CN106591467B - Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon - Google Patents
Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon Download PDFInfo
- Publication number
- CN106591467B CN106591467B CN201710005015.0A CN201710005015A CN106591467B CN 106591467 B CN106591467 B CN 106591467B CN 201710005015 A CN201710005015 A CN 201710005015A CN 106591467 B CN106591467 B CN 106591467B
- Authority
- CN
- China
- Prior art keywords
- breeding
- pigeons
- pigeon
- generation
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000272201 Columbiformes Species 0.000 title claims abstract description 159
- 210000003205 muscle Anatomy 0.000 title claims abstract description 37
- 210000000481 breast Anatomy 0.000 title claims abstract description 20
- 239000003147 molecular marker Substances 0.000 title claims abstract description 20
- 238000010187 selection method Methods 0.000 title claims abstract description 11
- 238000009395 breeding Methods 0.000 claims abstract description 114
- 230000001488 breeding effect Effects 0.000 claims abstract description 108
- 230000002068 genetic effect Effects 0.000 claims abstract description 12
- 230000012447 hatching Effects 0.000 claims abstract description 8
- 101710189565 Fatty acid-binding protein, liver-type Proteins 0.000 claims abstract 8
- 101710188974 Fatty acid-binding protein, liver Proteins 0.000 claims abstract 7
- 108700028369 Alleles Proteins 0.000 claims description 10
- 239000008280 blood Substances 0.000 claims description 10
- 210000004369 blood Anatomy 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- 210000003746 feather Anatomy 0.000 claims description 4
- 238000003205 genotyping method Methods 0.000 claims description 4
- 230000017448 oviposition Effects 0.000 claims description 4
- 230000004083 survival effect Effects 0.000 claims description 4
- 210000003462 vein Anatomy 0.000 claims description 4
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 238000001712 DNA sequencing Methods 0.000 claims description 3
- 230000002950 deficient Effects 0.000 claims description 3
- 238000002205 phenol-chloroform extraction Methods 0.000 claims description 3
- 238000012163 sequencing technique Methods 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 2
- 230000002440 hepatic effect Effects 0.000 claims description 2
- 230000002194 synthesizing effect Effects 0.000 claims description 2
- 102100026745 Fatty acid-binding protein, liver Human genes 0.000 claims 2
- 230000010100 anticoagulation Effects 0.000 claims 1
- 238000007710 freezing Methods 0.000 claims 1
- 230000008014 freezing Effects 0.000 claims 1
- 238000004321 preservation Methods 0.000 claims 1
- 230000009469 supplementation Effects 0.000 claims 1
- 239000003550 marker Substances 0.000 abstract description 5
- 230000001066 destructive effect Effects 0.000 abstract description 3
- 238000005259 measurement Methods 0.000 abstract description 3
- 235000013372 meat Nutrition 0.000 description 9
- 108090000623 proteins and genes Proteins 0.000 description 7
- 244000144977 poultry Species 0.000 description 5
- 235000013594 poultry meat Nutrition 0.000 description 5
- 210000002976 pectoralis muscle Anatomy 0.000 description 4
- 238000003307 slaughter Methods 0.000 description 3
- 241000287828 Gallus gallus Species 0.000 description 2
- 241000282887 Suidae Species 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 235000013330 chicken meat Nutrition 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 108091022862 fatty acid binding Proteins 0.000 description 2
- 238000009399 inbreeding Methods 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 238000004519 manufacturing process Methods 0.000 description 2
- 230000000474 nursing effect Effects 0.000 description 2
- 230000000717 retained effect Effects 0.000 description 2
- 241000283690 Bos taurus Species 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000002349 favourable effect Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Environmental Sciences (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker auxiliary selection method for improving breast leg muscle rate of a white-feather king pigeon, which comprises the following steps: establishing a breeding basic group: selecting adult white-feather king pigeon as breeding base group, namely 0 generation; breeding pigeons in cages, and numbering the breeding pigeons; continuously breeding basic group parent pigeons to obtain G1 generation, hatching and feeding the parent pigeons; g1 replacement pigeon breeding; g1 generation backup pigeon molecular marker auxiliary selection; and (4) selecting seeds of the reserve pigeons selected and reserved in the G1 generation in the breeding period. And (5) carrying out pure reproduction and subculture to obtain G2 generation, and circulating the steps to obtain Gn generation. The L-FABP gene molecular marker provided by the invention has genetic association with the breast muscle rate and the leg muscle rate of the squab, so that the breast muscle rate and the leg muscle rate of the squab can be improved through marker-assisted selection, and destructive measurement is avoided; in addition, early seed selection can be realized by marker-assisted selection, and the breeding progress is accelerated.
Description
Technical Field
The invention belongs to the technical field of poultry genetic markers, and relates to a molecular marker-assisted selection method for improving the breast muscle rate and the leg muscle rate of a squab of a white-feather king pigeon.
Background
China is a big country for breeding meat pigeons, about 5000 ten thousand pairs of pigeons are bred in the country, and 8 hundred million young pigeons are produced every year. The growth of meat pigeons in China is mainly based on small-scale breeding of farmers, most of the meat pigeons are self-breeding and self-breeding, and because of inbreeding of small groups and lack of related breeding technologies, the production performance of the pigeon groups is poor or even degraded. The white-feather king pigeon is a variety introduced from the United states, is a main pigeon species produced by the current meat pigeons in China, but is accompanied by hybridization, inbreeding and blind seed selection, so that the white-feather king pigeon has mixed seed sources and good and uneven production performance. In recent years, some enterprises and scientific research units with larger scale start meat pigeon breeding work, but the meat pigeons are not cultivated into new nationally examined varieties so far, which shows that the meat pigeons are lagged behind other livestock and poultry such as chickens and pigs.
Molecular marker-assisted selection is a breeding technology which utilizes phenotypic data and genotypic data to select, has been widely applied to breeding of livestock and poultry such as pigs, cattle, chickens and the like, but is not common in breeding of meat pigeons. The inventor discovers that T1327C mutation exists in exon 2 of liver fatty acid binding protein gene (L-FABP) of white-feather king pigeons, allele C is a favorable gene of breast muscle rate and leg muscle rate of the young pigeons but does not affect the weight of the young pigeons, and therefore, the breast muscle rate and leg muscle rate of the young pigeons can be improved by breeding and improving the gene frequency of the L-FABP allele C of a pigeon group, so that the slaughtering performance of the young pigeons is improved, and the proportion of edible parts is increased.
Disclosure of Invention
The invention aims to provide a molecular marker-assisted selection method for improving the breast and leg muscle rate of a white-feather king pigeon squab. On the basis of conventional breeding, the marker-assisted selection is carried out by utilizing the L-FABP gene molecular marker, and the breast muscle rate and the leg muscle rate of the white-feather king pigeon squab are improved generation by generation.
The specific technical scheme is as follows:
a molecular marker assisted selection method for improving breast and leg muscle rate of a white-feather king pigeon comprises the following steps:
step 1, establishing breeding basic group
Adult white-feather king pigeons are selected as a breeding basic group, namely 0 generation. And breeding pigeons in cages and numbering.
Step 2, breeding basic groups to obtain G1 generations
The breeding pigeons of the base group (generation 0) are continuously bred to obtain generation G1. Is hatched and fed by breeding pigeons.
Step 3, G1 replacement pigeon breeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding.
Step 4, G1 generation backup pigeon molecular marker auxiliary selection
(1) Before pairing, individuals with feather color, shank color and the like which accord with the appearance characteristics, weight and the like of the variety, and with uniform body type are selected and reserved in a proportion of about 80 percent.
(2) Genotyping of the hepatic fatty acid binding protein Gene L-FABP in the selected individuals
① backup pigeon genome DNA extraction, extracting the genome DNA in young pigeon blood by phenol-chloroform method.
② L-FABP gene fragment PCR amplification, synthesizing PCR primer with upstream primer sequence GAAATCCTCACAGTTGGGCG and downstream primer sequence CTTGGCCTTCTCTCCTGTCA, and PCR amplification system of 20ul, wherein the genome DNA is 1 uL, the upstream and downstream primers are 1 uL respectively, and 2 × Premix Taq 10 u L, ddH2O7 mu L; the PCR program was 94 ℃ for 5min followed by 35 cycles of 94 ℃ for 30s, x ℃ for 45s, 72 ℃ for 30s, followed by 72 ℃ for 10 min;
③ L-FABP genotype identification DNA sequencing of the PCR product and comparing the obtained sequencing graph with that of the L-FABP genotype identification in FIG. 1 to carry out genotype identification all the sample individuals are classified as TT type, TC type or CC type.
(3) In the selected individuals, genotype selection is performed again. Type CC individuals are preferentially selected and type TC individuals are then selected and retained. If CC and TC individuals are deficient, they are supplemented by TT individuals. By this step, the frequency of the pigeon population allele C can be increased.
Step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(2) Recording the performance: after the self-breeding pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of the breeding pigeons. And counting recorded data of one year, and selecting breeding pigeons with better reproduction performance and faster young pigeons to establish a breeding core group.
And 6, carrying out pure propagation and subculture to obtain G2 generations.
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation. With the increase of generations, the breeding performance of breeding pigeons and the growth speed of young pigeons can be kept stable or improved to a certain extent, meanwhile, the frequency of the L-FABP allele C can be improved generation by generation, and the breast muscle rate and the leg muscle rate of young pigeons are improved.
The molecular marker-assisted selection method for improving the breast muscle rate and the leg muscle rate of the squab of white-feather king pigeons is applied to selection of the breast muscle rate and the leg muscle rate of meat pigeons.
Compared with the prior art, the invention has the beneficial effects that:
the chest muscle rate and leg muscle rate of the poultry belong to destructive measurement traits, namely the poultry needs to be slaughtered. The conventional breeding method comprises the following steps: individuals with high pectoral and leg muscle rates were identified by slaughter assays and then selected using siblings. The L-FABP gene molecular marker provided by the invention has genetic association with the pectoral muscle rate and the leg muscle rate, so that the pectoral muscle rate and the leg muscle rate can be improved through marker-assisted selection, and destructive measurement is avoided; in addition, early seed selection can be realized by marker-assisted selection, and the breeding progress is accelerated.
Drawings
FIG. 1 is L-FABP genotype identification;
FIG. 2 is a breeding scheme.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.
A molecular marker assisted selection method for improving breast and leg muscle rate of a white-feather king pigeon comprises the following steps:
step 1, establishing breeding basic group
Adult white-feather king pigeon breeding pigeons are selected as breeding basic groups (0 generation). Breeding pigeons in cages and numbering.
Step 2, breeding basic groups to obtain G1 generations
The 0 generation breeding pigeon is continuously bred, and G1 generation. Hatching and nursing by breeding pigeons.
Step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding.
Step 4, G1 generation backup pigeon molecular marker auxiliary selection
(1) Before pairing, individuals with feather color, shank color and the like which accord with the appearance characteristics, weight and the like of the variety, and with uniform body type are selected and reserved in a proportion of about 80 percent.
(2) L-FABP genotype identification of selected individuals
① backup pigeon genome DNA extraction, phenol-chloroform method is adopted to extract the genome DNA in the young pigeon blood.
② L-FABP gene segment PCR amplification, PCR primer synthesis, wherein the sequence of an upstream primer is GAAATCCTCACAGTTGGGCG, the sequence of a downstream primer is CTTGGCCTTCTCTCCTGTCA, the PCR amplification system is 20 mu L, wherein 1 mu L of genome DNA, 1 mu L of each of the upstream primer and the downstream primer and 2 × Premix Taq 10 mu L, ddH2O7 mu L are adopted, the PCR program is 94 ℃ for 5min, and then 35 cycles, 94 ℃ for 30s, 57 ℃ for 45s, 72 ℃ for 30s and then 72 ℃ for 10min are carried out.
③ genotyping of L-FABP the DNA sequencing of the PCR products was carried out and the resulting sequencing pattern compared to FIG. 1 for L-FABP genotyping all samples were classified as TT-type or TC-type or CC-type.
(3) In the individuals selected in (1), genotype selection is further performed. Type CC individuals are preferentially selected and type TC individuals are then selected and retained. If CC and TC individuals are deficient, they are supplemented by TT individuals. By this step, the frequency of the pigeon population allele C can be increased.
Step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(3) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(4) Recording the performance: after the self-parent pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of self-parent pigeons. Counting the recorded data of one year, and selecting the breeding pigeon with better reproduction performance and faster squab growth as a breeding core group.
And 6, pure breeding and subculture of the core group breeding pigeons to obtain G2 generations. The breeding technical scheme has a flow chart shown in figure 2.
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation.
Examples
A molecular marker assisted selection method for improving breast and leg muscle rate of a white-feather king pigeon comprises the following steps:
step 1, establishing breeding basic group
Adult white-feather king pigeon breeding pigeons are selected as 0 generation basic group for breeding, and the scale of the basic group breeding pigeons is more than 1000 pairs. Breeding pigeons are bred in cages and numbered.
Step 2, breeding basic groups to obtain G1 generations
The basic group breeding pigeons are continuously bred to obtain the G1 generation. Hatching and nursing by breeding pigeons.
Step 3, G1 generation reserve breeding pigeon feeding
When the young pigeons are 25 days old, the individuals with obviously smaller weight are eliminated, and the reserved individuals wear the foot rings with unique numbers to be used as individual identification. While wearing the foot ring, 0.2ml of blood is taken from the pterygoid root vein, and the blood is anticoagulated and frozen for later use. And after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeonry to serve as a reserve breeding pigeons for breeding. The number of the reserved breeding pigeons is more than 5000 total male pigeons and female pigeons.
Step 4, G1 generation backup breeding pigeon molecular marker auxiliary selection
(1) Before pairing, individuals with feather color, shank color and the like which accord with the appearance characteristics, the moderate weight and the symmetric body type of the variety are selected and reserved, and the seed reserving proportion is about 80 percent, namely at least 2000 male pigeons and 2000 female pigeons are selected and reserved.
(2) And (3) carrying out L-FABP genotype identification on the selected individuals, wherein the TT type accounts for 17%, the TC type accounts for 48% and the CC type accounts for 35%. The allele C frequency was calculated to be 0.59. 80 slaughter test samples are obtained, the results are shown in table 1, and the homozygosis of the C allele can be seen to be beneficial to improving the breast muscle rate and the leg muscle rate of the young pigeons.
Table 1: genetic Effect of different genotypes of the L-FABP Gene (mean. + -. standard error)
| TT type | TC type | CC type | |
| Chest muscle rate,% | 17.7±1.04 | 16.6±1.80 | 19.3±0.47 |
| Rate of leg muscles% | 9.8±0.53 | 9.2±0.97 | 10.8±0.18 |
(3) In the individuals selected in (1), genotype selection is further performed. The CC type individual is preferentially selected and reserved, the TC type individual is selected and reserved, and 1500 male pigeons and 1500 female pigeons are finally selected and reserved. By means of the first generation breeding, the frequency of the pigeon group allele C can be increased from 0.59 to 0.73.
Step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) And (3) freely pairing the selected breeding pigeons, successfully pairing the breeding pigeons, transferring to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree.
(2) Recording the performance: after the self-breeding pigeons are paired, the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days old are recorded for each pair of the breeding pigeons. Counting the recorded data of one year, selecting 1000 pairs of breeding pigeons with better reproduction performance and faster squab growth, and establishing a breeding core group.
Step 6, pure breeding and subculture of core group breeding pigeons to obtain G2 generations
And G2 generation is executed according to the steps 3-6 to obtain G3 generation, and the Gn generation is obtained by the circulation. With the increase of generations, the reproductive performance of breeding pigeons and the growth speed of young pigeons can be kept stable or improved to a certain extent, meanwhile, the frequency of the L-FABP allele C can be improved generation by generation until the breeding pigeons are homozygous, and the breast muscle rate and the leg muscle rate of the young pigeons are improved.
The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.
SEQUENCE LISTING
<110> agriculture university of Anhui
<120> molecular marker auxiliary selection method for improving breast leg muscle rate of white-feather pigeon
<160>2
<170>PatentIn version 3.3
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<400>1
gaaatcctca cagttgggcg 20
<210>2
<211>20
<212>DNA
<213> Artificial sequence
<400>2
cttggccttc tctcctgtca 20
Claims (1)
1. A molecular marker-assisted selection method for improving the breast muscle rate and the leg muscle rate of a white-feather king pigeon is characterized by comprising the following steps:
step 1, establishing breeding basic group
Selecting adult white-feather king pigeon as breeding base group, namely 0 generation; breeding pigeons in cages and numbering;
step 2, breeding basic groups to obtain G1 generations
Continuously breeding basic group breeding pigeons to obtain G1 generations; hatching and feeding breeding pigeons;
step 3, G1 replacement pigeon breeding
When the young pigeons are 25 days old, obviously smaller individuals are eliminated, and the reserved individuals wear foot rings with unique numbers to serve as individual identification; taking 0.2ml of blood from the pterygoid root vein while wearing the foot ring, and performing anticoagulation and freezing preservation for later use; after the young pigeons wear the foot rings, the young pigeons are transferred to a young pigeon house to serve as reserve breeding pigeons for breeding;
step 4, G1 generation backup pigeon molecular marker auxiliary selection
(1) Selecting the appearance, weight and body type of the reserve pigeons before pairing, selecting individuals with uniform body type and feather color, shin color and the like which accord with the appearance characteristics, moderate weight and the like of the variety, and reserving the seeds with a proportion of about 80 percent;
(2) genotyping of the hepatic fatty acid binding protein Gene L-FABP in the selected individuals
① backup pigeon genome DNA extraction, which comprises extracting the genome DNA from young pigeon blood by phenol-chloroform method;
② L-FABP gene fragment PCR amplification, synthesizing PCR primer with upstream primer sequence GAAATCCTCACAGTTGGGCG and downstream primer sequence CTTGGCCTTCTCTCCTGTCA, and PCR amplification system of 20 μ L, wherein the genome DNA is 1 μ L, the upstream and downstream primers are 1 μ L respectively, and 2 × Premix Taq 10 μ L, ddH2O7 mu L; the PCR program was 94 ℃ for 5min followed by 35 cycles of 94 ℃ for 30s, 57 ℃ for 45s, 72 ℃ for 30s, followed by 72 ℃ for 10 min;
③ L-FABP genotype identification, wherein the PCR product is subjected to DNA sequencing, and the obtained sequencing graph is compared with the L-FABP genotype identification to carry out genotype identification, all sample individuals are divided into TT type or TC type or CC type, wherein the TT type is a homozygote of liver type fatty acid binding protein gene L-FABP 1327 th base being T/T, the TC type is a heterozygote of liver type fatty acid binding protein gene L-FABP 1327 th base being T/C, and the CC type is a homozygote of liver type fatty acid binding protein gene L-FABP 1327 th base being C/C;
in the selected individuals, genotype selection is carried out; preferentially selecting and reserving CC type individuals, and then selecting and reserving TC type individuals; (ii) supplementation by type TT individuals if type CC and type TC individuals are deficient; by the steps, the frequency of the pigeon group allele C can be improved;
step 5, the reserve pigeons selected and reserved in G1 generation enter the breeding stage for seed selection
(1) Freely pairing selected breeding pigeons, successfully pairing the breeding pigeons, transferring the breeding pigeons to cage culture, checking the foot ring number of each pair of the breeding pigeons, manually adjusting pairing if the breeding pigeons have a genetic relationship, ensuring that the paired breeding pigeons have no genetic relationship, and registering a pedigree;
(2) recording the performance: after the self-breeding pigeons are paired, recording the egg laying number, the hatching number, the survival rate of the young pigeons and the weight of the young pigeons in 25 days; counting recorded data of one year, selecting breeding pigeons with better reproduction performance and faster squab growth to establish a breeding core group;
step 6, pure breeding and subculture of core group breeding pigeons to obtain G2 generations;
generation G2 is executed according to the steps 3-6 to obtain generation G3, and the cycle is repeated to obtain generation Gn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710005015.0A CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710005015.0A CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106591467A CN106591467A (en) | 2017-04-26 |
| CN106591467B true CN106591467B (en) | 2020-06-26 |
Family
ID=58582769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710005015.0A Active CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591467B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116034943B (en) * | 2023-01-04 | 2024-04-16 | 仲恺农业工程学院 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
| CN117562019B (en) * | 2023-10-25 | 2024-09-06 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1274841C (en) * | 2001-09-25 | 2006-09-13 | 李宁 | Mononucleotide polymorphism analyzing method for detecting chicken ventral fat character |
| CN1293205C (en) * | 2004-12-08 | 2007-01-03 | 东北农业大学 | Molecule marking method for foreshowing and identifying chicken abdomen fat content by A-FABP gene |
-
2017
- 2017-01-04 CN CN201710005015.0A patent/CN106591467B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106591467A (en) | 2017-04-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755447B (en) | Molecular marker-assisted selection method for reducing abdomen fat rate of white-feather king pigeon and young pigeon | |
| CN103898107B (en) | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs | |
| CN113699250B (en) | Molecular marker related to broiler feed conversion efficiency character and application thereof | |
| CN112002371B (en) | Genome selection method for residual feed intake of white-feather broilers | |
| CN107779516B (en) | It is a kind of influence pig birth weight character SNP marker and its application | |
| CN110218799A (en) | The molecular genetic marker of pig residue feed intake character and application | |
| CN113424794B (en) | Breeding method of new strain of high-quality disease-resistant local chicken | |
| CN103911373A (en) | Major SNP marker capable of affecting pork aliphatic acid and application of major SNP marker in breeding pigs meat quality heredity improvement | |
| CN102124997B (en) | Method for breeding two-point-pattern lacy duck new breed | |
| CN110358840A (en) | The SNP molecular genetic marker of TPP2 gene relevant to remaining feed intake | |
| CN106591467B (en) | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon | |
| CN111647663A (en) | Molecular genetic marker for chicken walking number character and application | |
| CN107494415B (en) | Method for breeding new Guangdong yellow chickens | |
| CN107711685A (en) | High-quality high anti-fast numerous new product chicken genescreen and combined method | |
| CN113549699A (en) | Genome selection method for egg number of white feather broilers | |
| CN106489829B (en) | method for producing seeds of shallow-feathered meat ducks | |
| CN116584434A (en) | Seed production method of slaughter type Sanhuang high-quality broiler chicken complete set | |
| CN111213613A (en) | Molecular breeding method of black-feather green-foot powder-shell meat-egg dual-purpose chicken | |
| CN114568384B (en) | Seed production method of early-maturing grain-saving stress-resistant broiler chicken complete set system | |
| CN114271237B (en) | Method for breeding long-short velvet self-sexing pigeons | |
| CN116098114A (en) | Seed production method for large-sized white duck with chicken head | |
| CN104886003A (en) | Hybridization method for improving porcine intramuscular fat content | |
| CN112226515B (en) | Application of chicken molecular marker combination as detection site for identifying chicken intramuscular fat width | |
| CN103966316A (en) | Microsatellite family identifying method for diploid misgurnus anguillicaudatus and application of method | |
| CN114645045B (en) | Primer group for breeding slow-feather homozygous yellow-foot partridge chicken and breeding method of fast yellow-foot partridge chicken suitable for slaughter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |