CN114908182A - Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof - Google Patents
Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof Download PDFInfo
- Publication number
- CN114908182A CN114908182A CN202210384530.5A CN202210384530A CN114908182A CN 114908182 A CN114908182 A CN 114908182A CN 202210384530 A CN202210384530 A CN 202210384530A CN 114908182 A CN114908182 A CN 114908182A
- Authority
- CN
- China
- Prior art keywords
- cucumber
- female
- detecting
- sequence
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses an SNP marker related to the whole female shape of cucumber and application thereof. The SNP marker related to the cucumber full female shape disclosed by the invention corresponds to a nucleotide shown in the 101 th position of a sequence 4 in a sequence table, and is T or C. The SNP marker related to the full female shape of the cucumber is related to the full female shape of the cucumber, can be used for detecting the plant sex type of the cucumber, and further can be used for molecular marker assisted breeding of the cucumber. The SNP marker related to the full female shape of cucumber disclosed by the invention can be used for a high-flux molecular detection platform, and compared with the second generation molecular marker, the detection mode is simpler, more convenient and more accurate, and the detection efficiency is higher.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an SNP (single nucleotide polymorphism) marker related to the full female shape of cucumber and application thereof.
Background
Cucumber (Cucumissativus L.) is widely cultivated in the world and is one of important melon crops in China. Through the development and perfection of breeding technology in recent 40 years, the cucumber variety is updated for several times; a large number of excellent new cucumber varieties which have high yield, disease resistance and are suitable for annual cultivation are bred. The female line of the cucumber has great utilization value for breeding new high-yield cucumber varieties and producing cucumber seeds, so that the female line varieties are gradually accepted by the market in recent years. However, female genes in the existing cucumber female line material in China mostly come from European processing resources with smooth surfaces and few thorns, and to obtain the homozygous north China type female line material from the female genes, multiple generations of separation and purification are needed by means of selfing, backcrossing and the like, so that the effect is poor, and the period is long. Therefore, the development of molecular markers closely linked with cucumber female genes is an effective way for accelerating the innovation of cucumber female line materials. At present, with the completion of sequencing of cucumber genome, research on the orientation of various important trait genes of cucumber is driven, and there are many reports on cucumber genotype research and development of related molecular markers (Wanghui, Huafeng, Zhang Sheng, Xianyan, Zhang hong Cheng (2015), China cucumber female line research progress, China agricultural bulletin, 31 (10): 92-96)). However, besides the relative distance between the molecular markers and the female gene of cucumber, the types of the markers used are difficult to meet the requirement of high-throughput identification. The third generation of molecular marker SNP is paid attention to its advantages such as large quantity, wide distribution, stable heredity, etc. At present, SNP marker detection methods are various, wherein the detection method based on gel electrophoresis is difficult to realize high-throughput detection due to the dependence on gel electrophoresis detection; the fluorescence scanning genotyping method based on KASP (Competitive all specific PCR) with high automation degree is the most potential SNP detection method at present because the requirement on instruments and equipment is relatively low.
Disclosure of Invention
The invention aims to solve the technical problem of how to detect the sex type of cucumber.
In order to solve the technical problems, the invention firstly provides the application of the cucumber full-female molecular marker (the name of which is CsSNP16) or the substance for detecting the cucumber full-female molecular marker in detecting or assisting in detecting the cucumber sex type; the cucumber all-female-shaped molecule mark is a nucleotide corresponding to the 101 th site of a sequence 4 in a sequence table in a cucumber genome, and the cucumber all-female-shaped molecule mark is T or C.
In the application, the substance for detecting the cucumber all-female molecular marker can be a CsSNP16 primer set, and the CsSNP16 primer set consists of single-stranded DNA with the names of F1, F2 and R respectively;
the F1 is (b1) or (b 2):
(b1) single-stranded DNA shown in 22 th to 48 th positions of a sequence 1 in a sequence table;
(b2) single-stranded DNA obtained by substituting and/or deleting and/or adding one or more nucleotides at the 22 nd to the 48 th positions of the sequence 1;
the F2 is (b3) or (b 4):
(b3) single-stranded DNA shown in 22 th to 48 th positions of a sequence 2 in a sequence table;
(b4) single-stranded DNA obtained by substituting and/or deleting and/or adding one or more nucleotides from the 22 nd to the 48 th positions of the sequence 2;
and R is single-stranded DNA shown in a sequence 3 of a sequence table.
In the application, (b2) can be single-stranded DNA shown in a sequence 1 in a sequence table; (b4) can be single-stranded DNA shown in a sequence 2 in a sequence table.
The invention also provides a cucumber genotype detection method, wherein the genotypes are TT genotype, TC genotype and CC genotype, and the method comprises the following steps: detecting 101 st nucleotide corresponding to a sequence 4 in a sequence table in a cucumber genome to be detected, wherein if two alleles of the cucumber to be detected at a target site are both g1, the cucumber to be detected is a TT genotype cucumber; g2) if the two alleles of the cucumber to be detected at the target site are both the following genes, wherein the cucumber to be detected is a CC genotype cucumber; if one allele of the cucumber to be detected at the target site is g1) and the other allele is g2), the cucumber to be detected is a cucumber with TC genotype;
g1) the nucleotide corresponding to the 101 th site of the sequence 4 in the sequence table is T;
g2) the nucleotide corresponding to the 101 th site of the sequence 4 in the sequence table is C.
In the method, the detection of the 101 st nucleotide corresponding to the sequence 4 in the sequence table in the cucumber genome to be detected is carried out by adopting the CsSNP16 primer group.
The method may specifically include: and (2) carrying out reaction by adopting the CsSNP16 primer group to obtain a reaction product, and detecting a fluorescent signal of the reaction system, wherein the cucumber to be detected only with the VIC fluorescent signal is a TT genotype cucumber (namely, the homozygous type of the cucumber hologynic molecular marker T), the cucumber to be detected only with the FAM fluorescent signal is a CC genotype cucumber (namely, the homozygous type of the cucumber hologynic molecular marker C), and the cucumber to be detected with the VIC and the FAM fluorescent signal is a TC genotype cucumber (namely, the heterozygous type of the cucumber hologynic molecular marker T and C).
The reaction system for carrying out the reaction by adopting the CsSNP16 primer group can be as follows: cucumber genomic DNA (50 ng) and 0.07. mu.L of the primer mixture (the concentrations of F1, F2 and R in the primer mixture are all 50 pmol. multidot.L) -1 ) LGC 2 XKASP Mix (Low Rox) 2.5. mu.L, water make up to 8. mu.L.
The reaction conditions for carrying out the reaction by using the CsSNP16 primer set can be as follows: pre-denaturation at 95 ℃ for 10min for 1 cycle; denaturation at 95 ℃ for 20s, annealing at 55-62 ℃ (preferably 55 ℃) for 60s, setting 32-40 cycles (preferably 40 cycles).
The cucumber to be detected can be homozygous cucumber or heterozygous cucumber.
The invention also provides a method for detecting the plant type of cucumber, which comprises the following steps: detecting the genotype of the cucumber to be detected according to the detection method of the cucumber genotype, wherein the cucumber plant to be detected of the TT genotype blooms female flowers or candidate blooms female flowers, the cucumber plant to be detected of the CC genotype blooms male flowers and female flowers or candidate blooms male flowers and female flowers, and the cucumber plant to be detected of the TC genotype blooms female flowers or candidate blooms female flowers.
In the method, the cucumber to be detected can be homozygous cucumber. The cucumber to be detected can be a TT genotype cucumber or a CC genotype cucumber.
The invention also provides a cucumber breeding method, which comprises the following steps: detecting the genotype of the cucumber according to the detection method of the cucumber genotype, and selecting the TT genotype cucumber as a parent to breed.
The cucumber breeding method can also comprise selecting cucumber with the later generation of TT genotype or TC genotype as an intermediate material, and realizing cucumber breeding through multi-generation breeding.
The cucumber all-female molecular marker also belongs to the protection scope of the invention.
The invention also provides a substance with any one of the following uses Y1) -Y4), wherein the substance comprises the CsSNP16 primer set:
y1) detecting the molecular marker of the hologynic character of the cucumber;
y2) preparing a product for detecting the cucumber full-female molecular marker;
y3) or detecting the cucumber sex type in an auxiliary way;
y4) to prepare products for detecting or assisting in detecting cucumber sex types.
The substance may also comprise other reagents required for detecting the cucumber whole-female-like molecular marker, such as LGC 2 XKASP Mix (Low Rox).
The substance may be a kit. The substance can be only the CsSNP16 primer set, and can also be a kit consisting of the CsSNP16 primer set and other reagents required for detecting the cucumber full-female molecular marker.
The invention also provides any of the following applications:
H1) the application of the cucumber full female-shaped molecular marker in cucumber breeding;
H2) detecting the application of the cucumber full-female molecular marker substance in cucumber breeding;
H3) the application of the substance for detecting the cucumber full-female molecular marker in the preparation of detection or auxiliary detection of cucumber sex types;
H4) the cucumber genotype detection method is applied to detection or auxiliary detection of cucumber genotypes.
The cucumber in the present invention may be any one or more of the cucumbers in tables 1 and 2, but is not limited to the cucumbers in tables 1 and 2.
In the present invention, the cucumber sex type refers to the sex of the cucumber flower. If the flowers of the whole cucumber plant are female flowers, the plant is a female plant, and the phenotype is marked as female; if the whole cucumber plant blooms with both female flowers and male flowers, the plant is a hermaphrodite plant, and the phenotype is marked as non-female; if the flowers of the whole cucumber plant are male flowers, the plant is a male plant, and the phenotype is also marked as non-female.
The invention combines whole genome sequencing, bioinformatics analysis and phenotypic identification of materials to obtain an SNP marker CsSNP16 closely linked with a cucumber hologynic gene, and the marker can be used for detecting whether a cucumber plant is a female line plant or not and further can be used for cucumber molecular marker assisted breeding. Meanwhile, the cucumber hologynic character SNP marker obtained by the invention can be used for a high-flux molecular detection platform, and compared with a second-generation molecular marker, the detection mode is simpler, more convenient and more accurate, and the detection efficiency is higher.
Drawings
FIG. 1 is a genotyping chart of a CsSNP16 marker in a part of cucumber inbred lines. Note: the red data points (lower right) represent the material set with allele T and the blue data points (upper left) represent the material set with allele C.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents, instruments and the like used in the following examples are commercially available unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the 1 st position of each nucleotide sequence in the sequence listing is the 5 'terminal nucleotide of the corresponding DNA/RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA/RNA.
Example 1 obtaining of SNP markers associated with the Whole female shape of cucumber
This example selects 5 parts cucumber female line material and 5 parts non-female line material (table 1) for whole genome re-sequencing. And (2) analyzing the genotype data of the materials by utilizing bioinformatics, and combining the phenotype data of the 10 materials, positioning the nucleotide difference between the female line materials and the non-female line materials, finding that 24245869T/C of 1 SNP locus has significant correlation with the phenotype data on the sixth chromosome, and marking the SNP locus as a cucumber hologynic gene molecular marker, namely CsSNP16 for short.
Table 1, 10 parts sequencing cucumber material and phenotype
| Sample numbering | Phenotype type | Sample numbering | Phenotype type |
| 1 863-6 | Female part | 6 Q6 | Non-female |
| 2 863-7 | Female part | 7 Q12 | Non-female |
| 3 HZL04-1 | Female part | 8 F-3 | Non-female |
| 4 Hm60-1 | Female part | 9 Q9 | Non-female |
| 5 U4 | Female part | 10 Q10 | Non-female |
Note: materials marked 1, 2 on the left are described in "snow, et al. And (3) analyzing molecular markers linked with the cucumber high-temperature resistant QTL. The south China university newspaper (Nature science edition), 2008,41(4): 49-54' article; materials labeled 3, 8 on the left are described in "yellow, et al. Polymorphism analysis of molecular markers between cucumber mapping parents. North China agricultural science, 2007,22(2): 47-49' text; materials labeled 4, 5 on the left are described in "xu Qing", etc. And (3) constructing and analyzing a cucumber distant population molecular genetic linkage map. North China agricultural journal, 2008,23(1): 45-49'; materials labeled 6, 7 on the left are described in Zhang Guihua, et al. And (3) researching molecular markers linked with the scab resistant gene of the cucumber. Chinese agricultural science, 2006,39(11): 2250-2254'; materials marked 9, 10 on the left hand side are described in Zhang Guihua, et al. Obtaining AFLP markers linked with powdery mildew resistance related genes of cucumbers. Horticultural journal, 2004, 31 (2): 189-192'.
In Table 1, the phenotype "female" indicates that the strain flowers female flowers, and the phenotype "non-female" indicates that the strain flowers non-female flowers, i.e., both female flowers and male flowers.
Primers for detecting CsSNP16 are designed and synthesized, and specifically, the following steps are included:
forward primer F1: 5'-GAAGGTCGGAGTCAACGGATTCCTTAGCATTATTCTTGGAACATTTTT-3' (sequence 1 in the sequence table), the bold part is a VIC linker for combining with VIC;
forward primer F2: 5'-GAAGGTGACCAAGTTCATGCTCCTTAGCATTATTCTTGGAACATTTTC-3' (sequence 2 in the sequence table), the bold part is FAM linker for combining with FAM;
reverse primer R: 5'-TTTTCTCAGTTCTGATTAACGGTGT-3' (SEQ ID NO: 3 in the sequence Listing).
The sequence of a PCR product obtained by using cucumber genomic DNA as a template and performing PCR amplification by using a forward primer F1/F2 and a reverse primer R is as follows: 5 '-CCTTAGCATTATTCTTGGAACATTTTRTAAACCTATCTACACCGTTAATCAGAACTGAGAAAA-3' (underlined sequence in sequence 4 in the sequence listing), R represents T or C.
The detection reaction system of the 8-mu-L PCR fluorescence quantitative instrument comprises: cucumber genomic DNA (50 ng) and 0.07. mu.L of the primer mixture (50 pmol. L. for both forward primers F1 and F2 and for reverse primer R in the primer mixture) -1 ) LGC 2 XKASP Mix (Low Rox) 2.5. mu.L, water make up to 8. mu.L.
Editing a sample table, executing a running program and storing data according to an AB-Q6 instrument operation manual of the fluorescent quantitative PCR instrument. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 10min for 1 cycle; denaturation at 95 ℃ for 20s, annealing at 55 ℃ for 60s, 40 cycles.
And after amplification is finished, detecting a fluorescent signal, wherein the plant to be detected which detects the VIC fluorescent signal is TT genotype (namely, the CsSNP16 locus is T), the plant to be detected which detects the FAM fluorescent signal is CC genotype (namely, the CsSNP16 locus is C), and the plant to be detected which detects the VIC and the FAM fluorescent signal is TC genotype (namely, the CsSNP16 locus is T and C).
863-6, 863-7, HZL04-1, Hm60-1 and U4 in Table 1 are TT genotypes, and the blossoms are female flowers; q6, Q12, F-3, Q9 and Q10 are all CC genotypes, and female flowers and male flowers are bloomed on the same plant.
Example 2 validation of SNP markers closely linked to cucumber all-female-like Gene
The SNP marker (CsSNP16) linked to the all-female trait gene obtained in example 1 was used to determine the genotype of 50 cucumber materials (table 2) and the sex of flowers in each material was field counted to determine the accuracy of CsSNP16 for molecular marker-assisted selection.
The genotype of 50 germplasm materials was determined in the same manner as in example 1.
The results are shown in table 2, and the results show that 22 cucumbers with the TT genotype all bloom as female flowers; 27 cucumbers with CC genotypes, all flowers have female flowers and male flowers; 1 TC genotype cucumber can bloom together, and all flowers bloom. The CsSNP16 can be used for detecting the sex type of cucumber plants.
TABLE 2, 50 cucumber Material phenotype and genotype data
Note: the materials marked with the letters are all described in "Zhang Guihua", etc. And (4) carrying out AFLP analysis on genetic diversity of cucumber germplasm resources. North China agricultural science, 2007,22(3): 21-24' text;
is marked with
The materials of (A) are all described in Du Sheng, Zhang Gui Hua, etc. SCAR conversion of cucumber powdery mildew resistance gene AFLP marker. The journal of horticulture 2005,32(6): 1095-1097;
in Table 2, the phenotype "female" indicates that the line blooms both female flowers, and "non-female" indicates that the line blooms both female and male flowers.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> Tianjin Drie specialty industries, Ltd
<120> SNP marker related to cucumber full-female shape and application thereof
<160> 4
<170>PatentIn version 3.5
<210> 1
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 1
gaaggtcggagtcaacggattccttagcattattcttggaacattttt 48
<210> 2
<211> 48
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
gaaggtgaccaagttcatgctccttagcattattcttggaacattttc 48
<210> 3
<211> 25
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
ttttctcagttctgattaacggtgt 25
<210> 4
<211> 301
<212> DNA
<213> cucumber (Cucumissativus L.)
<400> 4
ggaattattcaaaacagttcgataaacatcattgggccattcatttccagttcaaaacaa 60
agcatacagataaaccttagcattattcttggaacattttrtaaacctatctacaccgtt 120
aatcagaactgagaaaatattacaaaatctcttgggactggcagaaaaggtaaacgatga 180
ttctacaaaatcaccctatgcctacgatagactgacggtccaattcattttatcttcgat 240
aagccccatttgtaatctggtaagtacagaatagagttgttgtgaaacaaccccaacacc 300
a 301
Claims (10)
1. The application of the cucumber full-female molecular marker or a substance for detecting the cucumber full-female molecular marker in detecting or assisting in detecting the cucumber sex type; the cucumber all-female-shaped molecule marker is a nucleotide corresponding to the 101 th site of a sequence 4 in a sequence table in a cucumber genome, and the cucumber all-female-shaped molecule marker is T or C.
2. Use according to claim 1, characterized in that: the substance for detecting the cucumber full-female molecular marker is a CsSNP16 primer group, and the CsSNP16 primer group consists of single-stranded DNAs with the names of F1, F2 and R respectively;
the F1 is (b1) or (b 2):
(b1) single-stranded DNA shown in 22 th to 48 th positions of a sequence 1 in a sequence table;
(b2) single-stranded DNA obtained by substituting and/or deleting and/or adding one or more nucleotides at the 22 nd to the 48 th positions of the sequence 1;
the F2 is (b3) or (b 4):
(b3) single-stranded DNA shown in 22 th to 48 th positions of a sequence 2 in a sequence table;
(b4) single-stranded DNA obtained by substituting and/or deleting and/or adding one or more nucleotides from the 22 nd to the 48 th positions of the sequence 2;
and R is single-stranded DNA shown in a sequence 3 of a sequence table.
3. Use according to claim 2, characterized in that: (b2) is single-stranded DNA shown in a sequence 1 in a sequence table; (b4) is single-stranded DNA shown in a sequence 2 in a sequence table.
4. A method for detecting cucumber genotypes, wherein the genotypes comprise a TT genotype, a TC genotype and a CC genotype, and the method comprises the following steps: detecting 101 st nucleotide corresponding to a sequence 4 in a sequence table in a cucumber genome to be detected, wherein if two alleles of the cucumber to be detected at a target site are both g1, the cucumber to be detected is a TT genotype cucumber; g2) if the two alleles of the cucumber to be detected at the target site are both the following genes, wherein the cucumber to be detected is a CC genotype cucumber; if one allele of the cucumber to be detected at the target site is g1) and the other allele is g2), the cucumber to be detected is a cucumber with TC genotype;
g1) the nucleotide corresponding to the 101 th site of the sequence 4 in the sequence table is T;
g2) the nucleotide corresponding to the 101 th site of the sequence 4 in the sequence table is C.
5. The method of claim 4, wherein: detecting the nucleotide corresponding to the 101 th site of the sequence 4 in the sequence table in the cucumber genome to be detected by using the CsSNP16 primer set described in claim 2 or 3.
6. A method for detecting cucumber genotype, comprising: detecting the genotype of the cucumber to be detected according to the method of claim 4 or 5, wherein the cucumber plant to be detected has a TT genotype of blooming or a candidate blooming, the cucumber plant to be detected has a CC genotype of blooming with male flowers and female flowers or a candidate blooming with male flowers and female flowers, and the cucumber plant to be detected has a TC genotype of blooming with female flowers or a candidate blooming with female flowers.
7. A method of cucumber breeding comprising: the cucumber is genotyped according to the method of claim 4 or 5, and the cucumber with TT genotype is selected as a parent for breeding.
8. The cucumber all-female-like molecular marker as claimed in claim 1.
9. A substance having any one of the following Y1) -Y4), comprising the CsSNP16 primer set according to claim 2 or 3:
y1) detecting the molecular marker of the hologynic character of the cucumber;
y2) preparing a product for detecting the cucumber full-female molecular marker;
y3) detecting or assisting in detecting the cucumber sex type;
y4) to prepare products for detecting or assisting in detecting cucumber sex types.
10. Any of the following applications:
H1) the use of a cucumber all-female-like molecular marker as defined in claim 1 in cucumber breeding;
H2) use of a substance for detecting a cucumber all-female-like molecular marker as defined in claim 1 in cucumber breeding;
H3) the use of a substance for detecting the cucumber all-female-like molecular marker as defined in claim 1 in the preparation of a product for detecting or assisting in detecting cucumber sex types;
H4) use of the method of claim 4 or 5 for detecting or aiding in the detection of cucumber genotypes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210384530.5A CN114908182A (en) | 2022-04-13 | 2022-04-13 | Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210384530.5A CN114908182A (en) | 2022-04-13 | 2022-04-13 | Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114908182A true CN114908182A (en) | 2022-08-16 |
Family
ID=82765737
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210384530.5A Pending CN114908182A (en) | 2022-04-13 | 2022-04-13 | Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114908182A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106968A (en) * | 2023-10-19 | 2023-11-24 | 北京市农林科学院 | Primer group and kit for identifying female strength of cucumber and application of primer group and kit |
-
2022
- 2022-04-13 CN CN202210384530.5A patent/CN114908182A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106968A (en) * | 2023-10-19 | 2023-11-24 | 北京市农林科学院 | Primer group and kit for identifying female strength of cucumber and application of primer group and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110499387B (en) | Wheat flag leaf length QTL linked molecular marker and application thereof | |
| CN112981001B (en) | Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof | |
| CN109913577B (en) | Molecular marker closely linked with wheat stripe rust resistance gene Yr1152 and application thereof | |
| CN114427007A (en) | KASP molecular marker related to bitter gourd whole female and application thereof | |
| CN107937397B (en) | SNP molecular marker closely linked with tomato male sterility gene and obtaining method and application thereof | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN114134247B (en) | Molecular marker closely linked with millet plant height character, primer sequence and application thereof | |
| CN105603119A (en) | SNP (single-nucleotide polymorphism) marker method for detecting cucumber Corynespora-cassiicola-resistant site | |
| CN114908182A (en) | Cucumber full-female-shape related SNP (Single nucleotide polymorphism) marker and application thereof | |
| CN107338293B (en) | KaSP molecular marker related to resistance of maize rough dwarf disease and application thereof | |
| CN109182557A (en) | A kind of SNP marker and its application for identifying Pelteobagrus vachelli low dissolved oxygen tolerance and coefficient of condition | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN113564161B (en) | Molecular marker closely linked with bacterial wilt resistance of cultivated peanut and application thereof | |
| CN106434948B (en) | The molecular labeling of brown planthopper resistant gene in rice Bph31 (t) and its application | |
| CN113278723B (en) | Composition for analyzing genetic diversity of Chinese cabbage genome segment or genetic diversity introduced in synthetic mustard and application | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| KR20130091434A (en) | Primer for selecting variety resistant to rice stripe disease containing stv-bi gene and the selecting method thereof | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| CN114574608B (en) | SNP (Single nucleotide polymorphism) marker related to cucumber anti-target spot and application thereof | |
| WO2012017679A1 (en) | Stalk-length-related marker of plant of the genus saccharum and the use thereof | |
| CN114908183B (en) | Method for identifying resistance of cucumber scab, SNP (Single nucleotide polymorphism) special primer set and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |