CN106591467A - Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon - Google Patents

Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon Download PDF

Info

Publication number
CN106591467A
CN106591467A CN201710005015.0A CN201710005015A CN106591467A CN 106591467 A CN106591467 A CN 106591467A CN 201710005015 A CN201710005015 A CN 201710005015A CN 106591467 A CN106591467 A CN 106591467A
Authority
CN
China
Prior art keywords
breeding
pigeon
squab
pigeons
generation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710005015.0A
Other languages
Chinese (zh)
Other versions
CN106591467B (en
Inventor
姜润深
万意
周帮园
黄媛媛
马陈东
王志成
戴猛
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Anhui Agricultural University AHAU
Original Assignee
Anhui Agricultural University AHAU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Anhui Agricultural University AHAU filed Critical Anhui Agricultural University AHAU
Priority to CN201710005015.0A priority Critical patent/CN106591467B/en
Publication of CN106591467A publication Critical patent/CN106591467A/en
Application granted granted Critical
Publication of CN106591467B publication Critical patent/CN106591467B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/02Breeding vertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Environmental Sciences (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeons, and the method comprises the following steps: establishing a breeding basic group, to be more specific, selecting adult Columba breeding pigeons as the breeding basic group, namely 0 generation, wherein the adult Columba breeding pigeons are cultured in a cage, and are numbered; continuously breeding basic group parent pigeons to obtain G1 generation, wherein the G1 generation is incubated and fed by the breeding pigeons; feeding G1 generation reserve pigeons; performing molecular marker-assisted selection of the G1 generation reserve pigeons; selecting seeds from selected remained G1 generation reserve pigeons entering a breeding season; and performing purebreeding subculture to obtain G2 generation, and cycling from the step 3-step 6 to obtain Gn generation. The L-FABP gene molecular marker is genetically connected with the breast and leg muscle percentages of the young pigeons, the breast and leg muscle percentages of the young pigeons can be improved by molecular marker assisted selection, destructive measurement can be avoided; in addition, early seed selection can be achieved by means of the molecular marker assisted selection, and breeding progress can be accelerated.

Description

A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields
Technical field
The invention belongs to bird Genetic Markers field, is related to a kind of raising King pigeon squab chest muscle rate and leg flesh rate Molecular marker-assisted selection method.
Background technology
China is pigeon for meat cultivation big country, and national breeding pigeon livestock on hand about 50,000,000 pairs produces squab 800,000,000 per year.China's pigeon for meat growth Based on being cultivated on a small scale with peasant household, and great majority carry out home-bred and autophytic, because of microcommunity inbreeding and the related breeding technique of shortage, dove group Production performance is not good or even degenerates.King pigeon is the kind introduced from the U.S., is the main dove kind of the current pigeon for meat production of China, But along with hybridization, inbreeding, blindly choose seeds, cause King pigeon introduces a collection to mix, production performance it is very different.In recent years, one Pigeon for meat breeding work is set about by a little larger enterprises and R&D institution, but not yet cultivates into the new product of country's authorization so far Kind, other livestock and poultry are delayed compared with chicken, pig etc. to show pigeon for meat breeding.
Molecular marker assisted selection is come the breeding technique of selection, in pig, ox, chicken using phenotypic data and genotype data Deng having been obtained for wide application in Animal Breeding, however it is not yet common in pigeon for meat breeding.The present inventor's early-stage Study It was found that, there is T1327C mutation, allele C in King pigeon liver fatty acid binding protein gene (L-FABP) exon 2 It is that the beneficial gene of squab chest muscle rate and leg flesh rate does not but affect the body weight of squab, therefore dove group L- can be improved by seed selection Improving squab chest muscle rate and leg flesh rate, so as to improve the Slaughter of squab, increase can for the gene frequency of FABP allele Cs The ratio of food part.
The content of the invention
It is an object of the invention to provide a kind of molecular marker assisted selection side for improving King pigeon squab breast-thigh yields Method.On the basis of conventional herd breeding, using L-FABP gene molecule markers, carry out marker assisted selection, by generation white plumage king is improved Pigeon's milk dove chest muscle rate and leg flesh rate.
Its concrete technical scheme is:
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps:
Step 1, breeding underlying group are set up
Select to grow up King pigeon as breeding underlying group, i.e., 0 from generation to generation.Breeding pigeon takes cage, numbering.
Step 2, underlying group breeding obtain G1 generations
Underlying group (0 from generation to generation) breeding pigeon is continuously bred, and obtains G1 generations.By breeding pigeon hatching, nurture.
Step 3, G1 are raised for standby dove
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring Afterwards, proceed to young dovecote to raise as standby breeding pigeon.
Step 4, G1 are for standby dove molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned Body, ratio of reserving seed for planting about 80%.
(2) individuality to selecting and remain carries out the genotype identification of liver fatty acid binding protein gene L-FABP
1. standby dove extracting genome DNA:Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplification:Synthetic pcr primer thing:Upstream primer sequence is GAAATCCTCACAGTTGGGC G, downstream primer sequence are CTTGGCCTTCTCTCCTGTCA;PCR amplification system is 20ul, wherein μ L of genomic DNA 1, up and down The each 1 μ L of trip primer, 2 × Premix Taq 10 μ L, ddH2O 7μL;PCR programs are 94 DEG C of 5min, are followed by 35 and circulate, 94 DEG C 30s, x DEG C of 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min;
3. L-FABP genotype identifications:PCR primer carries out DNA sequencing, and gained sequencer map reflects with Fig. 1 L-FABP genotype Surely comparing carries out genotype identification.All individual of sample are divided into TT types or TC types or CC types.
(3) in the individuality selected and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain Body.If CC types and TC types are individual not enough, augmented by TT types are individual.Thus step, can improve the frequency of dove group's allele C Rate.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory:From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded 25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, core is bred in squab growth breeding pigeon establishment faster Group.
Step 6, pure breeding subculture, obtain G2 generations.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon Reproductive performance, the speed of growth of squab can keep stable or certain lifting, while the frequency of L-FABP allele Cs can be by generation Improve, squab chest muscle rate and leg flesh rate are also with improve.
The molecular marker-assisted selection method of King pigeon squab chest muscle rate and leg flesh rate that improves of the present invention is in pigeon for meat Chest muscle rate and leg flesh rate are applied in selecting.
Compared with prior art, beneficial effects of the present invention are:
Poultry chest muscle rate and leg flesh rate proterties belong to destructive metric trait, that is, need to butcher.Conventional herd breeding method is:It is logical Slaughter determining is crossed, the high individuality of chest muscle rate and leg flesh rate is determined, then using Sib selection.The L-FABP genes that the present invention is provided Molecular labeling has genetic association with chest muscle rate and leg flesh rate, therefore chest muscle rate and leg flesh can be improved by marker assisted selection Rate, it is to avoid destructiveness tolerance;In addition, early stage seed selection can be realized using marker assisted selection, accelerate Advances in Breeding.
Description of the drawings
Fig. 1 is L-FABP genotype identifications;
Fig. 2 is breeding procedures figure.
Specific embodiment
Below in conjunction with the accompanying drawings technical scheme is described in more detail with specific embodiment.
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps:
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as breeding underlying group (0 from generation to generation).Breeding pigeon cage, numbering.
Step 2, underlying group breeding obtain G1 generations
0 generation breeding pigeon is continuously bred, G1 generations.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring Afterwards, proceed to young dovecote to raise as standby breeding pigeon.
Step 4, G1 are for standby dove molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned Body, ratio of reserving seed for planting about 80%.
(2) individuality to selecting and remain carries out L-FABP genotype identifications
1. standby breeding pigeon extracting genome DNA.Genomic DNA in squab blood is extracted using phenol-chloroform method.
2. L-FABP genetic fragments PCR amplification.Synthetic pcr primer thing:Upstream primer sequence is GAAATCCTCACAGTTGGGC G, downstream primer sequence are CTTGGCCTTCTCTCCTGTCA;PCR amplification system is 20 μ L, wherein μ L of genomic DNA 1, up and down The each 1 μ L of trip primer, the μ L of 2 × Premix Taq 10, ddH2O7 μ L;PCR programs are 94 DEG C of 5min, are followed by 35 and circulate, 94 DEG C 30s, 57 DEG C of 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min.
3. L-FABP genotype identifications:PCR primer carries out DNA sequencing, and gained sequencer map compares with Fig. 1 carries out L-FABP bases Because of type identification.All samples are divided into TT types or TC types or CC types.
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain It is individual.If CC types and TC types are individual not enough, augmented by TT types are individual.Thus step, can improve the frequency of dove group's allele C Rate.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(3) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(4) performance inventory:From after the pairing of close dove, egg number, chickling-surviving number, squab survival rate, the squab of each pair parent dove is recorded 25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain preferably, squab growth faster breeding pigeon as breeding core Group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations.Breeding technique protocol procedures figure is shown in accompanying drawing 2.
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.
Embodiment
A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields, comprises the following steps:
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as 0 generation of breeding underlying group, underlying group breeding pigeon scale more than 1000 pairs.Breeding pigeon Take cage and number.
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 from generation to generation.Hatched by breeding pigeon and fed.
Step 3, G1 are raised for standby breeding pigeon
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring with unique number As individual identification.While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby.Squab wears pin ring Afterwards, proceed to young dovecote to raise as standby breeding pigeon.Standby breeding pigeon quantity male and female sum more than 5000.
Step 4, G1 are for standby breeding pigeon molecular marker assisted selection
(1) match before, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, body weight it is medium it is on the upper side, be well-proportioned Body, ratio of reserving seed for planting about 80%, i.e., at least select and remain 2000 public doves, 2000 hen pigeons.
(2) individuality to selecting and remain carries out L-FABP genotype identifications, and TT types account for 17%, TC types and account for 48%, CC types 35%.Jing Calculate, allele C frequency is 0.59.Sampling slaughter determining 80, the results are shown in Table 1, it is seen that C allele homozygosis contributes to carrying High squab chest muscle rate and leg flesh rate.
Table 1:The hereditary effect (average ± standard error) of L-FABP gene different genotypes
TT types TC types CC types
Chest muscle rate, % 17.7±1.04 16.6±1.80 19.3±0.47
Leg flesh rate, % 9.8±0.53 9.2±0.97 10.8±0.18
(3) in the individuality that (1) selects and remain, then the selection for carrying out genotype.CC types of preferentially selecting and remain are individual, next TC type of selecting and remain Individuality, public dove 1500 of finally selecting and remain, hen pigeon 1500.Thus generation seed selection, can make the frequency of dove group's allele C by 0.59 Lifted to 0.73.
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if parent Edge relation, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree.
(2) performance inventory:From after breeding pigeon pairing, egg number, chickling-surviving number, squab survival rate, the squab of each pair breeding pigeon are recorded 25 age in days body weight.The statistics record material of a year, reproductive performance of selecting and remain is preferable, squab grows breeding pigeon 1000 pairs faster, sets up Breed core group.
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations
In G2 generations, perform according to step 3-6 and obtain G3 for numerous, so circulation, obtain Gn generations.With the increase of generation, breeding pigeon Reproductive performance, the speed of growth of squab can keep stable or certain lifting, while the frequency of L-FABP allele Cs can be by generation Improve until homozygosis, squab chest muscle rate and leg flesh rate are also with improve.
The above, preferably specific embodiment only of the invention, protection scope of the present invention not limited to this are any ripe Those skilled in the art are known in the technical scope of present disclosure, the letter of the technical scheme that can be become apparent to Altered or equivalence replacement are each fallen within protection scope of the present invention.
SEQUENCE LISTING
<110>Agricultural University Of Anhui
<120>A kind of molecular marker-assisted selection method for improving King pigeon squab breast-thigh yields
<160> 2
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213>Artificial sequence
<400> 1
gaaatcctca cagttgggcg 20
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
cttggccttc tctcctgtca 20

Claims (1)

1. a kind of molecular marker-assisted selection method for improving King pigeon squab chest muscle rate and leg flesh rate, it is characterised in that bag Include following steps:
Step 1, breeding underlying group are set up
Select to grow up King pigeon breeding pigeon as breeding underlying group, i.e., 0 from generation to generation;Breeding pigeon takes cage, numbering;
Step 2, underlying group breeding obtain G1 generations
Underlying group breeding pigeon is continuously bred, and obtains G1 generations;By breeding pigeon hatching, nurture;
Step 3, G1 are raised for standby dove
During 25 age in days of squab, obvious body weight individuality less than normal is eliminated, the individuality reserved seed for planting wears the pin ring conduct with unique number Individual identification;While wearing pin ring, wing root venous blood sampling 0.2ml, anti-freezing freezen protective is standby;Squab is worn after pin ring, is turned Enter young dovecote to raise as standby breeding pigeon;
Step 4, G1 are for standby dove molecular marker assisted selection
(1) before matching to standby dove appearance, body weight, build selection, plumage color of selecting and remain, shin color etc. meet this kind macroscopic features, The medium on the upper side, individuality be well-proportioned of body weight, ratio of reserving seed for planting about 80%;
(2) individuality to selecting and remain carries out the genotype identification of liver fatty acid binding protein gene L-FABP
1. standby dove extracting genome DNA:Genomic DNA in squab blood is extracted using phenol-chloroform method;
2. L-FABP genetic fragments PCR amplification:Synthetic pcr primer thing:Upstream primer sequence be GAAATCCTCACAGTTGGGCG, under Trip primer sequence is CTTGGCCTTCTCTCCTGTCA;PCR amplification system is 20 μ L, and the wherein μ L of genomic DNA 1, upstream and downstream is drawn The each 1 μ L of thing, 2 × Premix Taq 10 μ L, ddH2O 7μL;PCR programs are 94 DEG C of 5min, are followed by 35 circulations, 94 DEG C of 30s, x DEG C 45s, 72 DEG C of 30s, are followed by 72 DEG C of 10min;
3. L-FABP genotype identifications:PCR primer carries out DNA sequencing, gained sequencer map compare with L-FABP genotype identifications into Row genotype identification;All individual of sample are divided into TT types or TC types or CC types;
(3) in the individuality selected and remain, then the selection for carrying out genotype;CC types of preferentially selecting and remain are individual, and next TC type of selecting and remain is individual;Such as Fruit CC types and TC types are individual not enough, then augmented by TT types are individual;Thus step, can improve the frequency of dove group's allele C;
The standby dove that step 5, G1 generations select and remain is chosen seeds into breeding period
(1) breeding pigeon selected and remain freely is matched, and successful matching proceeds to cage, checks that each pair breeding pigeon pin ring is numbered, if relationship is closed System, then manually adjust pairing, it is ensured that pairing breeding pigeon affinity-less relation, and registers pedigree;
(2) performance inventory:From after breeding pigeon pairing, the egg number of each pair breeding pigeon, chickling-surviving number, squab survival rate, squab 25 days are recorded Age body weight;The statistics record material of a year, reproductive performance of selecting and remain is preferable, core group is bred in squab growth breeding pigeon establishment faster;
Step 6, core group breeding pigeon pure breeding subculture, obtain G2 generations;
In G2 generations, perform according to step 3-6 and obtain G3 generations, and so circulation obtains Gn generations.
CN201710005015.0A 2017-01-04 2017-01-04 Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon Active CN106591467B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710005015.0A CN106591467B (en) 2017-01-04 2017-01-04 Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710005015.0A CN106591467B (en) 2017-01-04 2017-01-04 Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon

Publications (2)

Publication Number Publication Date
CN106591467A true CN106591467A (en) 2017-04-26
CN106591467B CN106591467B (en) 2020-06-26

Family

ID=58582769

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710005015.0A Active CN106591467B (en) 2017-01-04 2017-01-04 Molecular marker-assisted selection method for improving breast and leg muscle rate of white-feather king pigeon

Country Status (1)

Country Link
CN (1) CN106591467B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116034943A (en) * 2023-01-04 2023-05-02 仲恺农业工程学院 Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk
CN117562019A (en) * 2023-10-25 2024-02-20 中国农业科学院北京畜牧兽医研究所 Pigeon breeding method capable of avoiding inbreeding

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1408885A (en) * 2001-09-25 2003-04-09 李宁 Mononucleotide polymorphism analyzing method for detecting chicken ventral fat character
CN1654681A (en) * 2004-12-08 2005-08-17 东北农业大学 Molecule marking method for foreshowing and identifying chicken abdomen fat content by A-FABP gene

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1408885A (en) * 2001-09-25 2003-04-09 李宁 Mononucleotide polymorphism analyzing method for detecting chicken ventral fat character
CN1654681A (en) * 2004-12-08 2005-08-17 东北农业大学 Molecule marking method for foreshowing and identifying chicken abdomen fat content by A-FABP gene

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
PENG XIE等: "Molecular Cloning, Characterization, and mRNA Expression of Intestinal Fatty Acid Binding Protein (I-FABP) in Columba Livia", 《JAPAN POULTRY SCIENCE ASSOCIATION》 *
颜士禄等: "脂肪酸的吸收与脂肪酸结合蛋白", 《饲料工业》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116034943A (en) * 2023-01-04 2023-05-02 仲恺农业工程学院 Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk
CN116034943B (en) * 2023-01-04 2024-04-16 仲恺农业工程学院 Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk
CN117562019A (en) * 2023-10-25 2024-02-20 中国农业科学院北京畜牧兽医研究所 Pigeon breeding method capable of avoiding inbreeding
CN117562019B (en) * 2023-10-25 2024-09-06 中国农业科学院北京畜牧兽医研究所 Pigeon breeding method capable of avoiding inbreeding

Also Published As

Publication number Publication date
CN106591467B (en) 2020-06-26

Similar Documents

Publication Publication Date Title
CN101919367B (en) Method for producing breed of black-shin dorking
RU2721252C2 (en) Hybrid dairy cattle and systems for maximizing the benefit of using the hybrid
CN106755447A (en) A kind of molecular marker-assisted selection method for reducing King pigeon squab abdominal fat
CN102106296B (en) Method for cultivating novel Dingyuan pig breed
Jin et al. The breeding history and commercial development of the Korean native chicken
CN100496232C (en) Novel selecting and breeding method for gift tilapia
CN104186404B (en) The hybridization breeding method of a kind of section agriculture mutton sheep new lines
CN104186403B (en) The hybridization breeding method of a kind of this sheep of agriculture
CN107201404A (en) A kind of molecular biology identification method and its application for Asparagus dioecian plant sex
CN102187844B (en) Method for culturing green-foot short and small recessive white feather egg chickens
CN102124997B (en) Method for breeding two-point-pattern lacy duck new breed
CN104823919B (en) The breeding method of southeast of Guizhou Province Fructus Foeniculi chicken recessive white feather new lines and application
CN107494410A (en) A kind of method for the production depth shell color layer of green-shell egg that forms a complete set of
CN104285884A (en) Culture method of new Shanxi white pig variety
CN107779516A (en) A kind of SNP marker for influenceing pig birth weight character and its application
CN106818552A (en) A kind of method that Heterologous Sperm induces Mandarin fish artificial gynogenesis
CN109349222A (en) A kind of method that molecule auxiliary cultivates short-foot layer of green-shell egg strain
CN109105338A (en) A kind of producing method for seed of red plumage white shell egg chicken breed system
CN104059877B (en) Method for preparing &#39;imitated Belgian blue cattle&#39; myostatin (MSTN) genetype gene editing pig
CN106591467A (en) Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon
CN107711685A (en) High-quality high anti-fast numerous new product chicken genescreen and combined method
CN109997788A (en) A kind of selection of dwarf-type Huang Yuhuang shin chicken
CN106069895A (en) The construction method of a kind of Heterologous Hybridization strain and offspring seed cultivation method thereof
CN101011038A (en) High-yield cultivation method by using dace as live bait fish for mandarin fish
CN107155959A (en) A kind of compound breeding method for improveing yellow catfish growing character

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant