecular labeling that son label can be used as Bacterial blight resistance gene uses.Polymorphism refers to: molecular labeling is in bacterial leaf spot resistant and not
Sequence in bacterial blight-resisting rice genome is different, can distinguish.
Embodiment 6: the preparation of molecular labeling
With the genomic DNA of the single plant of the water resistant bacterial blight of rice in the male parent gene group extracted in embodiment 3 or RIL group
For template, PCR amplification is carried out using the primer pair in embodiment 5.
PCR reaction system is as follows:
| Sterile water | 20.2μl |
| 10*Buffer (contains Mg2+) | 2.5μl |
| dNTPs(25mM) | 0.15μl |
| Taq enzyme (5U/ μ l) | 0.15μl |
| Forward primer | 0.5μl |
| Reverse primer | 0.5μl |
| Template | 1.0μl |
| Total volume | 25μl |
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.It is saved at 4 DEG C after pcr amplification product is purified.
Amplified production is purified, the nucleotide sequence containing molecular labeling of 985bp is obtained.It is sequenced, is tied after purification
Fruit is as shown in SEQ ID NO:4.
The amplified production (sequence as shown in SEQ ID NO:4) includes sequence and Seq ID shown in Seq ID No.1
5 ' the ends of No.1 and/or the upstream and downstream sequence at 3 ' ends.As long as it will be understood by those skilled in the art that expanding or detecting anti-Bai Ye
The molecular labeling in the oryza sativa genomic dna of blight, is necessarily able to detect or expands and obtain containing shown in Seq ID No.1
Sequence.The length of the upstream and downstream sequence at the 5 ' ends and/or 3 ' ends of Seq ID No.1 is suitable length, is not particularly limited, example
Such as, meet the length of molecular labeling less than 10,000bp, less than 5,000bp, less than 2,000bp, less than 1,500bp, less than 1,
200bp, it is less than 1,000bp or is less than 800bp.
The Seq ID that the molecular labeling (DNA fragmentation containing nucleotide sequence shown in Seq ID No.1) is included
5 ' the ends and/or 3 ' ends of No.1 are operably connected and have artificial sequence and/or control sequence, such as promoter, enhancer, termination
Son, restriction enzyme site, primer sequence etc..Wherein, term " operationally " is defined as a kind of following conformation in the present invention, at this
In conformation, control sequence such as promoter is appropriately placed on a position of Seq ID No.1, so that the control sequence refers to
Lead the generation of the polypeptide of Seq ID No.1 coding.
To those skilled in the art, it will be understood that the molecule mark can also be obtained by the chemically synthesized method of DNA
Note.
SEQ ID NO:4
GCTTGTGCACAGCCACTTTGTCAGGTAGACATCATCAGCAGATAGCTCATATGGCAAGTTTTGTGATGA
GTACCAATTGACCTGAAATTCAACTTGAATTGTAAGATGTTAATCTAGTCATGGTAAGGTAACTCTGTACCAGGATT
GTTAACAGAAAACATGTATGGTGAACTTTGTGAAGTTCATACCATGAGCTTAACTTTGTCAGACTCTTTTAACTTGC
TGCCCAAACACAGACAGGTCATGATTGAGGACAGTTTGTTAAGAGTACAAATTCAGCCACTTTGAGTGATCAGCTAT
GTACTGACTGCTTAAGAGTATATAGATGCAAGAGATGAGAGTGATCAGCTATGTACTGACTGCTTAAGAGTATATAG
ATGCAAGAGATGAAGGGCCTGTTCACTTTGATGCCATTTTCAACCTTACCAAATTTTAGTAAAGTTGCTAAAAAAAT
GGCTATATTTAGTTTGCTGTCAAATTTTGGTAACTATATAAGAAATCCTGCCAAAATTTTGATAACTATGCCAAAAT
TTGGTAAGGTTTTTTTTTGGCATCAAAGTGAACAGGCCCGAAAACTATATGATTGTATAAATTGCTACATTGCTTGC
CTACCGGCAAGATTGGAGTGATCAAGGTTTATAACCACAGAACAGTAGTGAACAGTCAGGGTTGCACAATTGCACTT
GTCTTTCACAACAAATGCAGATAAAAACGCAGGCCAACACAACGAGAACTTCAGGTCCAGAAAGGCCAACTCCATTA
TATGCTTCAAAACCTAAACAAGTCAATATCTGTACTACGCAGTAAGCACCTGCATCAGCACTCAGCAGCGCTTCAAG
TAGTTCACACTTGCAGACGACCTTATACCCATCAGAACCAAATAGAGTATATACTTAGTCAGCATATCTTAGGATTC
TAACTAGGCATCAGCAGATAGCATAGAACAACACCAACACTAAATTGTCAATCAAAACAACCCGCATGC
Both ends of them overstriking italicized item (each 20bp) is design of primers section, and intermediate overstriking italicized item (382bp) is
Molecular labeling SV3 sequence (i.e. SEQ ID NO:1).
Embodiment 7: molecular marker clone
The segment for expanding the 985bp of acquisition in embodiment 6 is cloned into pMD18-T carrier, recombinant vector is obtained.It should
Recombinant vector is transformed into e. coli jm109, chooses monoclonal, and culture obtains recombinant cell.Plasmid is extracted from recombinant cell,
Plasmid, that is, the recombinant vector carries out cloned sequence using M13 universal primer (sequence information refers to TaKaRa goods catalogue)
Sequencing, the results show that containing molecular labeling (Seq ID No.1) of the invention in recombinant vector.Above-mentioned clone, conversion, culture,
Plasmid extract and etc. refer to " the Molecular Cloning:A Laboratory guide third edition ", Huang Peitang etc. is translated, and Science Press's in September, 2002 goes out
Version.
The above content is specific embodiment is combined, further detailed description of the invention, and it cannot be said that this hair
Bright specific implementation is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, it is not taking off
Under the premise of from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to protection of the invention
Range.
Claims (9)
1. a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, it is characterised in that: the molecular labeling is Seq
Sequence shown in ID No.1.
2. a kind of primer pair that can be used for expanding with the molecular labeling of Gene For Resistance To Rice Bacterial Blight close linkage, it is characterised in that
The target sequence of amplification is sequence shown in Seq ID No.1；The primer 1 of the primer pair is sequence shown in Seq ID No.2, is drawn
Object 2 is sequence shown in Seq ID No.3.
3. a kind of method for screening molecular labeling described in claim 1, it is characterised in that: 1) obtain homozygous male parent, female parent
Genome；2) sequencing obtains male parent, female parent gene group sequence respectively；3) compare male parent, female parent gene group sequence, obtain difference position
Point；4) it constructs genetic group and collects phenotypic data；5) genotyping is carried out to the individual in group；6) combine genotype and
Phenotypic data, in the genome by target gene positioning；7) molecular labeling candidate in the section selection close to target gene,
The upstream and downstream of candidate molecular labeling designs primer as claimed in claim 2, carries out PCR amplification.
4. the detection method of molecular labeling described in claim 1, comprising steps of the nucleosides of the molecular labeling in claim 1
The upstream and downstream design primer of acid sequence；It is expanded using being detected oryza sativa genomic dna as template；Judge in amplified production whether
There are the molecular labelings；The primer is primer pair as claimed in claim 2.
5. a kind of carrier, it is characterised in that: contain molecular labeling described in claim 1.
6. a kind of recombinant cell, it is characterised in that: contain the carrier described in claim 5.
7. the molecular labeling primer of molecular labeling described in claim 1 or claim 2 is in rice assistant breeding or water
Purposes in the positioning of rice Bacterial blight resistance gene or detection.
8. a kind of method of Gene For Resistance To Rice Bacterial Blight positioning, it is characterised in that: the method includes using in claim 1
The step of the molecular labeling primer pair of the molecular labeling or claim 2.
9. a kind of rice auxiliary breeding means, it is characterised in that: the method includes molecule marks described in detection claim 1
Note or with the molecular labeling primer of claim 2 to detecting the step of.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510420998.5A CN106350515B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510420998.5A CN106350515B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106350515A CN106350515A (en) | 2017-01-25 |
| CN106350515B true CN106350515B (en) | 2019-03-01 |
Family
ID=57842226
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510420998.5A Active CN106350515B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106350515B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108165660A (en) * | 2018-03-16 | 2018-06-15 | 深圳盛宝联合谷物股份有限公司 | The molecular labeling and its screening technique of QTL close linkages related to rice meal taste |
-
2015
- 2015-07-16 CN CN201510420998.5A patent/CN106350515B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GenBank登录号：AC134624.4;Sharma,T.R. 等;《NCBI》;20040827;参见序列部分 * |
| 水稻抗白叶枯病基因Xa21的分子标记检测;马忠友 等;《天津农业科学》;20071231;第13卷(第3期);第7-8页 * |
| 白叶枯病抗性基因Xa21分子标记检测与表型鉴定的选育效果评价;陆永法 等;《浙江农业学报》;20051231;第17卷(第6期);第346-349页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106350515A (en) | 2017-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281A (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN113151553A (en) | Molecular marker coseparated with gene Clbl of watermelon plant few lateral branches and application | |
| WO2015143867A1 (en) | Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| CN107674922A (en) | Cucumber anti cucumber mosaic virus ospc gene cmv InDel marks and its application | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN109735648A (en) | A kind of method and its dedicated kit for screening different mass of 1000 kernel wheats | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350580A (en) | Molecular marker OSb1b-SV2 closely linked with genes of resistant bacterial blight of rice | |
| CN106350514B (en) | With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage | |
| CN106350513B (en) | With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN109797234A (en) | With the molecular labeling R060939-2 of resistance gene of rice blast Pi2 close linkage | |
| CN116814846B (en) | Molecular marker linked with salt-tolerant gene qSST4 of Dongxiang ordinary wild rice and application thereof | |
| CN108660233A (en) | A kind of molecular labeling SIsv0456 with millet anti-imazethapyr herbicide resistance gene close linkage | |
| CN109321670A (en) | The molecular labeling of rice number of grain per ear gene NOG1 and its application | |
| CN108660230A (en) | A kind of molecular labeling SIsv0163 with millet anti-imazethapyr herbicide resistance gene close linkage | |
| CN116574829B (en) | Molecular marker linked with rice mesocotyl elongation gene qML3 and application thereof | |
| CN102807981B (en) | With the closely linked molecular labeling SIsv0503 of millet fertile gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180312 Address after: 11, 8 floor, Beishan Industrial Zone, Yantian District, Guangdong, Shenzhen 518083, China Applicant after: Shenzhen Huada Sansheng Garden Technology Co., Ltd. Applicant after: Shenzhen Huada Academy of life science Applicant after: SHENZHEN BIOLOGY BREEDING INNOVATION INSTITUTE, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Address before: 518083 Guangdong Shenzhen City, Yantian District, North Mountain Road No. 146 Beishan industrial complex building science and Technology Park 604 Applicant before: SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY CO., LTD. Applicant before: BGI-Shenzhen |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |