CN104186403B - The hybridization breeding method of a kind of this sheep of agriculture - Google Patents
The hybridization breeding method of a kind of this sheep of agriculture Download PDFInfo
- Publication number
- CN104186403B CN104186403B CN201410382883.7A CN201410382883A CN104186403B CN 104186403 B CN104186403 B CN 104186403B CN 201410382883 A CN201410382883 A CN 201410382883A CN 104186403 B CN104186403 B CN 104186403B
- Authority
- CN
- China
- Prior art keywords
- sheep
- hybridization
- ewe
- body weight
- agriculture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Fodder In General (AREA)
Abstract
A hybridization breeding method for this sheep of agriculture, belongs to animal new lines breeding method field, and this breeding method does female parent with sheep, and Du Boyang is that male parent is hybridized, and produces F1For flock of sheep; Use F1Godmother sheep and the hybridization of sheep ram, F1For ram and the hybridization of sheep ewe, produce F2For flock of sheep, to F2Carry out natural breeding for flock of sheep, subculture seed selection, finally cultivates into this sheep of agriculture new lines; This sheep of agriculture new lines sheep of cultivating, hold the basic build macroscopic features of sheep, larger, the front body of physique and rear quarters fleshiness, grow fast, meat productivity is high, and adult weight ram reaches more than 90 kilograms, ewe is more than 60 kilograms, breeding potential is more than 220%, and strong adaptability, is suitable for drylot feeding and development fattening production.
Description
Technical field
The present invention relates to a kind of breeding method of animal new lines, specifically the hybridization cultivation side of a kind of this sheep of agricultureMethod.
Background technology
China's sheep husbandry is with a long history, is sheep raising big country in the world. In the last few years, in China, along with people's Living WaterFlat raising, people's food change of structure and more and more higher to the requirement of healthy food of having a strong smell, people are more next to the consumption figure of muttonLarger, thus the develop rapidly of Mutton Sheep Industry promoted. Sheep raising is got rich also becomes a large focus of current livestock. But therewithMeanwhile, in the time that traditional sheep husbandry makes the transition to modernization sheep husbandry fast, the low problem of productivity of sheep variety resource becomesThe important bottleneck of restriction modernization sheep husbandry development, in order to address this problem, China is from a lot of sheep countries from external introductionThe sheep variety of some advanced high-qualitys promotes the level of our national existing sheep variety, makes some progress, from certainIn journey, promote the coverage rate of breeding sheep. But China sheep variety source is very abundant, and different cultivars adapts to different ecologyType, the feeding and management method of different regions is different with forage resource in addition, to not adapting to this area sheep variety characteristic requirements also notWith. At present, sheep is raised and all introduces a fine variety raising in ground in China Henan, Hebei, Shandong, Shanxi, the Inner Mongol, Xinjiang etc., from warpIn Ji benefit, obtain good effect. But from steadily seed selection and breeding aspect of sheep variety resource self, but also existent defect, sheepPhysique is less than normal, enters to introduce a fine variety outward due to a large amount of, makes sheep source, sheep original producton location in short supply, for meeting the market requirement, and part original producton locationYang Chang has little time sheep to carry out seed selection and breeding meticulously, and quality is all sold, and even recalls to from the sheep of guiding to beyond original producton location againSell, thereby cause sheep colony production performance uneven, have a strong impact on the performance of this kind good characteristic. Henan ProvinceBe the Chinese large province of sheep raising, the variety source of continuous goat is also more, but excavation and improvement to these variety source excellent genesIn utilization, research and work lag behind, and have the situation of blindly introducing a fine variety blind hybridization, cause introduced variety not bring into play that it is due excellentGood characteristic, the valuable gene of local varieties is not also well preserved. In addition, some areas utilize introduced variety to local varietiesCarry out grading up and cultivated new product (kind) and be, new product (kind) be containing outer blood up to more than 75%, the new varieties of cultivation (being) bodily formAppearance, part producing performance are all to approach adventive, although promote the development of local sheep industry as a new breeding, realityIn matter, be the improvement to adventive, on the other hand, the most basic build appearance, merit etc. disappears gradually also to make land raceLose. As everyone knows, the first generation of hybrid has the hybrid vigour with 15%, utilizes grading up to two to carry with three generations's speed of growth from generation to generationHigh-amplitude is very little, and reproductive capacity further reduces. Henan Province is the Chinese large province of sheep raising, is " the weather of China sheep industry developmentTable ", flourish along with the rise of national Mutton Sheep Industry development, large quantities of mutton sheep enterprises and middle-size and small-size sheep raising field and partBody is high this merit of good sheep breeding potential per family, one after another from Jiangsu, zhejiang and other places introduces sheep and raises. After introduction,Because the ecological condition years such as feeding manner, weather ring environment change, make sheep in breeding process, go out series of problems, as diseaseThe incidence of disease improves, and grows and is obstructed etc., and this itself is exactly that the shortage of the seed selection and breeding aspect to this kind self is not enough and leadCause.
Summary of the invention
The object of the invention is to provide the hybridization breeding method of a kind of this sheep of agriculture, and this sheep of agriculture of cultivating is except having adaptabilityBy force, outside the high feature of lambing percentage, the meat of also having is good, fast, the meat build that grows is good, produce meat power carries high.
The present invention for solving the problems of the technologies described above adopted technical scheme is: the hybridization breeding method of a kind of this sheep of agriculture,Its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1 generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, male and female ratio 1:1-100 when hybridization, this ratio is preferably1:40-50; Environment temperature when breeding :-25 DEG C-34 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1-1%, bad ammoniaAcid 0.2-0.4% and methionine 0.1-0.2%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal essence toMaterial, every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and containing 10-15 gram of electrolysis multidimensional water to eweSolution, twice weekly;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: 12-25 DEG C,Humidity: 40-70%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: sugary80-100 gram of honey, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-in surplus18%; After six months, can transfer normal raising to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 12-25 DEG C, humidity:40-70%; The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: containing molasses80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-in surplus18%; After six months, can transfer normal raising to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six months
Age, body weight > 32kg, detected through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture, this agricultureThis sheep can reach 11-15mm at back-fat thickness in age in June, the ram body weight > 90kg that grows up, and ewe body weight > 70kg grows up.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours for sheep; After 7 daysFeed lamb and contain the whey powder that mass percent is 10-12%, the opening material that total protein content reaches 15-18%; 15 ages in days are to weaning periodBetween, feed lamb and contain the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described F1For sheep and F2The method that all adopts Phenotypic Selection and marker assisted selection to combine for the selection of sheep is selectedSelect.
Described hybridization, can adopt fresh smart dilution for many times technology of artificial insemination.
Beneficial effect is:
1, this sheep of agriculture hybridization breeding method of the present invention, does female parent with sheep, and Du Boyang is that male parent is hybridized, and produces Du HuGeneration flock of sheep; With Du lake generation ewe and the hybridization of sheep ram, Du lake generation ram and the hybridization of sheep ewe, produce Du's two generations of lakeFlock of sheep, to two generation flock of sheep update feeding and management condition, carry out strict ideal type individuality selection, carry out natural breeding,Subculture seed selection, is finally bred as this sheep of agriculture, and this strain has diamond level mutton gene and the 75% sheep gene of 25% Du Boyang, isA Types of Innovation for the outstanding local varieties sheep of China. Maintaining on the basis of sheep kind prolificacy performance, improveThe meat bodily form of sheep, improves table quality, makes to cultivate new lines except having the feature that sheep strong adaptability, lambing percentage are high,The meat of also having is good, and fast, the meat build that grows is good, product meat power is carried high.
2, this sheep of agriculture that this sheep of agriculture breeding method is cultivated, has kept the basic build macroscopic features of sheep, physique is large,Front body and rear quarters fleshiness, grow fast, and meat productivity is high, and adult weight ram reaches more than 90 kilograms, 60 kilograms of ewes withUpper, breeding potential is more than 220%, and strong adaptability, is suitable for drylot feeding and development fattening production.
Brief description of the drawings
Fig. 1 is the photo of this sheep of agriculture of the present invention.
Detailed description of the invention
A hybridization breeding method for this sheep of agriculture, this breeding method does female parent with sheep, and Du Boyang is that male parent is hybridized,Produce F1For flock of sheep; Use F1Godmother sheep and the hybridization of sheep ram, F1For ram and the hybridization of sheep ewe, produce F2For flock of sheep, to F2Carry out natural breeding for flock of sheep, subculture seed selection, finally cultivates into this sheep of agriculture;
A hybridization breeding method for this sheep of agriculture, its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, male and female ratio 1:1-100 when hybridization, this ratio is preferably1:40-50; Environment temperature when breeding :-25 DEG C-34 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1-1%, bad ammoniaAcid 0.2-0.4% and methionine 0.1-0.2%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal essence toMaterial, every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and containing 10-15 gram of electrolysis multidimensional water to eweSolution, twice weekly;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: 12-25 DEG C,Humidity: 40-70%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: sugary80-100 gram of honey, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-in surplus18%; After six months, can transfer normal raising to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 12-25 DEG C, humidity:40-70%; The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: containing molasses80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-in surplus18%; After six months, can transfer normal raising to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six months
Age, body weight > 32kg, detected through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture;
This sheep of agriculture of cultivating has following characteristics:
This sheep of agriculture ewe of cultivating: external form resembles sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hard hooves. JustMore than raw heavy 3kg, more than weaning weight 20kg, more than 6 monthly age lamb weight 32kg, 6-8 monthly age GR value (refers to the from the 12nd to the 13rd ribBetween bone, apart from the tissue thickness of ridge center line 11 centimeters) 11-15mm, (medium). More than birth weight 3kg, heavy 35kg of 6 monthly agesAbove, lambing percentage more than 220%, is grown up more than ewe body weight 70kg.
This sheep of agriculture ram of cultivating: bodily form appearance is similar to sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hoof matterSolid, more than birth weight 3.5kg, more than weaning weight 30kg, more than 6 monthly age lamb weight 43 ㎏, grow up more than ram 90kg. 6More than heavy 50kg of monthly age, and 6-8 monthly age GR value (refer to the from the 12nd to the 13rd rib, thick apart from organizing of ridge center line 11 centimetersDegree) 11-15mm. Lambing percentage is more than 220%.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours for sheep; After 7 daysFeed lamb and contain the whey powder that mass percent is 10-12%, the opening material that total protein content reaches 15-18%; 15 ages in days are to weaning periodBetween, feed lamb and contain the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described F1For sheep and F2The method that all adopts Phenotypic Selection and marker assisted selection to combine for the selection of sheep is selectedSelect.
Described hybridization, can adopt fresh smart dilution for many times technology of artificial insemination.
Embodiment 1
A hybridization breeding method for this sheep of agriculture, its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, environment temperature when male and female ratio 1:1 breeding when hybridizationDegree :-25 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1%, lysine0.2-0.4% and methionine 0.1%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 400 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to,Every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10 milliliters of ageratums and containing 10 grams of electrolysis multidimensional aqueous solution to ewe, everyTwice of week;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: 12-25 DEG C,Humidity: 40-70%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give feed 500 grams of fine fodders of every lamb every day, wherein: containing molasses 80Gram, 20 grams, 20 grams of coloured malts, 20 grams of dried orange peels and plant fat powder, the total protein content 16% in surplus; After six months, just can transfer toNormal raising is to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:1, this ratio is preferably 1:40-50; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:1, this ratio is preferably 1:40-50; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 12 DEG C, and humidity: 40%;The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give feed 500 grams of fine fodders of every lamb every day, wherein: containing 80 grams, molasses,20 grams, 20 grams of coloured malts, 20 grams of dried orange peels and plant fat powder, the total protein content 16% in surplus; After six months, can transfer to normalRaise to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six months
Age, body weight > 32kg, detected through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture;
This sheep of agriculture of cultivating has following characteristics:
This sheep of agriculture ewe of cultivating: external form resembles sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hard hooves. JustMore than raw heavy 3kg, more than weaning weight 20kg, more than 6 monthly age lamb weight 32kg, 6-8 monthly age GR value (refers to the from the 12nd to the 13rd ribBetween bone, apart from the tissue thickness of ridge center line 11 centimeters) 11-15mm, (medium). More than birth weight 3kg, heavy 35kg of 6 monthly agesAbove, lambing percentage more than 220%, is grown up more than ewe body weight 70kg.
This sheep of agriculture ram of cultivating: bodily form appearance is similar to sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hoof matterSolid, more than birth weight 3.5kg, more than weaning weight 30kg, more than 6 monthly age lamb weight 43 ㎏, grow up more than ram 90kg. 6More than heavy 50kg of monthly age, and 6-8 monthly age GR value (refer to the from the 12nd to the 13rd rib, thick apart from organizing of ridge center line 11 centimetersDegree) 11-15mm. Lambing percentage is more than 220%.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.4 milliliter in nascent latter 12 hours for sheep; Within 7 days, feed afterwards lambWhey powder, total protein content that sheep is 10% containing mass percent reach 15% opening material; 15 ages in days, between weaning period, are fed lamb and are containedMass percent is 4% whey powder, the fine fodder that total protein content reaches 14-16%.
Embodiment 2
A hybridization breeding method for this sheep of agriculture, its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, male and female ratio 1:100 when hybridization; Environment temperature when breedingDegree: 34 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 1%, lysine0.4% and methionine 0.2%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 600 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to,300 grams of every days;
(2), summer, ewe when drinking-water, drink 20 milliliters of ageratums and containing 15 grams of electrolysis multidimensional aqueous solution to ewe, everyTwice of week;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: be 25 DEG C, wetDegree: 70%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give feed 700 grams of fine fodders of every lamb every day, wherein: containing molasses 100Gram, 49 grams, 25 grams of coloured malts, 25 grams of dried orange peels and plant fat powder, the total protein content 18% in surplus; After six months, just can transfer toNormal raising is to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:100; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:100; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 25 DEG C, and humidity: 70%;The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give feed 700 grams of fine fodders of every lamb every day, wherein: containing molasses 100Gram, 49 grams, 25 grams of coloured malts, 25 grams of dried orange peels and plant fat powder, the total protein content 18% in surplus; After six months, just can transfer toNormal raising is to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six months
Age, body weight > 32kg, detected through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture;
This sheep of agriculture of cultivating has following characteristics:
This sheep of agriculture ewe of cultivating: external form resembles sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hard hooves. JustMore than raw heavy 3kg, more than weaning weight 20kg, more than 6 monthly age lamb weight 32kg, 6-8 monthly age GR value (refers to the from the 12nd to the 13rd ribBetween bone, apart from the tissue thickness of ridge center line 11 centimeters) 11-15mm, (medium). More than birth weight 3kg, heavy 35kg of 6 monthly agesAbove, lambing percentage more than 220%, is grown up more than ewe body weight 70kg.
This sheep of agriculture ram of cultivating: bodily form appearance is similar to sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hoof matterSolid, more than birth weight 3.5kg, more than weaning weight 30kg, more than 6 monthly age lamb weight 43 ㎏, grow up more than ram 90kg. 6More than heavy 50kg of monthly age, and 6-8 monthly age GR value (refer to the from the 12nd to the 13rd rib, thick apart from organizing of ridge center line 11 centimetersDegree) 11-15mm. Lambing percentage is more than 220%.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.6 milliliter in nascent latter 12 hours for sheep; Within 7 days, feed afterwards lambWhey powder, total protein content that sheep is 12% containing mass percent reach 18% opening material; 15 ages in days, between weaning period, are fed lamb and are containedMass percent is that 6% whey powder, total protein content reach 16% fine fodder.
Described F1For sheep and F2The method that all adopts Phenotypic Selection and marker assisted selection to combine for the selection of sheep is selectedSelect.
Described hybridization, adopts fresh smart dilution for many times technology of artificial insemination.
Embodiment 3
A hybridization breeding method for this sheep of agriculture, its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, male and female ratio 1:40 when hybridization; Environment temperature when breedingDegree: 25 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.5%, lysine0.3% and methionine 0.15%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 500 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to,280 grams of every days;
(2), summer, ewe when drinking-water, drink 15 milliliters of ageratums and containing 12 grams of electrolysis multidimensional aqueous solution to ewe, everyTwice of week;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: be 20 DEG C, wetDegree: 50%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give feed 600 grams of fine fodders of every lamb every day, wherein: containing molasses 90Gram, 30 grams, 22 grams of coloured malts, 22 grams of dried orange peels and plant fat powder, the total protein content 16-18% in surplus; After six months, can turnFor normal raising is to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:1-100, this ratio is preferably1:40-50; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 12-25 DEG C, humidity:40-70%; The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: containing molasses30 grams, 90 grams, 22 grams of coloured malts, 22 grams of dried orange peels and plant fat powder, the total protein content 16-18% in surplus; Can after six monthsTransfer normal raising to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six months
Age, body weight > 32kg, detected through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture;
This sheep of agriculture of cultivating has following characteristics:
This sheep of agriculture ewe of cultivating: external form resembles sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hard hooves. JustMore than raw heavy 3kg, more than weaning weight 20kg, more than 6 monthly age lamb weight 32kg, 6-8 monthly age GR value (refers to the from the 12nd to the 13rd ribBetween bone, apart from the tissue thickness of ridge center line 11 centimeters) 11-15mm, (medium). More than birth weight 3kg, heavy 35kg of 6 monthly agesAbove, lambing percentage more than 220%, is grown up more than ewe body weight 70kg.
This sheep of agriculture ram of cultivating: bodily form appearance is similar to sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hoof matterSolid, more than birth weight 3.5kg, more than weaning weight 30kg, more than 6 monthly age lamb weight 43 ㎏, grow up more than ram 90kg. 6More than heavy 50kg of monthly age, and 6-8 monthly age GR value (refer to the from the 12nd to the 13rd rib, thick apart from organizing of ridge center line 11 centimetersDegree) 11-15mm. Lambing percentage is more than 220%.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours for sheep; After 7 daysFeed lamb and contain the whey powder that mass percent is 10-12%, the opening material that total protein content reaches 15-18%; 15 ages in days are to weaning periodBetween, feed lamb and contain the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described F1For sheep and F2The method that all adopts Phenotypic Selection and marker assisted selection to combine for the selection of sheep is selectedSelect.
Described hybridization, adopts fresh smart dilution for many times technology of artificial insemination.
Embodiment 4
A hybridization breeding method for this sheep of agriculture, its breeding method comprises the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Described sheep ewe choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age mothersMore than lamb body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease;
Described sheep ram choice criteria: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated,Stenothorax, carries on the back straightly, and four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 monthly age public affairsMore than lamb body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Described Du moors ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length,Acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get that above-mentioned Du moors ram and sheep ewe hybridizes, male and female ratio 1:50 when hybridization; Environment temperature when breedingDegree: 30 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of beans to every day every ramMilk powder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional in fine fodder(composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.18%, lysine0.29% and methionine 0.17%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 490 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to,280 grams of every days;
(2), summer, ewe when drinking-water, drink 17 milliliters of ageratums and containing 12 grams of electrolysis multidimensional aqueous solution to ewe, everyTwice of week;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: be 20 DEG C, wetDegree: 50%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give feed 600 grams of fine fodders of every lamb every day, wherein: containing molasses 90Gram, 35 grams, 22 grams of coloured malts, 22 grams of dried orange peels and plant fat powder, the total protein content 16-18% in surplus; After six months, can turnFor normal raising is to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, chooses conditionBe:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, all individualMore than twins;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, 6 heavy > 40kg of monthly ages, individuality all fromMore than twins;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1The sheep ram that godmother plants sheep and chooses, hybridization, male and female ratio: 1:50; Produce F2Dai Yang;
Get the F choosing1For the public sheep ewe of planting sheep and choosing, hybridization, male and female ratio: 1:50; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 20 DEG C, and humidity: 50%;The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give feed 600 grams of fine fodders of every lamb every day, wherein: containing 90 grams, molasses,35 grams, 22 grams of coloured malts, 22 grams of dried orange peels and plant fat powder, the total protein content 16-18% in surplus; After six months, just can transfer toNormal raising is to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother sheep should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six monthly age bodiesHeavy > 32kg, detects through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for ram: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight> 35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture;
This sheep of agriculture of cultivating has following characteristics:
This sheep of agriculture ewe of cultivating: external form resembles sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hard hooves. JustMore than raw heavy 3kg, more than weaning weight 20kg, more than 6 monthly age lamb weight 32kg, 6-8 monthly age GR value (refers to the from the 12nd to the 13rd ribBetween bone, apart from the tissue thickness of ridge center line 11 centimeters) 11-15mm, (medium). More than birth weight 3kg, heavy 35kg of 6 monthly agesAbove, lambing percentage more than 220%, is grown up more than ewe body weight 70kg.
This sheep of agriculture ram of cultivating: bodily form appearance is similar to sheep, head is more delicate and prettier, and back of the body waist is straight, and rib is opened a business, hoof matterSolid, more than birth weight 3.5kg, more than weaning weight 30kg, more than 6 monthly age lamb weight 43 ㎏, grow up more than ram 90kg. 6More than heavy 50kg of monthly age, and 6-8 monthly age GR value (refer to the from the 12nd to the 13rd rib, thick apart from organizing of ridge center line 11 centimetersDegree) 11-15mm. Lambing percentage is more than 220%.
Described F1For sheep and F2In the time cultivating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours for sheep; After 7 daysFeed lamb and contain the whey powder that mass percent is 10-12%, the opening material that total protein content reaches 15-18%; 15 ages in days are to weaning periodBetween, feed lamb and contain the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described F1For sheep and F2The method that all adopts Phenotypic Selection and marker assisted selection to combine for the selection of sheep is selectedSelect.
About the genotypic qualification of this sheep of agriculture of the present invention:
Tachykinin is a kind of kassinin kinin class family, comprises that Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, neurokinin A (NKA), neurokinin B (NKB) and blood are thinBorn of the same parents' kassinin kinin (HK) etc. Research shows, brings into play in the mammalian reproduction such as people, mouse function aspects by hypothalamic pituitary gonadal axisImportant function. The gene TAC1 of fast peptide of encoding discharges swollen breast element as long-day Signal Regulation sheep hypophysis tubercle, thereby makes silk flossThere is seasonal breeding phenomenon in sheep. Because tachykinin is relevant with the breeding function of sheep, so as candidate gene, be used for studyingIts genetic diversity in sheep variety, or study the relevance of its specific gene site and a certain proterties of sheep. In this research,Utilize molecular breeding technology, i.e. marker assisted selection technology, only carries out seed selection and breeding to the sheep of cultivating.
The operating technology method relating to is as follows:
Taking TAC1 gene mRNA sequence as stencil design synthetic primer: TAC2S:5'AATCGCTCGGAGACCCAAG3'; TAC2AS:5'TTGTGAGAAAGCTGGCCATG3'. (its gene order is as SEQIDShown in NO:1 and SEQIDNO:2) target fragment length 1050bp when amplifying genom DNA, primer is respectively outside the 3rd and the 5thAobvious son is upper, after primer is synthetic across the 3rd and the 4th introne (450 and 472bp), carries out pcr amplification, to the product amplifyingPurifying order-checking, obtains the A/G sudden change at tachykinin TAC1 gene volume intron 2 295bp place of district. According to the property in mutational siteMatter, uses ScaEnzyme can be distinguished, during for A, can cut, and the feature that can not cut during for G, design enzyme is cut primer, PS:5'CCAAGAACAGGAATCAACC3', its base sequence of PAS:5'ATCAGAAGACACTGGCAGC3'(as SEQIDNO:3 andShown in SEQIDNO:4). Carry out restriction enzyme polymorphism analysis and present polymorphism. Find to exist in this sheep of agricultureTwo genotype, AA and AB; 2.13 of the only average lambing percentages of this sheep of agriculture AB genotype sheep, all have compared with prolificacy Ke YizuoFor marker assisted selection is carried out seed selection breeding.
The all feeds that the present invention is used and additive thereof, be conventional comprise Se-enriched feedstuff, electrolysis multidimensional, the material that stimulates the secretion of milk etc.Feed or additive, can be bought and be obtained by market.
SEQUENCELISTING
<110>University Of Science and Technology Of He'nan
<120>the hybridization breeding method of a kind of this sheep of agriculture
<130>1
<160>4
<170>PatentInversion3.3
<210>1
<211>19
<212>DNA
<213>artificial sequence
<400>1
aatcgctcggagacccaag19
<210>2
<211>20
<212>DNA
<213>artificial sequence
<400>2
ttgtgagaaagctggccatg20
<210>3
<211>19
<212>DNA
<213>artificial sequence
<400>3
ccaagaacaggaatcaacc19
<210>4
<211>19
<212>DNA
<213>artificial sequence
<400>4
atcagaagacactggcagc19
Claims (10)
1. a hybridization breeding method for this sheep of agriculture, is characterized in that: comprise the following steps:
Step 1, get sheep and become sheep, therefrom choose male kind sheep and femalely plant sheep, male and female stable breeding respectively;
Step 2, get Du Boyang and become sheep, therefrom choose the public sheep of planting, stable breeding separately;
Step 3, the female kind of the above-mentioned sheep of choosing sheep are all fed the Se-enriched feedstuff that is no less than a week before mating;
Step 4, outbreeding F1Generation:
Get above-mentioned Du and moor that male kind sheep and sheep are female to be planted sheep and hybridize, male and female ratio 1:1-100 when hybridization, environment when breedingTemperature :-25 DEG C-34 DEG C, outbreeding goes out F1Dai Yang;
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk to every day every ramPowder;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional 0.1-in fine fodder1%, lysine 0.2-0.4% and methionine 0.1-0.2%;
The feeding and management in step 5, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal fine fodder to,Every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and containing the 10-15 gram of electrolysis multidimensional aqueous solution to ewe,Twice weekly;
Step 6, the F that outbreeding is gone out1Feeding and management for sheep:
The F that outbreeding is gone out1For the ram in sheep and ewe, carry out to separate and cultivate, nurturing an environment temperature: 12-25 DEG C, humidity:40-70%; The cultivation time: birth is to reaching maturity certainly;
At F1For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: containing molasses 80-100 grams, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;After six months, can transfer normal raising to reaching maturity;
Step 7, choose F1In generation, is planted sheep:
The F that outbreeding goes out1After reaching maturity for sheep, therefrom select respectively F1The mother in generation plants sheep and male kind sheep, and the condition of choosing is:
Choose F1The mother in generation plants sheep: nascent body weight > 3kg, and weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from twoMore than tire;
Choose F1The public affairs kind sheep in generation: birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from twinsAbove;
Step 8, breeding F2In generation, is planted sheep:
Get the F choosing1Public sheep, hybridization, the male and female ratio: 1:1-100 of planting of sheep that godmother plants sheep and chooses; Produce F2Dai Yang;
Get the F choosing1Female sheep, hybridization, the male and female ratio: 1:1-100 of planting of the male sheep of planting sheep and choose of generation; Produce F2Dai Yang;
Step 9, to hybrid F2Cultivation for sheep:
The F that hybridization is produced2Ram and ewe in generation, separate and cultivate, and cultivates temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time: birth is to reaching maturity certainly;
F2For lamb from wean in six months, give every lamb fine fodder 500-700 gram that feeds every day, wherein: containing molasses 80-100Gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus; SixAfter month, can transfer normal raising to reaching maturity;
Step 10, F2The natural breeding in generation:
(1), choose F2In generation, is planted sheep:
The hybrid F choosing2Godmother plants sheep and should meet: nascent body weight > 3.0kg, weanling weight > 25kg, six monthly age body weight >32kg, detects through science of heredity, all containing twins gene;
The hybrid F choosing2Should meet for public kind sheep: nascent body weight > 3.5kg, weanling weight > 25kg, six monthly age body weight >35kg, detects through science of heredity, all containing twins gene;
（2）、F2The natural breeding in generation:
By the F choosing2Male kind sheep in generation and female kind sheep, mix stable breeding, and traversed by is fixed, and cultivates this sheep of agriculture, described this sheep of agricultureCan reach 11-15mm at back-fat thickness in age in June, the ram body weight > 90kg that grows up, ewe body weight > 70kg grows up.
2. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that: described F1For sheep and F2Training for sheepWhile educating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours; 7 days feed lamb is afterwards 10-12% containing mass percentWhey powder, total protein content reach the opening material of 15-18%; 15 ages in days are between weaning period, and hello lamb is 4-6% containing mass percentWhey powder, total protein content reach the fine fodder of 14-16%.
3. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that:
The female sheep choice criteria of planting of described sheep: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated, chestNarrow, to carry on the back straightly, four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 the monthly age ewe lambMore than body weight reaches 20 ㎏; More than 6 monthly age ewe 40 ㎏; More than becoming sheep ewe 50kg; Agenosomia official disease.
4. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that:
The public sheep choice criteria of planting of described sheep: sheepshead is long and narrow, bridge of the nose protuberance, eye is outstanding greatly, and ear is sagging greatly, acerous; Neck is elongated, chestNarrow, to carry on the back straightly, four limbs are very thin; Short broadtail, it is oblate that tail is greatly, and tail point upwarps; Whole body white; From polyembryony, 3 the monthly ages public lambMore than body weight reaches 25 ㎏; More than 6 monthly age ram 50 ㎏; More than becoming sheep ram 75kg; Agenosomia official disease.
5. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that:
Described Du moors the public sheep choice criteria of planting: Du's pool sheep physique is large, body body approximate circle tubbiness, and crown portion is straight, moderate length, nothingAngle, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width,Deeply, long thin tail, strong-limbed and moderate length, standing posture is rectified, and neck is black, and it is white that body drives with four limbs, nascent body weight 5㎏, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
6. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that: described F1For sheep and F2For the choosing of sheepSelect, the method that all can adopt Phenotypic Selection and marker assisted selection to combine is selected.
7. as the hybridization breeding method of claim 1-6 this sheep of agriculture as described in one of them, it is characterized in that: described hybridization,Can adopt fresh smart dilution for many times technology of artificial insemination.
8. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that: described Du moors public plant sheep and sheepFemale kind sheep hybridizes, male and female ratio 1:40-50 when hybridization.
9. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that: described F1Godmother plants sheep and sheepPublic sheep hybridization, the male and female ratio: 1:40-50 of planting.
10. the hybridization breeding method of this sheep of agriculture as claimed in claim 1, is characterized in that: described F1For public kind sheep and sheepFemale sheep hybridization, male and female ratio: 1:40-50 of planting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410382883.7A CN104186403B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of this sheep of agriculture |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2014101661853 | 2014-04-24 | ||
| CN201410166185.3 | 2014-04-24 | ||
| CN201410166185 | 2014-04-24 | ||
| CN201410382883.7A CN104186403B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of this sheep of agriculture |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104186403A CN104186403A (en) | 2014-12-10 |
| CN104186403B true CN104186403B (en) | 2016-05-04 |
Family
ID=52071923
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410382883.7A Expired - Fee Related CN104186403B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of this sheep of agriculture |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104186403B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293902B (en) * | 2014-02-20 | 2016-06-29 | 河南科技大学 | A kind of goat tachykinin TAC1 genetic polymorphism detection test kit and detection method |
| CN105557625B (en) * | 2015-12-11 | 2018-02-23 | 马边青山莲农业科技开发有限公司 | A kind of breeding method of mutton sheep |
| CN105557634A (en) * | 2016-01-21 | 2016-05-11 | 贵州省畜牧兽医研究所 | Method for breeding hornless black goats |
| CN110150218B (en) * | 2017-12-25 | 2021-11-23 | 兰州大学 | Method for breeding female parent strain of barn feeding type sheep |
| CN108812521A (en) * | 2018-05-04 | 2018-11-16 | 神木市旺洋农业有限责任公司 | The high numerous maternal breeding method of mutton sheep sheep |
| CN108967359A (en) * | 2018-07-17 | 2018-12-11 | 莱芜市嬴泰有机农业科技发展有限公司 | A kind of breeding method of middle areas in Shandong Province mutton sheep polyembryony strain |
| CN109247292A (en) * | 2018-08-03 | 2019-01-22 | 望谟县麻山黑山羊养殖有限责任公司 | A kind of cultural method improving black goat farrowing rate |
| CN109864041A (en) * | 2019-04-03 | 2019-06-11 | 天津市畜牧兽医研究所 | The production method and application of a kind of sheep corss combination system |
| CN113303282A (en) * | 2021-06-09 | 2021-08-27 | 临沂市农业科学院 | Method for improving early development of Qimeng black goats based on hybridization and mating device |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2148316C1 (en) * | 1999-02-18 | 2000-05-10 | Научно-исследовательский институт сельского хозяйства Юго-Востока | Method of selecting parent pairs in fine-fleece sheep breeding |
| CN102273429A (en) * | 2011-03-09 | 2011-12-14 | 龚华斌 | Method for breeding new strain of Jianyang big-ear goat |
| CN102405881A (en) * | 2011-08-17 | 2012-04-11 | 甘肃农业大学 | Method for breeding meat and wool dual-purpose new variety of Gansu alpine merino |
| CN103404484A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Dual-purpose sheep new strain cultivation method |
| CN103404482A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Highly-productive mutton sheep new strain breeding method |
| CN103503834A (en) * | 2013-09-26 | 2014-01-15 | 新疆维吾尔自治区畜牧科学院畜牧研究所 | Cultivation method for wool and mutton dual-purpose strain of China Merino sheep |
-
2014
- 2014-08-06 CN CN201410382883.7A patent/CN104186403B/en not_active Expired - Fee Related
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2148316C1 (en) * | 1999-02-18 | 2000-05-10 | Научно-исследовательский институт сельского хозяйства Юго-Востока | Method of selecting parent pairs in fine-fleece sheep breeding |
| CN102273429A (en) * | 2011-03-09 | 2011-12-14 | 龚华斌 | Method for breeding new strain of Jianyang big-ear goat |
| CN102405881A (en) * | 2011-08-17 | 2012-04-11 | 甘肃农业大学 | Method for breeding meat and wool dual-purpose new variety of Gansu alpine merino |
| CN103404484A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Dual-purpose sheep new strain cultivation method |
| CN103404482A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Highly-productive mutton sheep new strain breeding method |
| CN103503834A (en) * | 2013-09-26 | 2014-01-15 | 新疆维吾尔自治区畜牧科学院畜牧研究所 | Cultivation method for wool and mutton dual-purpose strain of China Merino sheep |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104186403A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104186403B (en) | The hybridization breeding method of a kind of this sheep of agriculture | |
| CN104186404B (en) | The hybridization breeding method of a kind of section agriculture mutton sheep new lines | |
| CN101878745B (en) | Production method of lean meat type hybrid miniature pigs | |
| CN108739656A (en) | A kind of quaternary lean meat pig breeding method | |
| CN101946749B (en) | Method for breeding red-head mutton goat new strain | |
| CN101120670B (en) | Method for cultivating meat and fine hair goat | |
| CN102124997B (en) | Method for breeding two-point-pattern lacy duck new breed | |
| CN101622969A (en) | Method for breeding non-polluted pigs with medicament-free fermented feed | |
| CN104186422B (en) | A kind of breeding method of high quality meat sheet new lines | |
| CN108522383A (en) | A kind of breeding method keeping Procambius clarkii merit | |
| CN103380761B (en) | Novel Yimeng black pig breeding method | |
| CN108184760A (en) | A kind of breeding method of black meat rabbit new lines | |
| CN105409856A (en) | Snakeheaded fish breeding method | |
| Hongtuo et al. | Culture of the oriental river prawn (Macrobrachium nipponense) | |
| CN104542488B (en) | A kind of hybridization production method of high-quality black Carnis Sus domestica | |
| CN104642264B (en) | Fast balance breeding method for native hen varieties | |
| CN111406710B (en) | Selective breeding method | |
| CN106818634A (en) | A kind of height is laid eggs dove automatic sexing matching method | |
| CN104642265B (en) | A kind of Fast-Balance breeding method of high-quality chicken breed | |
| CN106386670A (en) | Method for breeding Du-Sa black pigs in plateaus | |
| CN101288384B (en) | Black shrimp intraspecific hybridization method | |
| CN105994051A (en) | Method for breeding metapenaeus ensis in rice field | |
| CN105165682A (en) | Tilapia culture method | |
| CN104886003A (en) | Hybridization method for improving porcine intramuscular fat content | |
| CN104255658B (en) | A kind of Taihu pigs selection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160331 Address after: Luoning County, Henan province 471719 Luoyang Xishan Di Xiang sun Dong Cun, development of modern agricultural science and Technology Park Applicant after: NONGBEN ANIMAL HUSBANDRY DEVELOPMENT Co.,Ltd. Address before: 471000 Xiyuan Road, Jianxi District, Henan, No. 48, No. Applicant before: Henan University of Science and Technology |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20141210 Assignee: LUOYANG XIANGSHUN AGRICULTURE AND ANIMAL HUSBANDRY TECHNOLOGY Co.,Ltd. Assignor: NONGBEN ANIMAL HUSBANDRY DEVELOPMENT Co.,Ltd. Contract record no.: X2019980000954 Denomination of invention: Cross-breeding method for farmed sheep Granted publication date: 20160504 License type: Common License Record date: 20191210 |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160504 Termination date: 20210806 |