CN106350513B - With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage - Google Patents
With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage Download PDFInfo
- Publication number
- CN106350513B CN106350513B CN201510420975.4A CN201510420975A CN106350513B CN 106350513 B CN106350513 B CN 106350513B CN 201510420975 A CN201510420975 A CN 201510420975A CN 106350513 B CN106350513 B CN 106350513B
- Authority
- CN
- China
- Prior art keywords
- molecular labeling
- rice
- gene
- resistance
- bacterial blight
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, specifically, being related to a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, which contains sequence shown in Seq ID No.1.The invention further relates to expand the purposes and a kind of rice breeding method of primer, the molecular labeling and the primer of the molecular labeling in Gene For Resistance To Rice Bacterial Blight positioning or Genetic and breeding in rice.Molecular labeling of the invention connects genomic dna sequence and Gene For Resistance To Rice Bacterial Blight, is conducive to the foundation of rice molecular marker-assisted breeding system；The hereditary close linkage of the molecular labeling and Gene For Resistance To Rice Bacterial Blight distance is 0.2cM.Molecular labeling and molecular labeling amplimer of the invention can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Description
Technical field
The invention belongs to molecular biology fields, are related to a kind of molecular labeling, more particularly to a kind of and white leaf of Rice Resistance
The molecular labeling of blight gene close linkage.The invention further relates to the primer, the molecular labeling and the primers that expand the molecular labeling
Purposes in Gene For Resistance To Rice Bacterial Blight positioning or Genetic and breeding in rice.
Background technique
Bacterial blight of rice is a kind of global important disease.It is a kind of vascular bundle diseases, under field conditions (factors), disease
Bacterium is usually invaded by water hole or wound, generates white scab along vein.Bacterial leaf-blight occur when can lead to the rice underproduction 20%~
30%, it even has no harvest when serious.To guarantee rice high yield, stable yields, people mainly use two kinds of Prevention Techniques, first is that anti-with chemistry
Method is controlled, second is that cultivating and planting disease-resistant variety.Since chemical prevention is at high cost and pollution environment, cultivates and plant disease-resistant
Kind becomes the main target of rice breeding.
Traditional breeding for disease resistance is selected according to the performance of segregating population and the experience of breeder, usually by environment item
The influence for the factors such as part, aobvious recessive relationship, gene be upper, it is time-consuming, laborious, inaccurate, from one Genes For Plant Tolerance disease of identification to training
Time more than ten years need to be spent by bringing out disease-resistant breeding, and pathogen once invades, and diffusion velocity is more faster than breeding speed.
The application of the development of biotechnology in recent years, especially molecular marking technique brings huge to Genetic and breeding in rice
Variation.Molecular marker assisted selection provides the effective means that selection is carried out to objective trait for breeder, it is greatly accelerated
Breeding process improves breeding selection efficiency, while reducing a large amount of wastes of blindly selection and human and material resources, shows pole
Its wide application prospect.
Although currently, located some genes relevant to rice bacterial blight resistance and quantitative trait locus
(quantitative trait locus, QTLs) such as comes from the wide spectrum of long medicine wild rice (Oryza longistaminata)
Bacterial blight-resisting Xa21 gene, time of infertility bacterial blight-resisting Xa23 gene of common wild-rice O.rufipogon etc., but due to
The genetic mechanism of rice bacterial blight resistance is more complex, still lacks sufficient amount of QTLs relevant to Resistance to bacterial blight and divides
Son label.With the development of genomics and biological information, by gene order-checking, exploitation and bacterial blight-resisting close linkage
Molecular labeling will open up new idea and method for the genetic research of rice and breeding.
Summary of the invention
The object of the present invention is to provide a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labelings.
It can be used for PCR amplification and Gene For Resistance To Rice Bacterial Blight close linkage it is a further object of the present invention to provide a kind of
The primer pair of molecular labeling, and the molecular labeling obtained by the primer pair amplifies.
Another object of the present invention is to provide above-mentioned molecular labeling in Gene For Resistance To Rice Bacterial Blight positioning, detection and paddy
The detection method of purposes and above-mentioned molecular labeling in sub- assistant breeding.
The purpose of the present invention further includes providing a kind of recombinant vector including above-mentioned molecular labeling, and carry containing the recombination
The recombinant cell of body；There is provided a kind of includes using the localization method of the rice bacterial leaf spot resistant gene of above-mentioned molecular labeling, and use
The rice auxiliary breeding means of the molecular labeling.
To achieve the goals above, the invention adopts the following technical scheme:
The invention discloses a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, the molecular labeling contains
There is nucleotide sequence shown in Seq ID No.1；Preferably, the molecular labeling is nucleotide sequence shown in Seq ID No.1.
The invention also discloses the primer pair of a kind of amplification and the molecular labeling of Gene For Resistance To Rice Bacterial Blight close linkage,
The target sequence of the primer pair amplifies includes sequence shown in Seq ID No.1；
In one embodiment of the invention, the primer 1 of the primer pair contains nucleotides sequence shown in Seq ID No.2
Column, primer 2 contain nucleotide sequence shown in Seq ID No.3.
In another embodiment of the present invention, the primer 1 is nucleotide sequence shown in Seq ID No.2, described to draw
Object 2 is nucleotide sequence shown in Seq ID No.3.
The invention also discloses a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, the molecular labelings
It is to be obtained using the oryza sativa genomic dna of bacterial blight-resisting as template through PCR amplification by above-mentioned primer pair.
Nucleotide sequence shown in Seq ID No.1 is preferably contained as the molecular labeling that above-mentioned primer pair amplifies obtain.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in Seq ID No.1
DNA fragmentation) for the DNA fragmentation of nucleotide sequence shown in Seq ID No.1 in rice genome, that is, the Seq ID for being included
5 ' the ends of No.1 and/or the nucleotide sequence other than 3 ' ends are also the sequence in rice genome, it is preferred that are rice genome
5 ' the ends of middle Seq ID No.1 and/or the upstream and downstream sequence at 3 ' ends.As long as it will be understood by those skilled in the art that amplification or
The molecular labeling in the oryza sativa genomic dna of anti-hoja blanca is detected, is necessarily able to detect or expands and obtain containing Seq ID
Sequence shown in No.1.The length of the upstream and downstream sequence at the 5 ' ends and/or 3 ' ends of Seq ID No.1 is suitable length, not special
Do not limit, for example, meet the length of molecular labeling less than 10,000bp, less than 5,000bp, less than 2,000bp, less than 1,
500bp, it is less than 1,200bp, is less than 1,000bp, is less than 800bp or is less than 500bp.
In one embodiment of the invention, the molecular labeling (contains nucleotide sequence shown in Seq ID No.1
DNA fragmentation) included Seq ID No.1 5 ' end and/or 3 ' end be operably connected have artificial sequence and/or control sequence
Column, such as promoter, enhancer, terminator, restriction enzyme site, primer sequence etc..Wherein, term " operationally " is in the present invention
In be defined as a kind of following conformation, in the conformation, control sequence such as promoter is appropriately placed the one of Seq ID No.1
On a position, so that the generation for the polypeptide that the control sequence instructs Seq ID No.1 to encode.
The invention also discloses a kind of carriers, contain molecular labeling of the invention.The carrier can be inserted with this
The expression recombinant vector or clone's recombinant vector of the molecular labeling of invention.After obtaining above-mentioned recombinant vector, those skilled in the art
Member obtains the weight containing the recombinant vector it is appreciated that according to different needs, recombinant vector is transformed into suitable cell
Group cell.Therefore, the invention also discloses a kind of recombinant cells containing the recombinant vector.
The invention also discloses the preparation methods of molecular labeling of the invention, include the following steps: using bacterial blight-resisting
Oryza sativa genomic dna as template, PCR amplification is carried out with above-mentioned primer pair, obtained amplified production contains the molecule
Label；Preferably, further include the steps that purifying pcr amplification product.
To those skilled in the art, it will be understood that molecule of the invention can also be obtained in the chemically synthesized method of DNA
Label.
The invention also discloses the detection methods of molecular labeling of the invention, comprising steps of according to above-mentioned molecular labeling
Nucleotide sequence design primer is expanded as template using being detected oryza sativa genomic dna, and judges whether deposit in amplified production
In the molecular labeling.Preferably, the primer is the above-mentioned primer pair respectively containing Seq ID No.2 and Seq ID No.3.
For example, can be using the genomic DNA of detected rice as template, with above-mentioned primer (Seq ID No.2 and Seq ID
No.3 PCR amplification) is carried out, amplified production is obtained.Obtained amplified production can be carried out to sequencing or gel electrophoresis.
Invention additionally discloses the molecular labelings or the molecular labeling primer to fixed in Gene For Resistance To Rice Bacterial Blight
Purposes in position or detection.
The invention also discloses a kind of methods of Gene For Resistance To Rice Bacterial Blight positioning, and the method includes using the present invention
Molecular labeling or molecular labeling primer pair step.
The invention also discloses the molecular labelings or the molecular labeling primer in rice assistant breeding
Purposes.
The invention also discloses a kind of rice auxiliary breeding means, the method includes detect molecular labeling of the invention or
The step of with molecular labeling primer of the invention to detecting.
Molecular labeling of the invention can be used in molecular mark from now on, and those skilled in the art can manage
Solution, for example screen whether rice contains Bacterial blight resistance gene by detecting whether that there are molecular labelings of the invention.It is described
Specifically the primer pair of above-mentioned molecular labeling of the invention can be used in the method that detection can be PCR detection.The inspection
Survey can also be carried out by sequencing approach.The rice auxiliary breeding means have the advantages that easy, quick, high-throughput.
Due to using the technology described above, the beneficial effect for having the present invention is:
The present invention provides the molecular labeling with Gene For Resistance To Rice Bacterial Blight close linkage, the molecular labeling is by genome
DNA sequence dna is connected with Gene For Resistance To Rice Bacterial Blight, is conducive to the foundation of rice molecular marker-assisted breeding system；It is described
The hereditary close linkage of molecular labeling and Gene For Resistance To Rice Bacterial Blight distance is 0.2cM.Molecular labeling and molecule of the invention
Mark amplimer that can be applied to rice breeding practice and resource and cultivar identification easy, quick, with high throughput.
Detailed description of the invention
Fig. 1: molecular labeling primer (Seq ID No.2 and Seq ID No.3) expands 188 rice single plants in RIL group
The part electrophoresis detection result of increasing.Wherein:
Swimming lane 1-5 is the pcr amplification product of the single plant of 5 plants of bacterial blight-resistings in RIL group；Swimming lane 7-11 is RIL groups
The pcr amplification product of 5 plants of not single plants of bacterial blight-resisting in body.Swimming lane 6 is marker, is 2000bp DNA Ladder；Its
Molecular weight includes: 2000bp, 1000bp, 750bp, 500bp, 200bp and 100bp.
Specific embodiment
A kind of molecular labeling the invention discloses primer pair and with Gene For Resistance To Rice Bacterial Blight close linkage
OSblb-SV1.Using primer pair of the invention, PCR is carried out by template of oryza sativa genomic dna, it is available white with Rice Resistance
The molecular labeling of leaf blight gene close linkage, the molecular labeling are named as molecular labeling OSblb-SV1 in the present invention.It needs
, it is noted that it will be understood by those skilled in the art that being obtained except through above-mentioned PCR amplification outside molecular labeling of the invention, also
Molecular labeling of the invention can be obtained by chemical synthesis.
Primer pair of the invention contains nucleotide sequence shown in ordered list Seq ID No.2 and Seq ID No.3 respectively,
Forward primer: 5 '-CAAGTGTGCCAACAAGTTGC-3 ' (Seq ID No.2)
Reverse primer: 5 '-CCACTTAGCTTGTTGGATATG-3 ' (Seq ID No.3)
Those skilled in the art are known, can in the nucleotide sequence shown in above-mentioned Seq ID No.2 and Seq ID No.3
Increase separately 1~10 base at its 5 ' end or 3 ' ends, the increased base type of institute can according on oryza sativa genomic dna with Seq
ID No.2 and Seq ID No.3 match region base type and determined according to basepairing rule, it is thus obtained to draw
Essentially identical (the DNA sequence dna between upstream and downstream primer of amplified production of object pair and Seq ID No.2 and Seq ID No.3
It is identical).Therefore, above-mentioned to increase separately 1~10 base and energy at the 5 ' ends of Seq ID No.2 and Seq ID No.3 or 3 ' ends
Amplification obtains the primer pair of essentially identical DNA fragmentation, is included in primer pair of the invention.In the specific embodiment party of the present invention
In formula, primer pair of the invention is preferably nucleotide sequence shown in Seq ID No.2 and Seq ID No.3.The present invention is by male parent
The homozygote hybridization of bacterial blight-resisting and maternal not bacterial blight-resisting, obtains F1 generation, F1 generation obtains RIL group by single seed descent
(F7 generation), totally 188 single plants.SV molecular markers development method is preferably used, full base is carried out respectively to male parent and female parent first
Because group resurveys sequence (10X)；Then according to Parent sequencing data, using Hua Da independent development SOAP comparison Parent it
Between sequence difference；Genotyping is carried out based on individual of the genotyping technique of RAD-seq to RIL group, obtains RIL group
Genotype data；Genetic map drafting is carried out with Map Maker3.0 software, obtains genetic linkage map；It is obtained using inocalation method
The phenotypic data of male parent, female parent and RIL group；Phenotypic data is compared with genotype data, so that Rice Resistance is white
The leaf blight assignment of genes gene mapping is on genetic linkage maps；Then, in conjunction with the diversity sequence between Parent as a result, and Rice Resistance it is white
The positioning result of leaf blight gene is screening candidate molecular marker close to section where Gene For Resistance To Rice Bacterial Blight；Finally, right
Candidate molecular marker is verified, and molecular labeling OSblb-SV1 of the invention is obtained.
Below by specific embodiment and in conjunction with attached drawing, invention is further described in detail.Following embodiment is only right
The present invention is further detailed, and should not be construed as limiting the invention.Particular technique or condition are not specified in embodiment
, according to the literature in the art described technology or conditions (such as write with reference to J. Pehanorm Brooker etc., what Huang Peitang etc. was translated
" Molecular Cloning:A Laboratory guide ", the third edition, Science Press) or carry out according to product description.Agents useful for same or instrument are not
Production firm person is indicated, being can be with conventional products that are commercially available, such as can purchase from Illumina company.
Embodiment 1: the building of rice RIL group
Male parent: 801, bacterial blight-resisting is purchased from Shenzhen Huada Agriculture & Circular Economy Technology Co., Ltd..
Maternal: R15, bacterial blight-resisting, is not purchased from Shenzhen Huada Agriculture & Circular Economy Technology Co., Ltd..
RIL informative population: male parent and hybridization of female parent obtain F1 generation, and F1 generation obtains 188 recombinations by single seed descent and is selfed
It is RIL strain (F7 generation).
Embodiment 2: rice leaf spot bacteria inoculated identification
The representative strain of Hunan Province's rice leaf spot bacteria advantage pathological form IV type bacterium is selected (to be studied by Hunan hybrid rice
It gives at center).Bacterial strain is cultivated 72 hours under the side of body 28 DEG C of constant temperature of Ben Zheshi potato semisynthetic medium, under sterile washing
Bacterial suspension is diluted to 10 with wheat formula turbidimetry by lawn8~109Cell/milliliter bacterium solution.
Side of body Ben Zheshi potato semisynthetic medium formula: 300 grams of potato, 15 grams of sucrose, 5 grams of peptone, Ca (NO3)
0.5 gram of 2.4H2O, 2.0 grams of Na2HPO4.12H2O, 16 grams of agar powder, 1000 milliliters are adjusted to distilled water.
It for the RIL group obtained in embodiment 1, is inoculated with, is inoculated with using artificial leaf-cutting inocalation method in plant seedling stage
14~20d afterwards, the investigation when susceptible variety state of an illness tends towards stability judged with average scab length, > 12cm be it is susceptible, 6~
12cm be it is disease-resistant, < 6cm is highly resistance.
Be inoculated with result: after leaf spot bacteria bacterium solution is inoculated with 20d, the average scab length of male parent 801 is 4.3cm, dialogue leaf
Blight shows as Resistant reaction.The average scab length of maternal R15 reaches 22.4cm, is typical susceptible reaction.188 RIL
After single plant inoculation, the scab length of blade is in continuous normal distribution in group from most short 2.8cm to longest 23.6cm,
Its average value is 6.13cm, and two-way over parent segregation is extremely obvious, and distributed area is extensive, shows genetics of quantitative characters
Feature.
RIL group is divided into bacterial blight-resisting (highly resistance and disease-resistant) according to inoculation result and bacterial blight-resisting single plant (is not felt
Disease).
Embodiment 3: the extraction of Parent and RIL single plant genomic DNA
Extract the genomic DNA of Parent and 188 RIL single plants respectively with CTAB method, the specific method is as follows:
(1) the fresh blade of 1.0g is weighed, shreds and is put into mortar, with 3mL1.5 × CTAB is added after liquid nitrogen grinding, is ground into
Homogenate is transferred in the centrifuge tube of 15mL, and 1mL1.5 × CTAB flushing is then added into mortar and is transferred in centrifuge tube again.After mixing
In 65 DEG C of water-bath 30min, during which slowly shake up frequently.
Wherein 1.5 × CTAB is formulated following (1L):
| CTAB | 15g |
| The Tris.Cl (pH 8.0) of 1mol/L | 75mL |
| The EDTA of 0.5mol/L | 30mL |
| NaCl | 61.4g |
Add deionized water to be settled to 1L, uses the preceding mercaptoethanol that final concentration of 0.2% (2ml) is added.
(2) it is cooled to room temperature, isometric chloroform/isoamyl alcohol (24:1) is added, mixes gently, until subnatant becomes dark green
Color.
(3) 4200rpm is centrifuged 10min, and upper strata aqueous phase is moved on to new 15mL centrifuge tube, adds the anhydrous of 2 times of volume pre-coolings
Ethyl alcohol mixes static 5min.DNA is precipitated in -20 DEG C of placement 30min.
(4) 4200rpm is centrifuged 10min, discards supernatant, and 75% ethanol washing of 1mL is added and precipitates 1 time, it is dry to be inverted centrifuge tube
200 μ L TE dissolving DNAs are added in dry DNA.
(5) genomic DNA is detected with 0.8% Ago-Gel.
(6) by the genomic DNA of obtained Parent and RIL single plant be stored in -20 DEG C it is spare.
Embodiment 4: the assignment of genes gene mapping and molecular markers development
(1) genetic map construction
For the genomic DNA of the RIL single plant obtained in embodiment 3, the genotyping technique based on RAD-seq
(http://www.bioon.com.cn/server/show_product.asp? id=12291) to RIL group individual into
Row Genotyping obtains the genotype data of RIL group.
With 3.0 software of MapMaker (Constructing genetic maps with MAPMAKER/EXP3.0, S
Lincoln, M Daly, E Lander-Cambridge, MA:Whitehead Institute, 1992, by referring to it is complete
Text is incorporated herein) genetic linkage maps drafting is carried out, obtain genetic linkage map.
(2) assignment of genes gene mapping
For the RIL group obtained in embodiment 1, by the individual phenotype of RIL group, it is similar with male parent type character (i.e.
Highly resistance) be denoted as a, it is similar with maternal type character it is (i.e. susceptible) be denoted as b, character occupy (i.e. disease-resistant) note between male parent and female parent
For h.The phenotypic data of all individuals is obtained, the phenotypic data of individual is compared with the genotype data obtained before, from
And Gene For Resistance To Rice Bacterial Blight is located on genetic linkage maps.The results show that Gene For Resistance To Rice Bacterial Blight is located in
In No. 11 chromosome 20802924bp to the section 20806518bp, length is about 3594bp.
(3) molecular markers development
Male parent and the maternal full-length genome that carries out respectively are resurveyed into sequence (10X), then according to sequencing result, utilize SOAP software
(http://soap.genomics.org.cn/) compare sequencing data, then with SOAPsv (http: //
Soap.genomics.org.cn/ the molecular labeling that Parent genomic fragment differs greatly is found) convenient for using gel electrophoresis area
Divide and identifies.
Finally, selecting 209bp diversity sequence (the SEQ ID NO:1 institute close to section where Gene For Resistance To Rice Bacterial Blight
The nucleic acid sequence shown) it is used as candidate molecular marker, and it is named as OSblb-SV1.
CGCGCTGCTCTCTTTCAAGTCATCCCTGCTATACCAGGGGGGCCAGTCGCTGGCATCTTGGAACACGTCCGGCCATG
GCCAGCACTGCACATGGGTGGGTGTCGTGTGCGGCCGCCGGCACCCACACAGGGTGGTGAAGCTGCGGCTGCGCTCC
TCCAACCTGGCCGGGATCATCTCGCCGTCGCTGGGCAACCTATCCTTCCTCAGGA(Seq ID NO.1)
Embodiment 5: candidate molecular marker verifying
To the rice bacterial blight resistance candidate molecular marker OSblb-SV1 determined in embodiment 4 (shown in SEQ ID NO:1
Nucleic acid sequence) verified, it is specific as follows:
For above-mentioned candidate molecular marker design primer, primer sequence is as follows:
Forward primer: 5 '-CAAGTGTGCCAACAAGTTGC-3 ' (SEQ ID NO:2)
Reverse primer: 5 '-CCACTTAGCTTGTTGGATATG-3 ' (SEQ ID NO:3)
Using above-mentioned primer, the candidate molecular marker are verified by PCR amplification and agarose gel electrophoresis detection more
State property and amplification stability.
Specifically, using extracted in embodiment 3 male parent, female parent, RIL group single plant genomic DNA as template, in utilization
It states amplimer and carries out PCR amplification, wherein
PCR reaction system is as follows:
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.It is saved at 4 DEG C after pcr amplification product is purified.
Then, part pcr amplification product is taken, is detected with 1% agarose gel electrophoresis, the result is shown in Figure 1.As shown in Figure 1, anti-
The single plant of bacterial leaf-blight amplifies the band of 860bp, and the single plant of bacterial blight-resisting does not amplify the band of 651bp.
Then, each amplified production is sequenced using 3730 sequenators, as a result, bacterial leaf spot resistant in male parent and RIL group
The single plant amplified band of disease, with not increasing some sequences compared with the single plant amplified band of bacterial blight-resisting in maternal and RIL group
Column, as candidate molecular marker OSblb-SV1.Thus, it was demonstrated that candidate molecular marker OSblb-SV1 has between Parent
Polymorphism, the candidate molecular marker are closely related with rice bacterial blight resistance character, and have chain with Bacterial blight resistance gene
The stability of heredity.
Because candidate molecular marker has polymorphism, the stability with Bacterial blight resistance gene linkage inheritance, the time
The molecular labeling for selecting molecular labeling to can be used as Bacterial blight resistance gene uses.Polymorphism refers to: molecular labeling is in bacterial leaf spot resistant
The sequence in bacterial blight-resisting rice genome is not different, can distinguish.
Embodiment 6: the preparation of molecular labeling
Using the genomic DNA of the male parent, RIL single plant extracted in embodiment 3 as template, with molecular labeling amplimer pair
(Seq ID No.2 and Seq ID No.3) carries out PCR amplification.
PCR reaction system is as follows:
PCR response procedures are as follows:
94 DEG C initial denaturation 5 minutes；94 DEG C are denaturalized 30 seconds, and 60 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, run 35 circulations；
Last 72 DEG C extend 3 minutes.Pcr amplification product can be saved at 4 DEG C.
Amplified production is purified, the nucleotide sequence containing molecular labeling is obtained.It is sequenced after purification, as a result such as SEQ
Shown in ID NO:4.
To those skilled in the art, it will be understood that the molecule mark can also be obtained by the chemically synthesized method of DNA
Note.
To (the DNA piece containing nucleotide sequence shown in Seq ID No.1 of the nucleotide fragments containing molecular labeling of preparation
Section) 5 ' ends and/or 3 ' ends are operably connected and have artificial sequence and/or control sequence, such as promoter, enhancer, terminator,
Restriction enzyme site, primer sequence etc..Wherein, term " operationally " is defined as a kind of following conformation in the present invention, in the structure
As in, control sequence such as promoter is appropriately placed on a position of Seq ID No.1, so that the control sequence instructs
The generation of the polypeptide of Seq ID No.1 coding.
CAAGTGTGCCAACAAGTTGCGGACCAAGAATGTTGGTGGTTGGTCAGGCTACATCACTTTTTCTTATATCTGTCTAA
GTCCATGAGCTAAACCAAAAACATCTCTCGCTCTTGCTGTCTTAGCTTGCACCGATATTCTCTGCATCTCGGCACGA
TGATATCACTCCCATTACTGCTCTTCGTCCTCTTCTTCTCTGCGCTGCTGCTCTTCCCTTCGAGCAGTGACGACGAC
GGTGGTGGTGATGCTGCCGGCGACGAACTCGCGCTGCTCTCTTTCAAGTCATCCCTGCTATACCAGGGGGGCCAGTC
GCTGGCATCTTGGAACACGTCCGGCCATGGCCAGCACTGCACATGGGTGGGTGTCGTGTGCGGCCGCCGGCACCCAC
ACAGGGTGGTGAAGCTGCGGCTGCGCTCCTCCAACCTGGCCGGGATCATCTCGCCGTCGCTGGGCAACCTATCCTTC
CTCAGGACGCTGCAACTCAGCGACAACCACCTGTCCGGCAAGATACCCCAGGAGCTCAGCCGTCTCATCAGGCTCCA
GCAACTGGTACTGAATTTCAACAGCCTATCGGGTGAGATTCCAGCTGCTTTGGGCAATCTAACCAGTCTCTCGGTTC
TTGAGCTGACTAACAATACACTGTCCGGAGCAATCCCTTCATCTCTGGGCAAACTCACAGGTCTCACTGATCTTGCA
CTGGCTGAAAATACGCTGTCTGGTTCCATCCCATCATCTTTCGGCCAATTGCGCAGATTATCTTTCCTTAGCTTAGC
CTTTAACAATTTAAGTGGAGCGATCCCAGATCCTATTTGGAACATCTCCTCTCTCACCATATTCGAAGTCATATCCA
ACAAGCTAAGTGG (SEQ ID NO:4)
Wherein, intermediate bolded section is molecular labeling OSblb-SV1 sequence (i.e. SEQ ID NO:1), both ends bolded section
For design of primers section.
Embodiment 7: molecular marker clone
The segment for expanding the 860bp of acquisition in embodiment 6 is cloned into pMD18-T carrier, recombinant vector is obtained.It should
Recombinant vector is transformed into e. coli jm109, chooses monoclonal, and culture obtains recombinant cell.Plasmid is extracted from recombinant cell,
Plasmid, that is, the recombinant vector carries out cloned sequence using M13 universal primer (sequence information refers to TaKaRa goods catalogue)
Sequencing, the results show that containing molecular labeling OSblb-SV1 sequence (SEQ ID NO:1) of the invention in recombinant vector.Above-mentioned gram
It is grand, conversion, culture, plasmid extract and etc. refer to " the Molecular Cloning:A Laboratory guide third edition ", Huang Peitang etc. is translated, Science Press
In September, 2002 is published.
Although a specific embodiment of the invention has obtained detailed description, it will be understood to those of skill in the art that.Root
According to all introductions having disclosed, those details can be carry out various modifications and be replaced, these change in guarantor of the invention
Within the scope of shield.Full scope of the invention is given by the appended claims and any equivalents thereof.
Claims (11)
1. a kind of and Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, it is characterised in that: the molecular labeling is Seq
Nucleotide sequence shown in ID No.1.
2. a kind of primer pair that can be used for expanding with the molecular labeling of Gene For Resistance To Rice Bacterial Blight close linkage, it is characterised in that
The target sequence of amplification is sequence shown in Seq ID No.1；The primer 1 of the primer pair is sequence shown in Seq ID No.2, is drawn
Object 2 is sequence shown in Seq ID No.3.
3. a kind of with Gene For Resistance To Rice Bacterial Blight close linkage molecular labeling, it is characterised in that: the molecular labeling be by
Primer pair as claimed in claim 2 is obtained as template through PCR amplification using the oryza sativa genomic dna of bacterial blight-resisting.
4. molecular labeling according to claim 3, it is characterised in that: the molecular labeling is core shown in Seq ID No.1
Nucleotide sequence.
5. a kind of carrier, it is characterised in that: contain molecular labeling described in any one of claim 1,3,4.
6. a kind of recombinant cell, it is characterised in that: contain the carrier described in claim 5.
7. the detection method of molecular labeling described in claim 1, comprising steps of the core of molecular labeling according to claim 1
Nucleotide sequence design primer is expanded as template using being detected oryza sativa genomic dna, and judges to whether there is in amplified production
The molecular labeling.
8. detection method according to claim 7, which is characterized in that the primer is primer pair as claimed in claim 2.
9. the molecular labeling primer of molecular labeling described in any one of claim 1,3,4 or claim 2 is to auxiliary in rice
Help the purposes in breeding or Gene For Resistance To Rice Bacterial Blight positioning or detection.
10. a kind of method of Gene For Resistance To Rice Bacterial Blight positioning, it is characterised in that: the method includes use claim 1,
3, the step of the molecular labeling primer pair of molecular labeling described in any one of 4 or claim 2.
11. a kind of rice auxiliary breeding means, it is characterised in that: the method includes any one of detection claims 1,3,4
The molecular labeling or with the molecular labeling primer of claim 2 to detecting the step of.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510420975.4A CN106350513B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510420975.4A CN106350513B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106350513A CN106350513A (en) | 2017-01-25 |
| CN106350513B true CN106350513B (en) | 2019-03-01 |
Family
ID=57842308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510420975.4A Active CN106350513B (en) | 2015-07-16 | 2015-07-16 | With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106350513B (en) |
-
2015
- 2015-07-16 CN CN201510420975.4A patent/CN106350513B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| GenBank登录号：KJ890435.1;Bimolata,W. 等;《NCBI》;20150704;参见序列部分 * |
| 水稻抗白叶枯病基因Xa21的分子标记检测;马忠友 等;《天津农业科学》;20071231;第13卷(第3期);第7-8页 * |
| 白叶枯病抗性基因Xa21分子标记检测与表型鉴定的选育效果评价;陆永法 等;《浙江农业学报》;20051231;第17卷(第6期);第346-349页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106350513A (en) | 2017-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN107090494A (en) | The molecular labeling related to millet code grain number character and its detection primer and application | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN110938706B (en) | Molecular marker closely linked with watermelon plant non-tendril gene Clnt and application thereof | |
| CN106381343B (en) | One kind molecular labeling TaSnRK2.3A relevant to thousand grain weight of wheat and plant height and its application | |
| CN110499389A (en) | With codominant marker's primer, discrimination method and its application of the anti-spotted wilt site RTSW close linkage of tobacco | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN109295247A (en) | Compact linkage molecule label yau403, primer and the application of the anti-clubroot CRd gene of Chinese cabbage | |
| CN106350514B (en) | With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN106350513B (en) | With the molecular labeling OSblb-SV1 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN106350580A (en) | Molecular marker OSb1b-SV2 closely linked with genes of resistant bacterial blight of rice | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN107365873A (en) | Molecular labeling and its application with the millet leaf sheath color linkage of characters | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN109797234A (en) | With the molecular labeling R060939-2 of resistance gene of rice blast Pi2 close linkage | |
| CN109321670A (en) | The molecular labeling of rice number of grain per ear gene NOG1 and its application | |
| CN109913579A (en) | A kind of barley phosphorus element efficiently utilizes molecular labeling and the application of QTL site | |
| CN108660233A (en) | A kind of molecular labeling SIsv0456 with millet anti-imazethapyr herbicide resistance gene close linkage | |
| CN108660237A (en) | A kind of molecular labeling SIsv1099 and application with millet Plant height gene close linkage | |
| CN106636386A (en) | Molecular marker DNdCAPS8.03-1 chained with corn head smut-resistant secondary and primary loci and application thereof | |
| CN108660230A (en) | A kind of molecular labeling SIsv0163 with millet anti-imazethapyr herbicide resistance gene close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180312 Address after: 11, 8 floor, Beishan Industrial Zone, Yantian District, Guangdong, Shenzhen 518083, China Applicant after: Shenzhen Huada Sansheng Garden Technology Co., Ltd. Applicant after: Shenzhen Huada Academy of life science Applicant after: SHENZHEN BIOLOGY BREEDING INNOVATION INSTITUTE, CHINESE ACADEMY OF AGRICULTURAL SCIENCES Address before: 518083 Guangdong Shenzhen City, Yantian District, North Mountain Road No. 146 Beishan industrial complex building science and Technology Park 604 Applicant before: SHENZHEN BGI AGRICULTURE AND CYCLE ECONOMIC TECHNOLOGY CO., LTD. Applicant before: BGI-Shenzhen |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |