CN106591467A - Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon - Google Patents
Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon Download PDFInfo
- Publication number
- CN106591467A CN106591467A CN201710005015.0A CN201710005015A CN106591467A CN 106591467 A CN106591467 A CN 106591467A CN 201710005015 A CN201710005015 A CN 201710005015A CN 106591467 A CN106591467 A CN 106591467A
- Authority
- CN
- China
- Prior art keywords
- breeding
- pigeon
- squab
- pigeons
- generation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 239000003147 molecular marker Substances 0.000 title claims abstract description 20
- 238000010187 selection method Methods 0.000 title claims abstract description 10
- 241000272203 Columba Species 0.000 title abstract 4
- 210000000481 breast Anatomy 0.000 title abstract 4
- 210000003205 muscle Anatomy 0.000 title abstract 4
- 238000009395 breeding Methods 0.000 claims abstract description 92
- 230000001488 breeding effect Effects 0.000 claims abstract description 91
- 241000272201 Columbiformes Species 0.000 claims abstract description 89
- 101710189565 Fatty acid-binding protein, liver-type Proteins 0.000 claims abstract 5
- 101710188974 Fatty acid-binding protein, liver Proteins 0.000 claims abstract 4
- 210000002976 pectoralis muscle Anatomy 0.000 claims description 15
- 230000037396 body weight Effects 0.000 claims description 14
- 108700028369 Alleles Proteins 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 6
- 230000001850 reproductive effect Effects 0.000 claims description 6
- 230000004087 circulation Effects 0.000 claims description 5
- 230000002068 genetic effect Effects 0.000 claims description 5
- 238000010241 blood sampling Methods 0.000 claims description 4
- 238000007710 freezing Methods 0.000 claims description 4
- 239000000463 material Substances 0.000 claims description 4
- 230000001681 protective effect Effects 0.000 claims description 4
- 230000004083 survival effect Effects 0.000 claims description 4
- 238000011144 upstream manufacturing Methods 0.000 claims description 4
- 238000001712 DNA sequencing Methods 0.000 claims description 3
- 230000003190 augmentative effect Effects 0.000 claims description 3
- 239000008280 blood Substances 0.000 claims description 3
- 210000004369 blood Anatomy 0.000 claims description 3
- 239000012634 fragment Substances 0.000 claims description 3
- 238000002205 phenol-chloroform extraction Methods 0.000 claims description 3
- 239000012154 double-distilled water Substances 0.000 claims description 2
- 230000012447 hatching Effects 0.000 claims description 2
- 102100026745 Fatty acid-binding protein, liver Human genes 0.000 claims 3
- 238000000034 method Methods 0.000 abstract description 7
- 230000001066 destructive effect Effects 0.000 abstract description 2
- 230000001351 cycling effect Effects 0.000 abstract 1
- 238000005259 measurement Methods 0.000 abstract 1
- 235000013372 meat Nutrition 0.000 description 7
- 108090000623 proteins and genes Proteins 0.000 description 5
- 238000004519 manufacturing process Methods 0.000 description 3
- 239000003550 marker Substances 0.000 description 3
- 238000003307 slaughter Methods 0.000 description 3
- 241000287828 Gallus gallus Species 0.000 description 2
- 230000009286 beneficial effect Effects 0.000 description 2
- 108091022862 fatty acid binding Proteins 0.000 description 2
- 244000144980 herd Species 0.000 description 2
- 238000009399 inbreeding Methods 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 101100226596 Gallus gallus FABP gene Proteins 0.000 description 1
- 238000003975 animal breeding Methods 0.000 description 1
- 238000013475 authorization Methods 0.000 description 1
- 230000003111 delayed effect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 235000013336 milk Nutrition 0.000 description 1
- 239000008267 milk Substances 0.000 description 1
- 210000004080 milk Anatomy 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Environmental Sciences (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeons, and the method comprises the following steps: establishing a breeding basic group, to be more specific, selecting adult Columba breeding pigeons as the breeding basic group, namely 0 generation, wherein the adult Columba breeding pigeons are cultured in a cage, and are numbered; continuously breeding basic group parent pigeons to obtain G1 generation, wherein the G1 generation is incubated and fed by the breeding pigeons; feeding G1 generation reserve pigeons; performing molecular marker-assisted selection of the G1 generation reserve pigeons; selecting seeds from selected remained G1 generation reserve pigeons entering a breeding season; and performing purebreeding subculture to obtain G2 generation, and cycling from the step 3-step 6 to obtain Gn generation. The L-FABP gene molecular marker is genetically connected with the breast and leg muscle percentages of the young pigeons, the breast and leg muscle percentages of the young pigeons can be improved by molecular marker assisted selection, destructive measurement can be avoided; in addition, early seed selection can be achieved by means of the molecular marker assisted selection, and breeding progress can be accelerated.
Description
Technical field
The invention belongs to bird Genetic Markers field, is related to a kind of raising King pigeon squab chest muscle rate and leg flesh rate
Molecular marker-assisted selection method.
Background technology
China is pigeon for meat cultivation big country, and national breeding pigeon livestock on hand about 50,000,000 pairs produces squab 800,000,000 per year.China's pigeon for meat growth
Based on being cultivated on a small scale with peasant household, and great majority carry out home-bred and autophytic, because of microcommunity inbreeding and the related breeding technique of shortage, dove group
Production performance is not good or even degenerates.King pigeon is the kind introduced from the U.S., is the main dove kind of the current pigeon for meat production of China,
But along with hybridization, inbreeding, blindly choose seeds, cause King pigeon introduces a collection to mix, production performance it is very different.In recent years, one
Pigeon for meat breeding work is set about by a little larger enterprises and R＆D institution, but not yet cultivates into the new product of country's authorization so far
Kind, other livestock and poultry are delayed compared with chicken, pig etc. to show pigeon for meat breeding.
Molecular marker assisted selection is come the breeding technique of selection, in pig, ox, chicken using phenotypic data and genotype data
Deng having been obtained for wide application in Animal Breeding, however it is not yet common in pigeon for meat breeding.The present inventor's early-stage Study
It was found that, there is T1327C mutation, allele C in King pigeon liver fatty acid binding protein gene (L-FABP) exon 2
It is that the beneficial gene of squab chest muscle rate and leg flesh rate does not but affect the body weight of squab, therefore dove group L- can be improved by seed selection
Improving squab chest muscle rate and leg flesh rate, so as to improve the Slaughter of squab, increase can for the gene frequency of FABP allele Cs
The ratio of food part.
The content of the invention
It is an object of the invention to provide a kind of molecular marker assisted selection side for improving King pigeon squab breast-thigh yields
Method.On the basis of conventional herd breeding, using L-FABP gene molecule markers, carry out marker assisted selection, by generation white plumage king is improved
Pigeon's milk dove chest muscle rate and leg flesh rate.
Its concrete technical scheme is：
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps：
Step 1, breeding underlying group are set up
Select to grow up King pigeon as breeding underlying group, i.e., 0 from generation to generation.Breeding pigeon takes cage, numbering.
Step 2, underlying group breeding obtain G1 generations
Underlying group (0 from generation to generation) breeding pigeon is continuously bred, and obtains G1 generations.By breeding pigeon hatching, nurture.
Step 3, G1 are raised for standby dove
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, proceed to young dovecote to raise as standby breeding pigeon.
Step 4, G1 are for standby dove molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%.
(2) individuality to selecting and remain carries out the genotype identification of liver fatty acid binding protein gene L-FABP
1. standby dove extracting genome DNA：Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplification：Synthetic pcr primer thing：Upstream primer sequence is GAAATCCTCACAGTTGGGC
G, downstream primer sequence are CTTGGCCTTCTCTCCTGTCA；PCR amplification system is 20ul, wherein μ L of genomic DNA 1, up and down
The each 1 μ L of trip primer, 2 × Premix Taq 10 μ L, ddH2O 7μL；PCR programs are 94 DEG C of 5min, are followed by 35 and circulate, 94 DEG C
30s, x DEG C of 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min；
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, and gained sequencer map reflects with Fig. 1 L-FABP genotype
Surely comparing carries out genotype identification.All individual of sample are divided into TT types or TC types or CC types.
(3) in the individuality selected and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain
Body.If CC types and TC types are individual not enough, augmented by TT types are individual.Thus step, can improve the frequency of dove group's allele C
Rate.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory：From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, core is bred in squab growth breeding pigeon establishment faster
Group.
Step 6, pure breeding subculture, obtain G2 generations.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon
Reproductive performance, the speed of growth of squab can keep stable or certain lifting, while the frequency of L-FABP allele Cs can be by generation
Improve, squab chest muscle rate and leg flesh rate are also with improve.
The molecular marker-assisted selection method of King pigeon squab chest muscle rate and leg flesh rate that improves of the present invention is in pigeon for meat
Chest muscle rate and leg flesh rate are applied in selecting.
Compared with prior art, beneficial effects of the present invention are：
Poultry chest muscle rate and leg flesh rate proterties belong to destructive metric trait, that is, need to butcher.Conventional herd breeding method is：It is logical
Slaughter determining is crossed, the high individuality of chest muscle rate and leg flesh rate is determined, then using Sib selection.The L-FABP genes that the present invention is provided
Molecular labeling has genetic association with chest muscle rate and leg flesh rate, therefore chest muscle rate and leg flesh can be improved by marker assisted selection
Rate, it is to avoid destructiveness tolerance；In addition, early stage seed selection can be realized using marker assisted selection, accelerate Advances in Breeding.
Description of the drawings
Fig. 1 is L-FABP genotype identifications；
Fig. 2 is breeding procedures figure.
Specific embodiment
Below in conjunction with the accompanying drawings technical scheme is described in more detail with specific embodiment.
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps：
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as breeding underlying group (0 from generation to generation).Breeding pigeon cage, numbering.
Step 2, underlying group breeding obtain G1 generations
0 generation breeding pigeon is continuously bred, G1 generations.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, proceed to young dovecote to raise as standby breeding pigeon.
Step 4, G1 are for standby dove molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%.
(2) individuality to selecting and remain carries out L-FABP genotype identifications
1. standby breeding pigeon extracting genome DNA.Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplification.Synthetic pcr primer thing：Upstream primer sequence is GAAATCCTCACAGTTGGGC
G, downstream primer sequence are CTTGGCCTTCTCTCCTGTCA；PCR amplification system is 20 μ L, wherein μ L of genomic DNA 1, up and down
The each 1 μ L of trip primer, the μ L of 2 × Premix Taq 10, ddH2O7 μ L；PCR programs are 94 DEG C of 5min, are followed by 35 and circulate, 94 DEG C
30s, 57 DEG C of 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min.
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, and gained sequencer map compares with Fig. 1 carries out L-FABP bases
Because of type identification.All samples are divided into TT types or TC types or CC types.
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain
It is individual.If CC types and TC types are individual not enough, augmented by TT types are individual.Thus step, can improve the frequency of dove group's allele C
Rate.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(3) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(4) performance inventory：From after the pairing of close dove, egg number, chickling-surviving number, squab survival rate, the squab of each pair parent dove is recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain preferably, squab growth faster breeding pigeon as breeding core
Group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations.Breeding technique protocol procedures figure is shown in accompanying drawing 2.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.
Embodiment
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps：
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as 0 generation of breeding underlying group, underlying group breeding pigeon scale more than 1000 pairs.Breeding pigeon
Take cage and number.
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 from generation to generation.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number
As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring
Afterwards, proceed to young dovecote to raise as standby breeding pigeon.Standby breeding pigeon quantity male and female sum more than 5000.
Step 4, G1 are for standby breeding pigeon molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned
Body, ratio of reserving seed for planting about 80%, i.e., at least select and remain 2000 public doves, 2000 hen pigeons.
(2) individuality to selecting and remain carries out L-FABP genotype identifications, and TT types account for 17%, TC types and account for 48%, CC types 35%.Jing
Calculate, allele C frequency is 0.59.Sampling slaughter determining 80, the results are shown in Table 1, it is seen that C allele homozygosis contributes to carrying
High squab chest muscle rate and leg flesh rate.
Table 1：The hereditary effect (average ± standard error) of L-FABP gene different genotypes
| TT types | TC types | CC types | |
| Chest muscle rate, % | 17.7±1.04 | 16.6±1.80 | 19.3±0.47 |
| Leg flesh rate, % | 9.8±0.53 | 9.2±0.97 | 10.8±0.18 |
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain
Individuality, public dove 1500 of finally selecting and remain, hen pigeon 1500.Thus generation seed selection, can make the frequency of dove group's allele C by 0.59
Lifted to 0.73.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent
Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory：From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded
25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, squab grows breeding pigeon 1000 pairs faster, sets up
Breed core group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon
Reproductive performance, the speed of growth of squab can keep stable or certain lifting, while the frequency of L-FABP allele Cs can be by generation
Improve until homozygosis, squab chest muscle rate and leg flesh rate are also with improve.
The above, preferably specific embodiment only of the invention, protection scope of the present invention not limited to this are any ripe
Those skilled in the art are known in the technical scope of present disclosure, the letter of the technical scheme that can be become apparent to
Altered or equivalence replacement are each fallen within protection scope of the present invention.
SEQUENCE LISTING
<110>Agricultural University Of Anhui
<120>A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
gaaatcctca cagttgggcg 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
cttggccttc tctcctgtca 20
Claims (1)
1. a kind of molecular marker-assisted selection method for improving King pigeon squab chest muscle rate and leg flesh rate, it is characterised in that bag
Include following steps：
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as breeding underlying group, i.e., 0 from generation to generation；Breeding pigeon takes cage, numbering；
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 generations；By breeding pigeon hatching, nurture；
Step 3, G1 are raised for standby dove
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring conduct with unique number
Individual identification；While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby；Squab is worn after pin ring, is turned
Enter young dovecote to raise as standby breeding pigeon；
Step 4, G1 are for standby dove molecular marker assisted selection
(1) before matching to standby dove appearance, body weight, build selection, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features,
The medium on the upper side, individuality be well-proportioned of body weight, ratio of reserving seed for planting about 80%；
(2) individuality to selecting and remain carries out the genotype identification of liver fatty acid binding protein gene L-FABP
1. standby dove extracting genome DNA：Genomic DNA in squab blood is extracted using phenol-chloroform method；
2. L-FABP genetic fragments PCR amplification：Synthetic pcr primer thing：Upstream primer sequence be GAAATCCTCACAGTTGGGCG, under
Trip primer sequence is CTTGGCCTTCTCTCCTGTCA；PCR amplification system is 20 μ L, and the wherein μ L of genomic DNA 1, upstream and downstream is drawn
The each 1 μ L of thing, 2 × Premix Taq 10 μ L, ddH2O 7μL；PCR programs are 94 DEG C of 5min, are followed by 35 circulations, 94 DEG C of 30s, x
DEG C 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min；
3. L-FABP genotype identifications：PCR primer carries out DNA sequencing, gained sequencer map compare with L-FABP genotype identifications into
Row genotype identification；All individual of sample are divided into TT types or TC types or CC types；
(3) in the individuality selected and remain, then the selection for carrying out genotype；CC types of preferentially selecting and remain are individual, and next TC type of selecting and remain is individual；Such as
Fruit CC types and TC types are individual not enough, then augmented by TT types are individual；Thus step, can improve the frequency of dove group's allele C；
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if relationship is closed
System, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree；
(2) performance inventory：From after breeding pigeon pairing, the egg number of each pair breeding pigeon, chickling-surviving number, squab survival rate, squab 25 days are recorded
Age body weight；The statistics record material of a year, reproductive performance of selecting and remain is preferable, core group is bred in squab growth breeding pigeon establishment faster；
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations；
In G2 generations, perform according to step 3-6 and obtain G3 generations, and so circulation obtains Gn generations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710005015.0A CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710005015.0A CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106591467A true CN106591467A (en) | 2017-04-26 |
| CN106591467B CN106591467B (en) | 2020-06-26 |
Family
ID=58582769
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710005015.0A Active CN106591467B (en) | 2017-01-04 | 2017-01-04 | Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591467B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116034943A (en) * | 2023-01-04 | 2023-05-02 | 仲恺农业工程学院 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
| CN117562019A (en) * | 2023-10-25 | 2024-02-20 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1408885A (en) * | 2001-09-25 | 2003-04-09 | 李宁 | Mononucleotide polymorphism analyzing method for detecting chicken ventral fat character |
| CN1654681A (en) * | 2004-12-08 | 2005-08-17 | 东北农业大学 | Molecule marking method for foreshowing and identifying chicken abdomen fat content by A-FABP gene |
-
2017
- 2017-01-04 CN CN201710005015.0A patent/CN106591467B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1408885A (en) * | 2001-09-25 | 2003-04-09 | 李宁 | Mononucleotide polymorphism analyzing method for detecting chicken ventral fat character |
| CN1654681A (en) * | 2004-12-08 | 2005-08-17 | 东北农业大学 | Molecule marking method for foreshowing and identifying chicken abdomen fat content by A-FABP gene |
Non-Patent Citations (2)
| Title |
|---|
| PENG XIE等: "Molecular Cloning, Characterization, and mRNA Expression of Intestinal Fatty Acid Binding Protein (I-FABP) in Columba Livia", 《JAPAN POULTRY SCIENCE ASSOCIATION》 * |
| 颜士禄等: "脂肪酸的吸收与脂肪酸结合蛋白", 《饲料工业》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116034943A (en) * | 2023-01-04 | 2023-05-02 | 仲恺农业工程学院 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
| CN116034943B (en) * | 2023-01-04 | 2024-04-16 | 仲恺农业工程学院 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
| CN117562019A (en) * | 2023-10-25 | 2024-02-20 | 中国农业科学院北京畜牧兽医研究所 | Pigeon breeding method capable of avoiding inbreeding |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106591467B (en) | 2020-06-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101919367B (en) | Method for producing breed of black-shin dorking | |
| CN106755447A (en) | A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat | |
| CN102106296B (en) | Method for cultivating novel Dingyuan pig breed | |
| RU2721252C2 (en) | Hybrid dairy cattle and systems for maximizing the benefit of using the hybrid | |
| CN100496232C (en) | Novel selecting and breeding method for gift tilapia | |
| Jin et al. | The breeding history and commercial development of the Korean native chicken | |
| CN101288390A (en) | Wild pig, domestic pig and hybrid pig cross breeding and feeding method | |
| CN104186404B (en) | The hybridization breeding method of a kind of section agriculture mutton sheep new lines | |
| CN104186403B (en) | The hybridization breeding method of a kind of this sheep of agriculture | |
| CN102578041A (en) | Method for using Huai pigs to cultivate new pig breed and produce hybrid commercial pigs | |
| CN102187844B (en) | Method for culturing green-foot short and small recessive white feather egg chickens | |
| CN102124997B (en) | Method for breeding two-point-pattern lacy duck new breed | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN104823919B (en) | The breeding method of southeast of Guizhou Province Fructus Foeniculi chicken recessive white feather new lines and application | |
| CN107494410A (en) | A kind of method for the production depth shell color layer of green-shell egg that forms a complete set of | |
| CN104285884A (en) | Culture method of new Shanxi white pig variety | |
| CN110358819A (en) | A kind of breeding method of all-male crow spot hybridized snakehead fish | |
| CN107779516A (en) | A kind of SNP marker for influenceing pig birth weight character and its application | |
| CN106818552A (en) | A kind of method that Heterologous Sperm induces Mandarin fish artificial gynogenesis | |
| CN109349222A (en) | A kind of method that molecule auxiliary cultivates short-foot layer of green-shell egg strain | |
| CN109105338A (en) | A kind of producing method for seed of red plumage white shell egg chicken breed system | |
| CN106614356A (en) | Breeding method for Sumei black pigs | |
| CN104059877B (en) | Method for preparing 'imitated Belgian blue cattle' myostatin (MSTN) genetype gene editing pig | |
| CN106591467A (en) | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon | |
| CN107711685A (en) | High-quality high anti-fast numerous new product chicken genescreen and combined method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |