CN106755447A - A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat - Google Patents
A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat Download PDFInfo
- Publication number
- CN106755447A CN106755447A CN201710004394.1A CN201710004394A CN106755447A CN 106755447 A CN106755447 A CN 106755447A CN 201710004394 A CN201710004394 A CN 201710004394A CN 106755447 A CN106755447 A CN 106755447A
- Authority
- CN
- China
- Prior art keywords
- breeding
- pigeon
- squab
- remain
- types
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000272201 Columbiformes Species 0.000 title claims abstract description 91
- 210000000579 abdominal fat Anatomy 0.000 title claims abstract description 28
- 239000003147 molecular marker Substances 0.000 title claims abstract description 15
- 238000010187 selection method Methods 0.000 title claims abstract description 9
- 238000009395 breeding Methods 0.000 claims abstract description 99
- 230000001488 breeding effect Effects 0.000 claims abstract description 98
- 230000004087 circulation Effects 0.000 claims abstract description 7
- 230000002068 genetic effect Effects 0.000 claims abstract description 6
- 230000037396 body weight Effects 0.000 claims description 12
- 108020004414 DNA Proteins 0.000 claims description 11
- 108090000623 proteins and genes Proteins 0.000 claims description 11
- 108700028369 Alleles Proteins 0.000 claims description 10
- 230000001850 reproductive effect Effects 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 108700024394 Exon Proteins 0.000 claims description 5
- 238000010241 blood sampling Methods 0.000 claims description 4
- 238000007710 freezing Methods 0.000 claims description 4
- 239000000463 material Substances 0.000 claims description 4
- 230000001681 protective effect Effects 0.000 claims description 4
- 230000004083 survival effect Effects 0.000 claims description 4
- 238000001712 DNA sequencing Methods 0.000 claims description 3
- 230000003190 augmentative effect Effects 0.000 claims description 3
- 239000008280 blood Substances 0.000 claims description 3
- 210000004369 blood Anatomy 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 238000002205 phenol-chloroform extraction Methods 0.000 claims description 3
- 230000012447 hatching Effects 0.000 claims description 2
- 101710189565 Fatty acid-binding protein, liver-type Proteins 0.000 claims 4
- 101710188974 Fatty acid-binding protein, liver Proteins 0.000 claims 3
- 102100026745 Fatty acid-binding protein, liver Human genes 0.000 claims 2
- 239000003550 marker Substances 0.000 abstract description 5
- 238000000034 method Methods 0.000 abstract description 5
- 238000005259 measurement Methods 0.000 abstract description 2
- 101150058771 FABP gene Proteins 0.000 abstract 1
- 235000013372 meat Nutrition 0.000 description 8
- 108091022862 fatty acid binding Proteins 0.000 description 4
- 238000004519 manufacturing process Methods 0.000 description 3
- 244000144977 poultry Species 0.000 description 3
- 230000006641 stabilisation Effects 0.000 description 3
- 238000011105 stabilization Methods 0.000 description 3
- 241000287828 Gallus gallus Species 0.000 description 2
- 210000000481 breast Anatomy 0.000 description 2
- 244000144980 herd Species 0.000 description 2
- 238000009399 inbreeding Methods 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 238000003307 slaughter Methods 0.000 description 2
- 241000271566 Aves Species 0.000 description 1
- 238000003975 animal breeding Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000003111 delayed effect Effects 0.000 description 1
- 230000001066 destructive effect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 235000006486 human diet Nutrition 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 239000013049 sediment Substances 0.000 description 1
- 239000013589 supplement Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat, the method is comprised the following steps：Breeding underlying group is set up：Selection adult King pigeon breeding pigeon is used as breeding underlying group；Underlying group breeding obtains G1 generations；G1 is for standby breeding pigeon molecular marker assisted selection；G1 is for the standby dove selected and remain into breeding period seed selection；Pure breeding subculture, obtains G2 generations, and so circulation obtains Gn generations.The L FABP gene molecule markers that the present invention is provided have genetic association with squab abdominal fat, therefore squab abdominal fat can be reduced by marker assisted selection, it is to avoid destructiveness measurement；In addition, early stage seed selection can be realized using marker assisted selection, accelerate Advances in Breeding.
Description
Technical field
The invention belongs to birds Genetic Markers field, be related to a kind of molecule labelling method for reducing pigeon for meat abdominal fat and
Using.
Background technology
China is pigeon for meat cultivation big country, and national breeding pigeon livestock on hand about 50,000,000 pairs produces squab 800,000,000 per year.China's pigeon for meat growth
Based on being cultivated on a small scale with peasant household, and most of implementation home-bred and autophytics, because of microcommunity inbreeding and the related breeding technique of shortage, dove group
Production performance is not good or even degenerates.King pigeon is the kind introduced from the U.S., is the main dove kind of the current pigeon for meat production of China,
But along with hybridization, inbreeding, blindly choose seeds, cause King pigeon introduces a collection to mix, production performance it is very different.In recent years, one
A little larger enterprises, R＆D institution set about pigeon for meat breeding work, but not yet cultivate into national new varieties so far, show
Compared with chicken, pig etc., other livestock and poultry are delayed for pigeon for meat breeding.
Molecular marker assisted selection is come the breeding technique of selection, in pig, ox, chicken using phenotypic data and genotype data
Deng having been obtained for wide application in Animal Breeding, however it is not yet common in pigeon for meat breeding.The abdominal fat of poultry can price cheating
Value is low, and reducing abdominal fat sediment can save feed, therefore, it is one of breeding objective of butcher's beast to reduce abdominal fat.The present invention
People's early-stage Study finds that King pigeon liver fatty acid binding protein gene (L-FABP) exons 1 has T100C mutation,
And it is significantly correlated with squab abdominal fat, therefore breast can be reduced by the frequency of seed selection raising dove group's L-FABP allele T
Dove abdominal fat, cultivates more section grain, more meets the pigeon for meat kind of human diet health.
The content of the invention
It is an object of the invention to provide a kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat.
On the basis of conventional herd breeding, using L-FABP gene molecule markers, carry out marker assisted selection, King pigeon breast is reduced by generation
Dove abdominal fat.
Its concrete technical scheme is：
A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat, comprises the following steps：
Step 1, breeding underlying group are set up
Used as breeding underlying group, i.e., 0 from generation to generation for selection adult King pigeon breeding pigeon.Breeding pigeon takes cage, dove to number.
Step 2, underlying group breeding obtain G1 generations
Underlying group (0 from generation to generation) breeding pigeon is continuously bred, and obtains G1 generations.By breeding pigeon hatching, nurture.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, young dovecote is transferred to be raised as standby breeding pigeon.
Step 4, G1 are for standby breeding pigeon molecular marker assisted selection
(1) match before select and remain plumage color, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%.
(2) liver fatty acid binding protein gene (L-FABP) exons 1 genotype identification is carried out to the individuality selected and remain
1. standby dove extracting genome DNA：Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplifications：Synthetic pcr primer thing：Upstream primer sequence is
CATCCCCACTGTCATCTCCA, downstream primer sequence are ACCCCAAACCAACAATTGCA；PCR amplification system is 20 μ L, its
The μ L of middle genomic DNA 1, each 1 μ L of upstream and downstream primer, 2 × Premix Taq 10 μ L, ddH2O 7μL；PCR programs are 94 DEG C
5min, is followed by 35 circulations (94 DEG C of 30s, 57 DEG C of 45s, 72 DEG C of 30s), is followed by 72 DEG C of 10min；
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, in gained sequencer map and L-FABP gene extrons 1
T100C loci gene types sequencer map relatively carries out genotype identification.All individual of sample are divided into TT types or TC types or CC types.
(3) in the individuality selected and remain, then the selection for carrying out genotype.Preferential TT types of selecting and remain are individual, next TC type of selecting and remain
Body.If TT types and TC types are individual not enough, augmented by CC types are individual.Thus step, can improve dove group's allele T's by generation
Frequency.
Step 5, G1 are for the standby breeding pigeon selected and remain into breeding period seed selection
(1) breeding pigeon selected and remain freely is matched, and successful matching is transferred to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory：From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, core is bred in squab growth breeding pigeon establishment faster
Group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon
Reproductive performance, the speed of growth of squab can keep stabilization or certain lifting, while the frequency of L-FABP allele T can be by generation
Improve, squab abdominal fat is also with reduction.
The molecular marker-assisted selection method for reducing King pigeon squab abdominal fat of the present invention is for squab abdominal fat
Application in the selection course of rate.
Compared with prior art, beneficial effects of the present invention are：
Poultry abdominal fat proterties belongs to destructive metric trait, that is, needing to butcher to determine, and conventional herd breeding method is：It is logical
Slaughter determining is crossed, the low individuality of abdominal fat is determined, then using Sib selection.The L-FABP gene molecule markers that the present invention is provided
There is genetic association with abdominal fat, therefore abdominal fat can be reduced by marker assisted selection, it is to avoid destructiveness measurement；In addition,
Early stage seed selection can be realized using marker assisted selection, accelerates Advances in Breeding.
Brief description of the drawings
Fig. 1 is T100C loci gene type sequencer maps in L-FABP gene extrons 1；
Fig. 2 is each generation breeding technique flow chart.
Specific embodiment
Technical scheme is described in more detail with specific embodiment below in conjunction with the accompanying drawings.
A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat, comprises the following steps：
Step 1, breeding underlying group are set up
Used as breeding underlying group, i.e., 0 from generation to generation for selection adult King pigeon breeding pigeon.Breeding pigeon takes cage, numbering.
Step 2, underlying group breeding obtain G1 generations
Underlying group (0 from generation to generation) breeding pigeon is continuously bred, and obtains 1 from generation to generation.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, young dovecote is transferred to be raised as standby breeding pigeon.
Step 4, G1 are for standby breeding pigeon molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%.
(2) liver fatty acid binding protein gene (L-FABP) exons 1 genotype mirror is carried out to the individuality that (1) selects and remain
It is fixed
1. standby breeding pigeon extracting genome DNA：Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplifications：Synthetic pcr primer thing：Upstream primer sequence is
CATCCCCACTGTCATCTCCA, downstream primer sequence are ACCCCAAACCAACAATTGCA；PCR amplification system is 20 μ L, its
The μ L of middle genomic DNA 1, each 1 μ L of upstream and downstream primer, 2 × Premix Taq 10 μ L, ddH2O 7μL；PCR programs are 94 DEG C
5min, is followed by 35 circulations (94 DEG C of 30s, 57 DEG C of 45s, 72 DEG C of 30s), is followed by 72 DEG C of 10min；
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, in gained sequencer map and L-FABP gene extrons 1
T100C loci gene types sequencer map (accompanying drawing 1) compare carries out genotype identification.All individual of sample be divided into TT types or TC types or
CC types.
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.Preferential TT types of selecting and remain are individual, next TC type of selecting and remain
It is individual.If TT types and TC types are individual not enough, augmented by CC types are individual.Thus step, can improve dove group's allele T by generation
Frequency.
Step 5, G1 are for the standby dove selected and remain into breeding period seed selection
(1) breeding pigeon selected and remain freely is matched, and successful matching is transferred to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory：From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, core is bred in squab growth breeding pigeon establishment faster
Group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations.Each generation breeding technique flow chart is shown in accompanying drawing 2.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon
Reproductive performance, the speed of growth of squab can keep stabilization or certain lifting, while the frequency of L-FABP allele T can be by generation
Improve, squab abdominal fat is also with reduction.
Embodiment
Step 1, breeding underlying group are set up
Selection adult King pigeon breeding pigeon is used as breeding underlying group (0 from generation to generation), underlying group breeding pigeon scale more than 1000 pairs.Kind
Dove is taken cage and numbers.
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 generations.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, young dovecote is transferred to be raised as standby breeding pigeon.Standby breeding pigeon quantity male and female sum more than 5000.
Step 4, G1 are for standby dove molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%, i.e., at least select and remain 2000 public doves, 2000 hen pigeons.
(2) T100C in liver fatty acid binding protein gene (L-FABP) exons 1 is carried out to the individuality that (1) selects and remain
Loci gene type identifies that TT types account for 17.0%, TC types and account for 42.6%, CC types 40.4%.It is computed, allele T frequencies are
0.38.Sampling slaughter determining 94, the results are shown in Table 1, it is seen that T allele homozygosis significantly reduces (P<0.05) squab abdominal fat.
Table 1：The hereditary effect (average ± standard error) of L-FABP gene different genotypes
| TT types | TC types | CC types | |
| Abdominal fat, % | 0.7±0.15a | 1.3±0.14b | 1.2±0.11b |
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.Preferential TT types of selecting and remain are individual, next TC type of selecting and remain
Individuality, supplements if lazy weight so that CC types are individual.Finally select and remain public dove 1500, hen pigeon 1500.Thus generation seed selection, can
Make the frequency of dove group's allele T by 0.38 lifting to 0.51.
Step 5, G1 are for the standby dove selected and remain into breeding period seed selection
(1) breeding pigeon selected and remain freely is matched, and successful matching is transferred to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory：From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, squab grows breeding pigeon 1000 pairs faster, sets up
Breed core group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon
Reproductive performance, the speed of growth of squab can keep stabilization or certain lifting, while the frequency of L-FABP allele T can be by generation
Improve until homozygosis, squab abdominal fat is also with reduction.
The above, preferably specific embodiment only of the invention, protection scope of the present invention not limited to this are any ripe
Those skilled in the art are known in the technical scope of present disclosure, the letter of the technical scheme that can be become apparent to
Altered or equivalence replacement are each fallen within protection scope of the present invention.
SEQUENCE LISTING
<110>Agricultural University Of Anhui
<120>A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 1
catccccact gtcatctcca 20
<210> 2
<211> 20
<212> DNA
<213>It is artificial synthesized
<400> 2
accccaaacc aacaattgca 20
Claims (1)
1. it is a kind of reduce King pigeon squab abdominal fat molecular marker-assisted selection method, it is characterised in that including following step
Suddenly：
Step 1, breeding underlying group are set up
Used as breeding underlying group, i.e., 0 from generation to generation for selection adult King pigeon breeding pigeon；Breeding pigeon takes cage, numbering；
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 generations；By breeding pigeon hatching, nurture；
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring conduct with unique number
Individual identification；While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby；After squab wears pin ring, turn
Enter young dovecote to be raised as standby breeding pigeon；
Step 4, G1 are for standby dove molecular marker assisted selection
(1) before matching, plumage color of selecting and remain, shin color etc. meet the medium on the upper side, individuality be well-proportioned of this kind macroscopic features, body weight,
Ratio of reserving seed for planting about 80%；
(2) liver fatty acid binding protein gene L-FABP exons 1 genotype identifications are carried out to the individuality selected and remain
1. standby dove extracting genome DNA：Genomic DNA in squab blood is extracted using phenol-chloroform method；
2. L-FABP genetic fragments PCR amplifications：Synthetic pcr primer thing：Upstream primer sequence be CATCCCCACTGTCATCTCCA, under
Trip primer sequence is ACCCCAAACCAACAATTGCA；PCR amplification system is 20 μ L, and the wherein μ L of genomic DNA 1, upstream and downstream is drawn
Each 1 μ L of thing, 2 × Premix Taq 10 μ L, ddH2O 7μL；PCR programs are 94 DEG C of 5min, are followed by 35 and circulate, 94 DEG C of 30s,
57 DEG C of 45s, 72 DEG C of 30s, it is followed by 72 DEG C of 10min；
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, in gained sequencer map and L-FABP gene extrons 1
T100C loci gene types sequencer map relatively carries out genotype identification；All individual of sample are divided into TT types or TC types or CC types；
(3) in the individuality selected and remain, then the selection for carrying out genotype；Preferential TT types of selecting and remain are individual, and next TC type of selecting and remain is individual；Such as
Fruit TT types and TC types are individual not enough, then augmented by CC types are individual；Thus step, the frequency of dove group's allele T is improved by generation；
Step 5, G1 are for the standby dove selected and remain into breeding period seed selection
(1) breeding pigeon selected and remain freely is matched, and successful matching is transferred to cage, checks that each pair breeding pigeon pin ring is numbered, if relationship is closed
System, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree；
(2) performance inventory：From after breeding pigeon pairing, the record each pair parent egg number of dove, chickling-surviving number, squab survival rate, squab 25 days
Age body weight；The statistics record material of a year, reproductive performance of selecting and remain is preferable, core group is bred in squab growth breeding pigeon establishment faster；
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations；
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710004394.1A CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710004394.1A CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755447A true CN106755447A (en) | 2017-05-31 |
| CN106755447B CN106755447B (en) | 2020-06-09 |
Family
ID=58949503
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710004394.1A Active CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755447B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109349210A (en) * | 2018-10-22 | 2019-02-19 | 潜山县绿色养殖有限责任公司 | Seed choosing method that is a kind of while improving meat index reproductive capacity and the squab speed of growth |
| CN110367197A (en) * | 2019-08-26 | 2019-10-25 | 浙江省农业科学院 | A kind of corss combination combination research method of pigeon for meat |
| CN111235247A (en) * | 2020-03-05 | 2020-06-05 | 佛山科学技术学院 | Breeding method of low-abdominal-fat high-quality chickens |
| CN114847225A (en) * | 2022-05-05 | 2022-08-05 | 江苏省家禽科学研究所 | Pigeon breeding family recording method |
| CN117562019A (en) * | 2023-10-25 | 2024-02-20 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914623A (en) * | 2010-08-20 | 2010-12-15 | 中国农业大学 | Method for assisting identifying chicken with different fat traits and primer special for same |
| CN101921845A (en) * | 2010-09-18 | 2010-12-22 | 吉林大学 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
| CN104911273A (en) * | 2015-07-01 | 2015-09-16 | 山东大学 | Chicken FABP1 gene molecular genetic marker related to chicken good production traits and application thereof |
-
2017
- 2017-01-04 CN CN201710004394.1A patent/CN106755447B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914623A (en) * | 2010-08-20 | 2010-12-15 | 中国农业大学 | Method for assisting identifying chicken with different fat traits and primer special for same |
| CN101921845A (en) * | 2010-09-18 | 2010-12-22 | 吉林大学 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
| CN104911273A (en) * | 2015-07-01 | 2015-09-16 | 山东大学 | Chicken FABP1 gene molecular genetic marker related to chicken good production traits and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| JUN HE ET AL: "A novel SNP of liver-type fatty acid-binding protein gene in duck and its associations with the intramuscular fat", 《MOL BIOL REP》 * |
| Q. WANG ET AL: "Tissue Expression and Association with Fatness Traits of Liver Fatty Acid-Binding Protein Gene in Chicken", 《POULTRY SCIENCE》 * |
| YUFANG ZHAO ET AL: "Identification of SNPs of the L-BABP and L-FABP and their Association with Growth and Body Composition Traits in Chicken", 《J. POULT. SCI.》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109349210A (en) * | 2018-10-22 | 2019-02-19 | 潜山县绿色养殖有限责任公司 | Seed choosing method that is a kind of while improving meat index reproductive capacity and the squab speed of growth |
| CN109349210B (en) * | 2018-10-22 | 2021-10-19 | 潜山县绿色养殖有限责任公司 | Seed selection method for simultaneously improving breeding power of meat breeding pigeons and growth speed of young pigeons |
| CN110367197A (en) * | 2019-08-26 | 2019-10-25 | 浙江省农业科学院 | A kind of corss combination combination research method of pigeon for meat |
| CN110367197B (en) * | 2019-08-26 | 2022-06-28 | 浙江省农业科学院 | Hybridization matching combination research method of meat pigeons |
| CN111235247A (en) * | 2020-03-05 | 2020-06-05 | 佛山科学技术学院 | Breeding method of low-abdominal-fat high-quality chickens |
| CN114847225A (en) * | 2022-05-05 | 2022-08-05 | 江苏省家禽科学研究所 | Pigeon breeding family recording method |
| CN117562019A (en) * | 2023-10-25 | 2024-02-20 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
| CN117562019B (en) * | 2023-10-25 | 2024-09-06 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755447B (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755447A (en) | A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat | |
| RU2721252C2 (en) | Hybrid dairy cattle and systems for maximizing the benefit of using the hybrid | |
| Sutarno et al. | Genetic diversity of local and exotic cattle and their crossbreeding impact on the quality of Indonesian cattle | |
| CN101919367B (en) | Method for producing breed of black-shin dorking | |
| CN102106296B (en) | Method for cultivating novel Dingyuan pig breed | |
| Jin et al. | The breeding history and commercial development of the Korean native chicken | |
| CN107494410A (en) | A kind of method for the production depth shell color layer of green-shell egg that forms a complete set of | |
| CN102578041A (en) | Method for using Huai pigs to cultivate new pig breed and produce hybrid commercial pigs | |
| CN110358819A (en) | A kind of breeding method of all-male crow spot hybridized snakehead fish | |
| CN102187844B (en) | Method for culturing green-foot short and small recessive white feather egg chickens | |
| CN104823919B (en) | The breeding method of southeast of Guizhou Province Fructus Foeniculi chicken recessive white feather new lines and application | |
| CN113424794B (en) | Breeding method of new strain of high-quality disease-resistant local chicken | |
| CN104719255A (en) | Cultivation method for new black pig varieties | |
| CN104604794A (en) | Recessive white feather Beijing fatty chicken breeding method | |
| CN102124997B (en) | Method for breeding two-point-pattern lacy duck new breed | |
| CN109349222A (en) | A kind of method that molecule auxiliary cultivates short-foot layer of green-shell egg strain | |
| CN109105338A (en) | A kind of producing method for seed of red plumage white shell egg chicken breed system | |
| CN107711685A (en) | High-quality high anti-fast numerous new product chicken genescreen and combined method | |
| CN102487860B (en) | Method for screening megalobrama amblycephala group combinations with hybrid vigor | |
| CN106591467A (en) | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon | |
| CN106069895A (en) | The construction method of a kind of Heterologous Hybridization strain and offspring seed cultivation method thereof | |
| CN107155959A (en) | A kind of compound breeding method for improveing yellow catfish growing character | |
| Lehrman et al. | Shaping our food-an overview of crop and livestock breeding | |
| Reddy | Carp genetic resources of India. | |
| CN106172095B (en) | Breeding method of large-size Yangtze river system river crab fine breeds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiang Runshen Inventor after: Wan Yi Inventor after: Zhou Bangyuan Inventor after: Huang Yuanyuan Inventor after: Wang Zhicheng Inventor after: Ma Chendong Inventor before: Wan Yi Inventor before: Jiang Runshen Inventor before: Zhou Bangyuan Inventor before: Huang Yuanyuan Inventor before: Wang Zhicheng Inventor before: Ma Chendong Inventor before: Dai Meng |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |