CN106755447B - Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon - Google Patents
Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon Download PDFInfo
- Publication number
- CN106755447B CN106755447B CN201710004394.1A CN201710004394A CN106755447B CN 106755447 B CN106755447 B CN 106755447B CN 201710004394 A CN201710004394 A CN 201710004394A CN 106755447 B CN106755447 B CN 106755447B
- Authority
- CN
- China
- Prior art keywords
- breeding
- pigeons
- pigeon
- generation
- individuals
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000272201 Columbiformes Species 0.000 title claims abstract description 157
- 239000003147 molecular marker Substances 0.000 title claims abstract description 19
- 238000010187 selection method Methods 0.000 title claims abstract description 9
- 210000001015 abdomen Anatomy 0.000 title description 5
- 238000009395 breeding Methods 0.000 claims abstract description 123
- 230000001488 breeding effect Effects 0.000 claims abstract description 116
- 101710188974 Fatty acid-binding protein, liver Proteins 0.000 claims abstract description 25
- 101710189565 Fatty acid-binding protein, liver-type Proteins 0.000 claims abstract description 25
- 210000000579 abdominal fat Anatomy 0.000 claims abstract description 22
- 230000002068 genetic effect Effects 0.000 claims abstract description 12
- 102100026745 Fatty acid-binding protein, liver Human genes 0.000 claims description 12
- 108700028369 Alleles Proteins 0.000 claims description 10
- 239000008280 blood Substances 0.000 claims description 10
- 210000004369 blood Anatomy 0.000 claims description 10
- 230000012447 hatching Effects 0.000 claims description 7
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000012163 sequencing technique Methods 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 210000003746 feather Anatomy 0.000 claims description 5
- 230000017448 oviposition Effects 0.000 claims description 4
- 230000004083 survival effect Effects 0.000 claims description 4
- 210000003462 vein Anatomy 0.000 claims description 4
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 238000001712 DNA sequencing Methods 0.000 claims description 3
- 230000002950 deficient Effects 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 238000002205 phenol-chloroform extraction Methods 0.000 claims description 3
- 230000002194 synthesizing effect Effects 0.000 claims description 3
- 230000010100 anticoagulation Effects 0.000 claims 1
- 238000007710 freezing Methods 0.000 claims 1
- 230000008014 freezing Effects 0.000 claims 1
- 238000004321 preservation Methods 0.000 claims 1
- 230000009469 supplementation Effects 0.000 claims 1
- 239000003550 marker Substances 0.000 abstract description 5
- 230000001066 destructive effect Effects 0.000 abstract description 3
- 238000005259 measurement Methods 0.000 abstract description 3
- 235000013372 meat Nutrition 0.000 description 11
- 244000144977 poultry Species 0.000 description 7
- 235000013594 poultry meat Nutrition 0.000 description 7
- 238000000034 method Methods 0.000 description 6
- 238000003307 slaughter Methods 0.000 description 3
- 241000287828 Gallus gallus Species 0.000 description 2
- 241000282887 Suidae Species 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 235000013330 chicken meat Nutrition 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 108091022862 fatty acid binding Proteins 0.000 description 2
- 238000009399 inbreeding Methods 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 230000000474 nursing effect Effects 0.000 description 2
- 230000000717 retained effect Effects 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 241000283690 Bos taurus Species 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000008021 deposition Effects 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 230000002440 hepatic effect Effects 0.000 description 1
- 235000006486 human diet Nutrition 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 108090000623 proteins and genes Proteins 0.000 description 1
- 230000009467 reduction Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Animal Behavior & Ethology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker-assisted selection method for reducing the fat percentage of a squab of white-feather king pigeon, which comprises the following steps: establishing a breeding basic group: selecting adult white-feather king pigeon as a breeding base group; breeding basic groups to obtain G1 generations; g1 generation reserve pigeon molecular marker auxiliary selection; selecting seeds of the reserve pigeons selected and reserved in the G1 generation in the breeding period; and (5) carrying out pure reproduction and subculture to obtain G2 generation, and circulating the steps to obtain Gn generation. The L-FABP gene molecular marker provided by the invention has genetic association with the squab abdominal fat rate, so that the squab abdominal fat rate can be reduced through marker-assisted selection, and destructive measurement is avoided; in addition, early seed selection can be realized by marker-assisted selection, and the breeding progress is accelerated.
Description
Technical Field
The invention belongs to the technical field of poultry genetic markers, and relates to a molecular marker method for reducing the abdominal fat rate of meat pigeons and application thereof.
Background
China is a big country for breeding meat pigeons, about 5000 ten thousand pairs of pigeons are bred in the country, and 8 hundred million young pigeons are produced every year. The growth of meat pigeons in China is mainly based on small-scale breeding of farmers, most of the meat pigeons are self-breeding and self-breeding, and because of inbreeding of small groups and lack of related breeding technologies, the production performance of the pigeon groups is poor or even degraded. The white-feather king pigeon is a variety introduced from the United states, is a main pigeon species produced by the current meat pigeons in China, but is accompanied by hybridization, inbreeding and blind seed selection, so that the white-feather king pigeon has mixed seed sources and good and uneven production performance. In recent years, some enterprises and scientific research units with larger scale start meat pigeon breeding work, but the meat pigeons are not cultivated into new national-grade varieties so far, which shows that the breeding of the meat pigeons lags behind that of other livestock and poultry such as chickens and pigs.
Molecular marker-assisted selection is a breeding technology which utilizes phenotypic data and genotypic data to select, has been widely applied to breeding of livestock and poultry such as pigs, cattle, chickens and the like, but is not common in breeding of meat pigeons. Poultry has low abdominal fat edible value, feed can be saved by reducing abdominal fat deposition, and therefore, the reduction of abdominal fat rate is one of the breeding targets of meat poultry. The inventor discovers that T100C mutation exists in exon 1 of liver type fatty acid binding protein (L-FABP) gene of white-feather king pigeons, and is obviously related to the abdominal fat rate of young pigeons, so that the abdominal fat rate of young pigeons can be reduced by breeding and improving the frequency of L-FABP allele T of a pigeon group, and the meat pigeon variety which is more grain-saving and more in line with human diet health is bred.
Disclosure of Invention
The invention aims to provide a molecular marker-assisted selection method for reducing the abdominal fat rate of a white-feather king pigeon squab. On the basis of conventional breeding, the marker-assisted selection is carried out by utilizing the L-FABP gene molecular marker, and the abdominal fat rate of the white-feather king pigeon and the squab is reduced generation by generation.
The specific technical scheme is as follows:
a molecular marker assisted selection method for reducing the abdominal fat rate of a white-feather king pigeon squab comprises the following steps:
step 1, establishing breeding basic group
Adult white-feather king pigeon breeding pigeons are selected as breeding basic groups, namely 0 generation. The breeding pigeons are bred in cages and numbered.
Step 2, breeding basic groups to obtain G1 generations
The breeding pigeons of the base group (generation 0) are continuously bred to obtain generation G1. Is hatched and fed by breeding pigeons.
Step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding.
Step 4, G1 generation backup breeding pigeon molecular marker auxiliary selection
(1) Individuals with feather color, shank color and the like which accord with the appearance characteristics, weight and the like of the variety, and with uniform body type are selected before pairing, and the seed reserving proportion is about 80 percent.
(2) Genotyping exon 1 of the hepatic fatty acid binding protein Gene (L-FABP) in selected individuals
① backup pigeon genome DNA extraction, extracting the genome DNA in young pigeon blood by phenol-chloroform method.
② L-FABP gene fragment PCR amplification, synthesizing PCR primer with upstream primer sequence CATCCCCACTGTCATCTCCA and downstream primer sequence ACCCCAAACCAACAATTGCA, and PCR amplification system of 20 μ L, wherein the genome DNA is 1 μ L, the upstream and downstream primers are 1 μ L respectively, and 2 × Premix Taq 10 μ L, ddH2O7 mu L; the PCR procedure was 94 ℃ for 5min followed by 35 cycles (94 ℃ 30s, 57 ℃ 45s, 72 ℃ 30s) followed by 72 ℃ for 10 min;
③ L-FABP genotype identification, DNA sequencing is carried out on the PCR product, and the obtained sequencing graph is compared with the T100C site genotype sequencing graph in the L-FABP gene exon 1 for genotype identification.
(3) In the selected individuals, genotype selection is performed again. TT type individuals are preferentially selected and TC type individuals are secondarily selected. If TT and TC individuals are deficient, they are supplemented by CC individuals. By the steps, the frequency of the pigeon group allele T can be improved generation by generation.
Step 5, the reserve breeding pigeons selected and reserved in G1 generation enter the breeding period for breeding
(1) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(2) Recording the performance: after the self-breeding pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of the breeding pigeons. And counting recorded data of one year, and selecting breeding pigeons with better reproduction performance and faster young pigeons to establish a breeding core group.
And 6, pure breeding and subculture of the core group breeding pigeons to obtain G2 generations.
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation. With the increase of generations, the breeding performance of breeding pigeons and the growth speed of young pigeons can be kept stable or improved to a certain extent, meanwhile, the frequency of L-FABP allele T can be improved generation by generation, and the abdominal fat rate of young pigeons is reduced.
The molecular marker-assisted selection method for reducing the squab belly fat rate of the white-feather pigeon disclosed by the invention is applied to the selection process aiming at the squab belly fat rate.
Compared with the prior art, the invention has the beneficial effects that:
poultry abdominal fat ratio property belongs to destructive measurement property, namely, the poultry abdominal fat ratio property can be measured only by slaughtering, and the conventional breeding method comprises the following steps: individuals with low abdominal fat rates were identified by slaughter assays and then selected using siblings. The L-FABP gene molecular marker provided by the invention has genetic association with abdominal fat rate, so that abdominal fat rate can be reduced through marker-assisted selection, and destructive measurement is avoided; in addition, early seed selection can be realized by marker-assisted selection, and the breeding progress is accelerated.
Drawings
FIG. 1 is a genotype plot of T100C locus in exon 1 of the L-FABP gene;
FIG. 2 is a flow chart of the breeding technique of each generation.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.
A molecular marker assisted selection method for reducing the abdominal fat rate of a white-feather king pigeon squab comprises the following steps:
step 1, establishing breeding basic group
Adult white-feather king pigeon breeding pigeons are selected as breeding basic groups, namely 0 generation. And breeding pigeons in cages and numbering.
Step 2, breeding basic groups to obtain G1 generations
The breeding pigeons of the base group (0 generation) are continuously bred to obtain 1 generation. Hatching and nursing by breeding pigeons.
Step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding.
Step 4, G1 generation backup breeding pigeon molecular marker auxiliary selection
(1) Before pairing, individuals with feather color, shank color and the like which accord with the appearance characteristics, weight and the like of the variety, and with uniform body type are selected and reserved in a proportion of about 80 percent.
(2) Carrying out genotype identification on exon 1 of liver type fatty acid binding protein gene (L-FABP) on individuals selected and remained in step (1)
① backup pigeon genome DNA extraction, extracting the pigeon genome DNA from young pigeon blood by phenol-chloroform method.
② L-FABP gene fragment PCR amplification, synthesizing PCR primer with upstream primer sequence CATCCCCACTGTCATCTCCA and downstream primer sequence ACCCCAAACCAACAATTGCA, and PCR amplification system of 20 μ L, wherein the genome DNA is 1 μ L, the upstream and downstream primers are 1 μ L respectively, and 2 × Premix Taq 10 μ L, ddH2O7 mu L; the PCR procedure was 94 ℃ for 5min followed by 35 cycles (94 ℃ 30s, 57 ℃ 45s, 72 ℃ 30s) followed by 72 ℃ for 10 min;
③ L-FABP genotype identification, DNA sequencing is carried out on the PCR product, and the obtained sequencing graph is compared with the T100C site genotype sequencing graph (figure 1) in the L-FABP gene exon 1 to carry out genotype identification.
(3) In the individuals selected in (1), genotype selection is further performed. TT type individuals are preferentially selected and TC type individuals are secondarily selected. If TT and TC individuals are deficient, they are supplemented by CC individuals. By the steps, the frequency of the pigeon group allele T can be improved generation by generation.
Step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(2) Recording the performance: after the self-breeding pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of the breeding pigeons. And counting recorded data of one year, and selecting breeding pigeons with better reproduction performance and faster young pigeons to establish a breeding core group.
And 6, pure breeding and subculture of the core group breeding pigeons to obtain G2 generations. The flow chart of each generation breeding technique is shown in figure 2.
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation. With the increase of generations, the breeding performance of breeding pigeons and the growth speed of young pigeons can be kept stable or improved to a certain extent, meanwhile, the frequency of L-FABP allele T can be improved generation by generation, and the abdominal fat rate of young pigeons is reduced.
Examples
Step 1, establishing breeding basic group
Adult white-feather king pigeon breeding pigeons are selected as breeding basic groups (0 generation), and the scale of the breeding pigeons of the basic groups is more than 1000 pairs. Breeding pigeons are bred in cages and numbered.
Step 2, breeding basic groups to obtain G1 generations
The basic group breeding pigeons are continuously bred to obtain G1 generations. Hatching and nursing by breeding pigeons.
Step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding. The number of the reserved breeding pigeons is more than 5000 total male pigeons and female pigeons.
Step 4, G1 generation backup pigeon molecular marker auxiliary selection
(1) Before pairing, individuals with feather color, shank color and the like which accord with the appearance characteristics, the moderate weight and the symmetric body type of the variety are selected and reserved, and the seed reserving proportion is about 80 percent, namely at least 2000 male pigeons and 2000 female pigeons are selected and reserved.
(2) And (3) carrying out genotype identification on the T100C locus in exon 1 of the liver fatty acid binding protein gene (L-FABP) of the individuals selected and remained in the step (1), wherein the TT type accounts for 17.0%, the TC type accounts for 42.6% and the CC type accounts for 40.4%. The allele T frequency was calculated to be 0.38. 94 slaughter test samples are obtained, the results are shown in table 1, and the T allele homozygosity is obviously reduced (P <0.05) so that the fat percentage of the squab abdomen is obviously reduced.
Table 1: genetic Effect of different genotypes of the L-FABP Gene (mean. + -. standard error)
| TT type | TC type | CC type | |
| Abdominal fat percentage,% | 0.7±0.15a | 1.3±0.14b | 1.2±0.11b |
(3) In the individuals selected in (1), genotype selection is further performed. Preferably, TT type individuals are retained, and then TC type individuals are retained, and if the number is insufficient, the TT type individuals are supplemented with CC type individuals. 1500 male pigeons and 1500 female pigeons are finally selected. By means of the first generation breeding, the frequency of the pigeon group allele T can be increased from 0.38 to 0.51.
Step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(2) Recording the performance: after the self-breeding pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of the breeding pigeons. Counting the recorded data of one year, selecting 1000 pairs of breeding pigeons with better reproduction performance and faster squab growth, and establishing a breeding core group.
Step 6, pure breeding and subculture of core group breeding pigeons to obtain G2 generations
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation. With the increase of generations, the reproductive performance of breeding pigeons and the growth speed of young pigeons can be kept stable or improved to a certain extent, meanwhile, the frequency of the L-FABP allele T can be improved generation by generation until the breeding pigeons are homozygous, and the abdominal fat percentage of the young pigeons is reduced.
The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.
SEQUENCE LISTING
<110> agriculture university of Anhui
<120> molecular marker-assisted selection method for reducing fat percentage of squab of Bai-feather king pigeon
<160>2
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213> Artificial Synthesis
<400>1
catccccact gtcatctcca 20
<210>2
<211>20
<212>DNA
<213> Artificial Synthesis
<400>2
accccaaacc aacaattgca 20
Claims (1)
1. A molecular marker assisted selection method for reducing the abdominal fat rate of a squab of Bai feather king is characterized by comprising the following steps:
step 1, establishing breeding basic group
Selecting adult white-feather king pigeon as breeding base group, namely 0 generation; breeding pigeons in cages and numbering;
step 2, breeding basic groups to obtain G1 generations
Continuously breeding basic group breeding pigeons to obtain G1 generations; hatching and feeding breeding pigeons;
step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, obviously smaller individuals are eliminated, and the reserved individuals wear foot rings with unique numbers to serve as individual identification; taking 0.2ml of blood from the pterygoid root vein while wearing the foot ring, and performing anticoagulation and freezing preservation for later use; after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeon house to serve as reserve breeding pigeons for breeding;
step 4, G1 generation backup pigeon molecular marker auxiliary selection
(1) Before pairing, selecting and reserving individuals with feather color and shank color according with the appearance characteristics, middle and upper weight and uniform body type of the variety, wherein the seed reserving proportion is about 80 percent;
(2) identifying genotype of liver type fatty acid binding protein gene L-FABP exon 1 for selected individuals
① backup pigeon genome DNA extraction, which comprises extracting the genome DNA from young pigeon blood by phenol-chloroform method;
② L-FABP gene fragment PCR amplification, synthesizing PCR primer with upstream primer sequence CATCCCCACTGTCATCTCCA and downstream primer sequence ACCCCAAACCAACAATTGCA, and PCR amplification system of 20 μ L, wherein the genome DNA is 1 μ L, the upstream and downstream primers are 1 μ L respectively, and 2 × Premix Taq 10 μ L, ddH2O7 mu L; the PCR program was 94 ℃ for 5min followed by 35 cycles of 94 ℃ for 30s, 57 ℃ for 45s, 72 ℃ for 30s, followed by 72 ℃ for 10 min;
③ L-FABP genotype identification, DNA sequencing is carried out on the PCR product, and the obtained sequencing graph is compared with the T100C locus genotype sequencing graph in the L-FABP gene exon 1 to carry out genotype identification;
(3) in the selected individuals, genotype selection is carried out; preferentially selecting and reserving TT type individuals and then selecting and reserving TC type individuals; supplementation by type CC individuals if TT and TC individuals are deficient; the frequency of the pigeon group allele T is increased generation by generation;
step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) Freely pairing selected breeding pigeons, successfully pairing the breeding pigeons, transferring the breeding pigeons to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree;
(2) recording the performance: after the self-breeding pigeons are paired, recording the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days; counting recorded data of one year, selecting breeding pigeons with better reproduction performance and faster squab growth to establish a breeding core group;
step 6, pure breeding and subculture of core group breeding pigeons to obtain G2 generations;
generation G2 is executed according to the steps 3-6 to obtain generation G3, and the cycle is repeated to obtain generation Gn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710004394.1A CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710004394.1A CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106755447A CN106755447A (en) | 2017-05-31 |
| CN106755447B true CN106755447B (en) | 2020-06-09 |
Family
ID=58949503
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710004394.1A Active CN106755447B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755447B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109349210B (en) * | 2018-10-22 | 2021-10-19 | 潜山县绿色养殖有限责任公司 | Seed selection method for simultaneously improving breeding power of meat breeding pigeons and growth speed of young pigeons |
| CN110367197B (en) * | 2019-08-26 | 2022-06-28 | 浙江省农业科学院 | Hybridization matching combination research method of meat pigeons |
| CN111235247A (en) * | 2020-03-05 | 2020-06-05 | 佛山科学技术学院 | Breeding method of low-abdominal-fat high-quality chickens |
| CN114847225A (en) * | 2022-05-05 | 2022-08-05 | 江苏省家禽科学研究所 | Pigeon breeding family recording method |
| CN117562019B (en) * | 2023-10-25 | 2024-09-06 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914623A (en) * | 2010-08-20 | 2010-12-15 | 中国农业大学 | Method for assisting identifying chicken with different fat traits and primer special for same |
| CN101921845A (en) * | 2010-09-18 | 2010-12-22 | 吉林大学 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
| CN104911273A (en) * | 2015-07-01 | 2015-09-16 | 山东大学 | Chicken FABP1 gene molecular genetic marker related to chicken good production traits and application thereof |
-
2017
- 2017-01-04 CN CN201710004394.1A patent/CN106755447B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914623A (en) * | 2010-08-20 | 2010-12-15 | 中国农业大学 | Method for assisting identifying chicken with different fat traits and primer special for same |
| CN101921845A (en) * | 2010-09-18 | 2010-12-22 | 吉林大学 | Molecular marker of liver fatty acid binding protein (L-FABP) as pork quality character and application thereof |
| CN104911273A (en) * | 2015-07-01 | 2015-09-16 | 山东大学 | Chicken FABP1 gene molecular genetic marker related to chicken good production traits and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| A novel SNP of liver-type fatty acid-binding protein gene in duck and its associations with the intramuscular fat;Jun He et al;《Mol Biol Rep》;20110511;第39卷;摘要 * |
| Identification of SNPs of the L-BABP and L-FABP and their Association with Growth and Body Composition Traits in Chicken;Yufang Zhao et al;《J. Poult. Sci.》;20131231;第50卷;摘要 * |
| Tissue Expression and Association with Fatness Traits of Liver Fatty Acid-Binding Protein Gene in Chicken;Q. Wang et al;《Poultry Science》;20061231;第85卷;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106755447A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755447B (en) | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon | |
| CN103898107B (en) | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs | |
| CN113699250B (en) | Molecular marker related to broiler feed conversion efficiency character and application thereof | |
| CN112002371B (en) | Genome selection method for residual feed intake of white-feather broilers | |
| CN108676897B (en) | SNP marker influencing daily gain traits of pigs and application thereof | |
| CN109362646B (en) | Low-cost white feather broiler matched seed production method | |
| CN113424794B (en) | Breeding method of new strain of high-quality disease-resistant local chicken | |
| CN104604794A (en) | Recessive white feather Beijing fatty chicken breeding method | |
| CN104186403A (en) | Cross-breeding method for farmed sheep | |
| CN107779516A (en) | A kind of SNP marker for influenceing pig birth weight character and its application | |
| CN104719255A (en) | Cultivation method for new black pig varieties | |
| CN111647663B (en) | Molecular genetic marker for chicken walking number character and application | |
| CN109105338B (en) | Seed production method of red-feather white-shell laying hen complete set line | |
| CN111213614A (en) | Method for molecular marker-assisted cultivation of fishy smell-free green-leg pockmarked-feather green-shell laying hens | |
| CN110358840A (en) | The SNP molecular genetic marker of TPP2 gene relevant to remaining feed intake | |
| CN106591467B (en) | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon | |
| CN109997788B (en) | Breeding method of short and small yellow-feather yellow-shank chickens | |
| CN107494415B (en) | Method for breeding new Guangdong yellow chickens | |
| CN113549699B (en) | Genome selection method for egg yield of white-feather broilers | |
| Villamor et al. | Genetic Diversity of Philippine Carabao (Bubalus bubalis) Using Mitochondrial DNA D-loop Variation: Implications to Conservation and Management. | |
| CN107711685A (en) | High-quality high anti-fast numerous new product chicken genescreen and combined method | |
| CN107047468B (en) | Method for breeding recessive white curly eucheuma chickens | |
| CN103074426B (en) | Fast detection method for chicken Pax7 gene 31 bp indel polymorphism and application thereof | |
| CN104542488A (en) | High quality black pork hybrid production method | |
| CN111213613A (en) | Molecular breeding method of black-feather green-foot powder-shell meat-egg dual-purpose chicken |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiang Runshen Inventor after: Wan Yi Inventor after: Zhou Bangyuan Inventor after: Huang Yuanyuan Inventor after: Wang Zhicheng Inventor after: Ma Chendong Inventor before: Wan Yi Inventor before: Jiang Runshen Inventor before: Zhou Bangyuan Inventor before: Huang Yuanyuan Inventor before: Wang Zhicheng Inventor before: Ma Chendong Inventor before: Dai Meng |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |