CN104186404B - The hybridization breeding method of a kind of section agriculture mutton sheep new lines - Google Patents
The hybridization breeding method of a kind of section agriculture mutton sheep new lines Download PDFInfo
- Publication number
- CN104186404B CN104186404B CN201410382958.1A CN201410382958A CN104186404B CN 104186404 B CN104186404 B CN 104186404B CN 201410382958 A CN201410382958 A CN 201410382958A CN 104186404 B CN104186404 B CN 104186404B
- Authority
- CN
- China
- Prior art keywords
- sheep
- generation
- hybrid
- ram
- ewe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Fodder In General (AREA)
Abstract
The breeding method of a kind of section agriculture mutton sheep new lines, relate to a kind of breeding method of sheep new lines, do female parent with the cold sheep of little tail, Du Boyang is that male parent is hybridized, obtain first generation of hybrid sheep, with polyembryony and Meat Performance and grow as main separation index, through strict seed selection, hybridize with the cold ram of the little tail of Du Han generation ewe of seed selection again, obtain the second generation of hybrid containing 1/4 Du's pool sheep blood, cold sheep ewe hybridizes for Du Han generation ram and little tail, equally also obtain the second generation of hybrid containing 1/4 Du's pool sheep blood, select and remain taking polyembryony and Meat Traits as main separation index basis female flock of sheep and ram, carrying out traversed by fixes, cultivate the agriculture mutton sheep new lines of graduating from old-type opera school, the section agriculture mutton sheep new lines sheep of cultivating, leg is slightly shorter than the cold sheep of little tail, and physique is large, it is fast to grow, and meat productivity is high, and meat is good, and breeding potential is more than 220%, and strong adaptability, is suitable for drylot feeding and development fattening production.
Description
Technical field
The present invention relates to a kind of breeding method of sheep new lines, specifically the hybridization breeding method of a kind of section agriculture mutton sheep new lines.
Background technology
China's sheep husbandry is with a long history, is sheep raising big country in the world. In the last few years, in China, along with the raising of people's living standard, people's food change of structure and more and more higher to the requirement of healthy food of having a strong smell, people are increasing to the consumption figure of mutton, thereby promoted the develop rapidly of Mutton Sheep Industry. Sheep raising is got rich also becomes a large focus of current livestock. But meanwhile, in the time that traditional sheep husbandry makes the transition to modernization sheep husbandry fast, the low problem of productivity of sheep variety resource becomes the important bottleneck of restriction modernization sheep husbandry development, in order to address this problem, China promotes the level of our national existing sheep variety from a lot of sheep countries from the sheep variety of external some advanced high-qualitys of introduction, make some progress, promoted the coverage rate of breeding sheep from certain journey. But China sheep variety source is very abundant, and different cultivars adapts to different ecotypes, and the feeding and management method of different regions is different with forage resource in addition, also different to adapting to this area sheep variety characteristic requirements. Henan Province is the Chinese large province of sheep raising, the variety source of continuous goat is also more, but the excavation to these variety source excellent genes and improvement utilize upper research and work to lag behind, there is the situation of blindly introducing a fine variety blind hybridization, cause introduced variety not bring into play its due good characteristic, the valuable gene of local varieties is not also well preserved. Some areas utilize introduced variety to carry out the grading new product (kind) of having cultivated to local varieties, new product (kind) is up to more than 75% containing outer blood, new varieties (being) bodily form appearance, part producing performance of cultivating are all to approach adventive, but when 6 monthly age, back fat fat is too thick, on the other hand, the most basic build appearance, merit etc. fades away also to make land race. Research on Du Hanyang shows, Du Han generation birth weight is lower than hybridization Parent, but higher than Du Han F2With Du Han F3. Before the wean of a Du Han generation, average daily gain is significantly higher than bis-generations of Du Han and Du Han three generations, and visible, grading up is very little to two generations and three generations's speed of growth increase rate, and reproductive capacity further reduces.
Summary of the invention
The present invention seeks to the deficiency for solving the problems of the technologies described above, the hybridization breeding method of a kind of section agriculture mutton sheep new lines is provided, section's agriculture meat mutton sheep new lines of cultivating has outside the feature that strong adaptability, lambing percentage are high, the meat of also having is good, and fast, the meat build that grows is good, product meat power is carried high.
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1:1-100, this ratio is preferably 1:40-50, the outbreeding first generation of hybrid, breeding temperature :-25 DEG C-34 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1-1%, lysine 0.2-0.4% and albumen propylhomoserin 0.1-0.2% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal fine fodder to, every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and containing the 10-15 gram of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), plant sheep and hybridize with the cold sheep ram of little tail female the above-mentioned first generation of hybrid chosen, male and female ratio: 1:100, this ratio is preferably 1:40-50; Produce second generation of hybrid sheep;
(4), plant sheep and hybridize with the cold sheep ewe of little tail public the above-mentioned first generation of hybrid chosen, male and female ratio: 1:1-100, this ratio is preferably 1:40-50; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school. This section agriculture mutton sheep new lines sheep, more than birth weight 3.5kg, more than 6 monthly age body weight 35kg, GR value 11-15mm; More than adult weight 70 ㎏, lambing percentage is more than 220%.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed long-acting scholar's mycin 0.4-0.6 milliliter in nascent latter 12 hours; Within 7 days, feed afterwards the whey powder that lamb is 10-12% containing mass percent, the opening material that total protein content reaches 15-18%; 15 ages in days, between weaning period, are fed lamb and are contained the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all can adopt Phenotypic Selection and marker assisted selection to combine is selected.
Described hybridization all can adopt fresh smart dilution for many times technology of artificial insemination.
Beneficial effect is:
1, the hybridization breeding method of section of the present invention agriculture mutton sheep new lines does female parent with the cold sheep of little tail, and Du Boyang is that male parent is hybridized, and produces Du Han generation flock of sheep; With Du Han generation ewe and the cold sheep ram hybridization of little tail, the cold sheep ewe hybridization of Du Han generation ram and little tail, produce Du Han bis-generations flock of sheep, to two generation flock of sheep update feeding and management condition, carry out strict ideal type individuality selection, carry out natural breeding, subculture seed selection, is finally bred as Lip river agriculture mutton sheep new lines, this strain has 25% the diamond level mutton gene of Du Boyang and the numerous gene of height of the cold sheep of 75% little tail, is a Types of Innovation for the cold sheep of the little tail of Chinese outstanding local varieties.
2, the present invention fully retains and utilizes the hybrid vigour of a Du Han generation, in line with developing cold this outstanding variety source of sheep of " Chinese national treasure " little tail, introducing a small amount of outer blood, improve its existing shortcoming and be bred as a kind of new lines mutton sheep, is the tremble with fear Types of Innovation of sheep of little tail. the present invention is directed to current this area sheep husbandry concrete condition designs, the ground such as little Wei Hanyang China Henan, Hebei, Shandong, Shanxi, the Inner Mongol, Xinjiang is raised and is all obtained good effect but also existent defect, the cold gigot of little tail is high, the present situations such as the proterties such as meat build is slightly poor, the inadequate the first transaction of a day's business of rib and the purebred lambing percentage of Du's pool sheep variety are low. utilize the cold sheep hybridization of Du pool sheep and little tail, acquisition has heterotic Du Han generation sheep, with polyembryony and Meat Performance and grow as main separation index, through strict seed selection, hybridize with the cold ram of the little tail of Du Han generation ewe of seed selection again, obtain the second generation of hybrid containing 1/4 Du's blood, cold sheep ewe hybridizes for Du Han generation ram and little tail, equally also obtain the second generation of hybrid containing 1/4 Du's blood, select and remain taking polyembryony and Meat Traits as main separation index basis female flock of sheep and ram, carrying out traversed by fixes, maintaining on the basis of the cold sheep variety prolificacy performance of little tail, improve the meat bodily form of the cold sheep of little tail, improve table quality, make to cultivate new lines except thering is the cold sheep sheep strong adaptability of little tail, outside the high feature of lambing percentage, the meat of also having is good, grow fast, meat build is good, produce meat power and carry high.
3, section's agriculture meat mutton sheep new lines maintains the basic build macroscopic features of the cold sheep of little tail, leg is slightly shorter than the cold sheep of little tail, physique is large, it is fast to grow, and meat productivity is high, and meat is good, adult weight ram reaches more than 90 kilograms, ewe is more than 70 kilograms, 6-8 monthly age back GR value 11-15mm, and breeding potential is more than 220%, strong adaptability, is suitable for drylot feeding and development fattening production.
Brief description of the drawings
Fig. 1 is the photo of section of the present invention agriculture mutton sheep new lines sheep.
Detailed description of the invention
The hybridization breeding method of a kind of section agriculture mutton sheep new lines, do female parent with the cold sheep of little tail, Du Boyang is that male parent is hybridized, obtain first generation of hybrid sheep, with polyembryony and Meat Performance and grow as main separation index, through strict seed selection, hybridize with the cold ram of the little tail of Du Han generation ewe of seed selection again, obtain the second generation of hybrid containing 1/4 Du's pool sheep blood, cold sheep ewe hybridizes for Du Han generation ram and little tail, equally also obtain the second generation of hybrid containing 1/4 Du's pool sheep blood, select and remain taking polyembryony and Meat Traits as main separation index basis female flock of sheep and ram, carrying out traversed by fixes, cultivate the agriculture meat mutton sheep new lines of graduating from old-type opera school,
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1:1-100, this ratio is preferably 1:40-50, the outbreeding first generation of hybrid, breeding temperature :-25 DEG C-34 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1-1%, lysine 0.2-0.4% and albumen propylhomoserin 0.1-0.2% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal fine fodder to, every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and containing the 10-15 gram of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), plant sheep and hybridize with the cold sheep ram of little tail female the above-mentioned first generation of hybrid chosen, male and female ratio: 1:100, this ratio is preferably 1:40-50; Produce second generation of hybrid sheep;
(4), plant sheep and hybridize with the cold sheep ewe of little tail public the above-mentioned first generation of hybrid chosen, male and female ratio: 1:1-100, this ratio is preferably 1:40-50; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed long-acting scholar's mycin 0.4-0.6 milliliter in nascent latter 12 hours; Within 7 days, feed afterwards the whey powder that lamb is 10-12% containing mass percent, the opening material that total protein content reaches 15-18%; 15 ages in days, between weaning period, are fed lamb and are contained the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all adopts Phenotypic Selection and marker assisted selection to combine is selected.
Described hybridization all can adopt fresh smart dilution for many times technology of artificial insemination.
Ewe and ram feature in gained section agriculture meat mutton sheep new lines are as follows:
Section agriculture meat mutton sheep new lines sheep ewe: bodily form appearance is similar to the cold sheep of little tail, head is more delicate and prettier, black face snip, back of the body waist is straight, rib is opened a business, hard hooves, 6 monthly age lamb GR values (referring to the from the 12nd to the 13rd rib, apart from the tissue thickness of ridge center line 11 centimeters) are 11-15mm. More than birth weight 3.5kg, more than heavy 35kg of 6 monthly ages, more than adult weight 70 ㎏, lambing percentage is more than 220%.
Section agriculture meat mutton sheep new lines sheep ram: bodily form appearance is similar to the cold sheep of little tail, and head is more delicate and prettier, black face snip, back of the body waist is straight, and rib is opened a business, and front body and rear quarters physically well develop, hard hooves, 6 monthly age lamb GR value 11-15mm. More than birth weight 4kg, more than weaning weight 30kg, more than heavy 50kg of 6 monthly ages, grow up more than ram 90kg.
Embodiment 1
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1 ︰ 1, the outbreeding first generation of hybrid, breeding temperature :-25 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.1%, lysine 0.2% and albumen propylhomoserin 0.1% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 400 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to, 200 grams of every days;
(2), summer, ewe when drinking-water, drink 10 milliliters of ageratums and containing 10 grams of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 12 DEG C, humidity: 40%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 500 grams of fine fodders of every lamb, wherein: containing 80 grams, molasses, 20 grams of coloured malts, 20 grams, 20 grams of dried orange peels and plant fat powder, the total protein content 16% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), by female the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ram hybridization of little tail, male and female ratio: 1:1 of planting; Produce second generation of hybrid sheep;
(4), by public the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ewe hybridization of little tail, the male and female ratio: 1:1 of planting; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12 DEG C, humidity: 40%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 500 grams of fine fodders of every lamb, wherein: containing 80 grams, molasses, 20 grams of coloured malts, 20 grams, 20 grams of dried orange peels and plant fat powder, the total protein content 16% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed 0.4 milliliter of long-acting scholar's mycin in nascent latter 12 hours; Within 7 days, feed afterwards whey powder, the total protein content that lamb is 10% containing mass percent and reach 15% opening material; 15 ages in days are between weaning period, and whey powder, total protein content that hello lamb is 4% containing mass percent reach 14% fine fodder.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all can adopt Phenotypic Selection and marker assisted selection to combine is selected.
Described hybridization all can adopt fresh smart dilution for many times technology of artificial insemination.
Embodiment 2
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1 ︰ 100, the outbreeding first generation of hybrid, breeding temperature: 34 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 1%, lysine 0.4% and albumen propylhomoserin 0.2% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 600 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to, 300 grams of every days;
(2), summer, ewe when drinking-water, drink 20 milliliters of ageratums and containing 15 grams of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 25 DEG C, humidity: 70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 700 grams of fine fodders of every lamb, wherein: containing molasses 80-100 gram, 25 grams of coloured malts, 49 grams, 25 grams of dried orange peels and plant fat powder, the total protein content 18% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), by female the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ram hybridization of little tail, male and female ratio: 1:100 of planting; Produce second generation of hybrid sheep;
(4), by public the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ewe hybridization of little tail, the male and female ratio: 1:100 of planting; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 25 DEG C, humidity: 70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 700 grams of fine fodders of every lamb, wherein: containing 100 grams, molasses, 25 grams of coloured malts, 49 grams, 25 grams of dried orange peels and plant fat powder, the total protein content 18% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed long-acting scholar's mycin 0.4-0.6 milliliter in nascent latter 12 hours; Within 7 days, feed afterwards whey powder, the total protein content that lamb is 12% containing mass percent and reach 18% opening material; 15 ages in days are between weaning period, and whey powder, total protein content that hello lamb is 6% containing mass percent reach 16% fine fodder.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all adopts Phenotypic Selection and marker assisted selection to combine is selected.
Described hybridization all adopts fresh smart dilution for many times technology of artificial insemination.
Embodiment 3
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1 ︰ 40; The outbreeding first generation of hybrid, breeding temperature: 30 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.14%, lysine 0.3% and albumen propylhomoserin 0.15% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 500 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to, 280 grams of every days;
(2), summer, ewe when drinking-water, drink 15 milliliters of ageratums and containing 12 grams of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 20 DEG C, humidity: 60%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 600 grams of fine fodders of every lamb, wherein: containing 90 grams, molasses, 23 grams of coloured malts, 30 grams, 22 grams of dried orange peels and plant fat powder, the total protein content 17% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), by female the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ram hybridization of little tail, male and female ratio: 1:40 of planting; Produce second generation of hybrid sheep;
(4), by public the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ewe hybridization of little tail, the male and female ratio: 1:40 of planting; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 600 grams of fine fodders of every lamb, wherein: containing 90 grams, molasses, 22 grams of coloured malts, 3 grams, 23 grams of dried orange peels and plant fat powder, the total protein content 17% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed 0.5 milliliter of long-acting scholar's mycin in nascent latter 12 hours; Within 7 days, feed afterwards whey powder, the total protein content that lamb is 11% containing mass percent and reach 17% opening material; 15 ages in days are between weaning period, and whey powder, total protein content that hello lamb is 5% containing mass percent reach 15% fine fodder.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all adopts Phenotypic Selection and marker assisted selection to combine is selected.
Embodiment 4
A hybridization breeding method for section's agriculture mutton sheep new lines, comprises the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively basis female breeding flock and the public breeding flock of the cold sheep of little tail;
The little tail ewe choice criteria of trembling with fear: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The little tail ram choice criteria of trembling with fear: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; Grow up more than ram 80kg, more than twins, agenosomia official disease
Step 2, from Du Boyang, choose the public sheep of planting, composition Du pool sheep basis ram group;
Du's pool ram choice criteria: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public lamb 5 ㎏ of Du's pool ram birth weight, public lamb 33 ㎏ of 3 monthly age body weight, 6 heavy public lamb 55 ㎏ of monthly age, 24 heavy ram 120 ㎏ of monthly age.
Step 3, feed the Se-enriched feedstuff that is no less than a week to before hybridization the cold ewe of little tail;
Step 4, get above-mentioned Du and moor the cold ewe of ram and little tail and hybridize, male and female ratio 1:50, the outbreeding first generation of hybrid, breeding temperature: 28 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional (composition mainly comprises VA, VE, VD3, VK, VB1, VB2, VB6, VB12, nicotinic acid, pantothenic acid, folic acid, biotin) 0.15%, lysine 0.32% and albumen propylhomoserin 0.18% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, 500 grams of every days, be used in conjunction 30 days, transfer normal fine fodder to, 280 grams of every days;
(2), summer, ewe when drinking-water, drink 18 milliliters of ageratums and containing 12 grams of electrolysis multidimensional aqueous solution, twice weekly to ewe;
The management of step 7, the first generation of hybrid and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 23 DEG C, humidity: 60%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 600 grams of fine fodders of every lamb, wherein: containing 90 grams, molasses, 22 grams of coloured malts, 30 grams, 24 grams of dried orange peels and plant fat powder, the total protein content 20% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, birth weight > 3.5kg, weaning weight > 30kg, heavy > 40kg of 6 monthly ages, individuality is all from more than twins;
(3), by female the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ram hybridization of little tail, male and female ratio: 1 ︰ 50 of planting; Produce second generation of hybrid sheep;
(4), by public the above-mentioned first generation of hybrid of choosing sheep and the cold sheep ewe hybridization of little tail, the male and female ratio: 1 ︰ 50 of planting; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day feed 550 grams of fine fodders of every lamb, wherein: containing 95 grams, molasses, 22 grams of coloured malts, 35 grams, 23 grams of dried orange peels and plant fat powder, the total protein content 17% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school.
Described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed 0.5 milliliter of long-acting scholar's mycin in nascent latter 12 hours; Within 7 days, feed afterwards whey powder, the total protein content that lamb is 11% containing mass percent and reach 16% opening material; 15 ages in days are between weaning period, and whey powder, total protein content that hello lamb is 5% containing mass percent reach 15% fine fodder.
Described first generation of hybrid sheep and and the selection of second generation of hybrid sheep, the method that all adopts Phenotypic Selection and marker assisted selection to combine is selected.
About the genotypic qualification of section agriculture mutton sheep new lines sheep of the present invention:
Tachykinin is a kind of kassinin kinin class family, comprises Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2, neurokinin A (NKA), neurokinin B (NKB) and hemokinin (HK) etc. Research shows, plays a significant role in the mammalian reproduction such as people, mouse function aspects by hypothalamic pituitary gonadal axis. The gene TAC1 of fast peptide of encoding discharges swollen breast element as long-day Signal Regulation sheep hypophysis tubercle, thereby makes sheep occur seasonal breeding phenomenon. Because tachykinin is relevant with the breeding function of sheep, thus as candidate gene, be used for studying its genetic diversity in sheep variety, or study the relevance of its specific gene site and a certain proterties of sheep. In this research, utilize molecular breeding technology, i.e. marker assisted selection technology, only carries out seed selection and breeding to the sheep of cultivating.
The operating technology method relating to is as follows:
Taking TAC1 gene mRNA sequence as stencil design synthetic primer: TAC2S:5'AATCGCTCGGAGACCCAAG3'; TAC2AS:5'TTGTGAGAAAGCTGGCCATG3'. Target fragment length 1050bp when (its gene order is as shown in SEQIDNO:1 and SEQIDNO:2) amplifying genom DNA, primer is respectively on the 3rd and the 5th extron, after synthetic across the 3rd and the 4th introne (450 and 472bp) primer, carry out pcr amplification, the product purification amplifying is checked order, obtain the A/G sudden change at tachykinin TAC1 gene volume intron 2 295bp place of district. According to the character in mutational site, use ScaEnzyme can be distinguished, during for A, can cut, and the feature that can not cut during for G, design enzyme is cut primer, PS:5'CCAAGAACAGGAATCAACC3', its base sequence of PAS:5'ATCAGAAGACACTGGCAGC3'(is as shown in SEQIDNO:3 and SEQIDNO:4). Carry out restriction enzyme polymorphism analysis and present polymorphism. Find to have 3 frequency of genotypes AA, AB and BB in section agriculture mutton sheep new lines sheep. 2.08 of the only average lambings of the agriculture mutton sheep new lines sheep AB of section genotype sheep, all have compared with prolificacy, can be used as marker assisted selection and carry out seed selection breeding.
The all feeds that the present invention is used and additive thereof, be common feedstuffs or additive comprise Se-enriched feedstuff, electrolysis multidimensional, the material that stimulates the secretion of milk etc., can be bought and be obtained by market.
SEQUENCELISTING
<110>University Of Science and Technology Of He'nan
<120>hybridization of a kind of section agriculture mutton sheep new lines
Breeding method
<130>1
<160>4
<170>PatentInversion3.3
<210>1
<211>19
<212>DNA
<213>artificial sequence
<400>1
aatcgctcggagacccaag
19
<210>2
<211>20
<212>DNA
<213>artificial sequence
<400>2
ttgtgagaaagctggccatg
20
<210>3
<211>19
<212>DNA
<213>artificial sequence
<400>3
ccaagaacaggaatcaacc
19
<210>4
<211>19
<212>DNA
<213>artificial sequence
<400>4
atcagaagacactggcagc
19
Claims (9)
1. a hybridization breeding method for section's agriculture mutton sheep new lines, is characterized in that: comprise the following steps:
Step 1, from the cold sheep of little tail, choose male and female kind sheep, form respectively the male breeding flock in basis and the female breeding flock of the cold sheep of little tail;
Step 2, from Du Boyang, choose the public sheep of planting, the public breeding flock in composition Du pool sheep basis;
Step 3, before hybridization, give that little tail is cold female plants sheep and feed the Se-enriched feedstuff that is no less than a week;
Step 4, get above-mentioned Du and moor that male kind sheep and little tail are cold femalely plants sheep and hybridize, male and female ratio: 1:1-100, the outbreeding first generation of hybrid, breeding temperature :-25 DEG C-34 DEG C;
The raising of step 5, hybridization phase:
The ram of hybridization phase is raised: on normal basis of raising, increase by 3 pieces of eggs and 30 grams of soymilk powder to every day every ram;
The ewe of hybridization phase is raised: on normal basis of raising, add by mass percentage electrolysis multidimensional 0.1-1%, lysine 0.2-0.4% and methionine 0.1-0.2% in fine fodder;
The feeding and management in step 6, ewe postpartum:
(1), ewe postpartum, add and feed the material that stimulates the secretion of milk for commercially available sock lamb, every day, 400-600 gram, was used in conjunction 30 days, transferred normal fine fodder to, every day 200-300 gram;
(2), summer, ewe when drinking-water, drink 10-20 milliliter ageratum and the aqueous solution containing 10-15 gram of electrolysis multidimensional, twice weekly to ewe;
The management of step 7, first generation of hybrid sheep and seed selection
The ram of the first generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The breeding of step 8, second generation of hybrid sheep
(1), the mother that chooses the first generation of hybrid plants sheep, nascent body weight > 3kg, weanling weight > 25kg, 6 monthly age body weight > 35kg, individuality is all from more than twins;
(2), choose the public affairs kind sheep of the first generation of hybrid, nascent body weight > 3.5kg, weanling weight > 30kg, 6 monthly age body weight > 40kg, individuality is all from more than twins;
(3), by female the above-mentioned first generation of hybrid of choosing sheep and the cold male kind sheep hybridization of little tail, male and female ratio: 1:1-100 of planting; Produce second generation of hybrid sheep;
(4), by the above-mentioned first generation of hybrid of choosing male kind sheep and cold female sheep hybridization, the male and female ratio: 1:1-100 of planting of little tail; Produce second generation of hybrid sheep;
Step 9, the sheep cultivation of two generations: the ram of the second generation of hybrid and ewe separation are cultivated, cultivated temperature: 12-25 DEG C, humidity: 40-70%; The cultivation time is 6 months;
Lamb from wean to 6 months, every day every lamb fine fodder 500-700 gram that feeds, wherein: containing molasses 80-100 gram, coloured malt 20-25 gram, dried orange peel 20-25 gram and plant fat powder 20-49 gram, the total protein content 16-18% in surplus;
The cultivation of step 10, section's agriculture mutton sheep new lines
(1), choose second generation of hybrid ewe according to following standard:
More than nascent body weight 3.0kg, more than weanling weight 25kg, more than 6 monthly age body weight 32kg; Detect through science of heredity, all containing twins gene;
(2), choose second generation of hybrid ram according to following standard: more than nascent body weight 3.5kg, more than weanling weight 25kg, more than 6 monthly age body weight 35kg; Detect through science of heredity, all containing twins gene;
(3), by above-mentioned choose two generation ram and ewe, mix stable breeding, traversed by is fixed, group expanding is cultivated the agriculture mutton sheep new lines of graduating from old-type opera school, this section agriculture mutton sheep new lines sheep, more than nascent body weight 3.5kg, more than 6 monthly age body weight 35kg, GR value 11-15mm; More than adult weight 70 ㎏, lambing percentage is more than 220%.
2. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, is characterized in that: described first generation of hybrid sheep and second generation of hybrid sheep, in the time cultivating, feed long-acting terramycin 0.4-0.6 milliliter in nascent latter 12 hours; Within 7 days, feed afterwards the whey powder that lamb is 10-12% containing mass percent, the opening material that total protein content reaches 15-18%; 15 ages in days, between weaning period, are fed lamb and are contained the whey powder that mass percent is 4-6%, the fine fodder that total protein content reaches 14-16%.
3. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, it is characterized in that: the selection of basic flock of sheep in step 1, step 8 are selected standby ewe and ram in first generation of hybrid sheep, step 10 is selected standby ewe and ram in second generation of hybrid sheep, and the method that all adopts Phenotypic Selection and molecular marker assisted selection to combine is selected.
4. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, it is characterized in that: the cold female sheep choice criteria of planting of little tail: sheepshead type is delicate and pretty, pale, the thin eyelid blood-shot eye illness end, only have angle base without obvious angle, ear is sagging greatly, coarse wool type, the wide buttocks of waist is large, polyembryony, nipple are many, utilizes Molecular Marker Assisted Selection Technology to identify all containing polyembryony gene, and adult body weighs more than 70 kilograms;
The cold public sheep choice criteria of planting of little tail: the large neck of ram head is thick, has flourishing helicity big angle; Front body prosperity, chest is wide dark, and rib is opened a business, and back of the body waist is straight; Body body is long, is barrel-shaped; Four limbs are high, healthy and strong rectifying; Short broadtail, turns on tail point; Whole body is by hair white; More than the ram body weight of growing up reaches 80kg, more than twins, agenosomia official disease.
5. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, is characterized in that: the public sheep choice criteria of planting of Du's pool: Du's pool sheep physique is large, body body approximate circle tubbiness; Crown portion is straight, moderate length, and acerous, volume is wide, bridge of the nose protuberance, ear is greatly slightly vertical, neck tubbiness, shoulder breadth is thick, shirtfront is plentiful, carry on the back straight, rib bed vault circle, body body length and width, dark; Long thin tail; Strong-limbed and moderate length, standing posture is rectified; Neck is black, and it is white that body drives with four limbs, public nascent body weight 5 ㎏ that plant sheep of Du's pool, 3 monthly age body weight 33 ㎏, 6 monthly age body weight 55 ㎏, 24 monthly age body weight 120 ㎏.
6. as the hybridization breeding method of the section agriculture mutton sheep new lines of claim 1-5 as described in one of them, it is characterized in that: described hybridization all can adopt fresh smart dilution for many times technology of artificial insemination.
7. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, is characterized in that: described Du moors male kind sheep and the cold female kind sheep of little tail hybridizes, male and female ratio when hybridization: 1:40-50.
8. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, is characterized in that: female sheep and the cold male kind sheep hybridization of little tail, the male and female ratio: 1:40-50 of planting of the first generation of hybrid.
9. the hybridization breeding method of section as claimed in claim 1 agriculture mutton sheep new lines, is characterized in that: cold female sheep hybridization, the male and female ratio: 1:40-50 of planting of the described first generation of hybrid male kind sheep and little tail.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410382958.1A CN104186404B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of section agriculture mutton sheep new lines |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410166151.4 | 2014-04-24 | ||
CN201410166151 | 2014-04-24 | ||
CN2014101661514 | 2014-04-24 | ||
CN201410382958.1A CN104186404B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of section agriculture mutton sheep new lines |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104186404A CN104186404A (en) | 2014-12-10 |
CN104186404B true CN104186404B (en) | 2016-05-04 |
Family
ID=52071924
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410382958.1A Expired - Fee Related CN104186404B (en) | 2014-04-24 | 2014-08-06 | The hybridization breeding method of a kind of section agriculture mutton sheep new lines |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104186404B (en) |
Families Citing this family (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104855333B (en) * | 2015-05-29 | 2017-11-21 | 会宁县金丰旺畜牧养殖有限责任公司 | A kind of breeding method of the dual-purpose breeding Small-fat-tail sheep new lines of meat fur coat |
CN105462967B (en) * | 2015-11-27 | 2018-06-29 | 新疆农垦科学院 | The relevant molecular labeling of sheep seasonal breeding character, primer pair, kit and discrimination method |
CN107306881A (en) * | 2017-06-22 | 2017-11-03 | 赖永雄 | A kind of cross breeding method of the sharp ox in high-quality high-grade beef cattle new varieties building |
CN107361013A (en) * | 2017-06-28 | 2017-11-21 | 谢萍 | A kind of Du based on agricultural economy moors sheep cross breeding method |
CN108207789A (en) * | 2017-12-25 | 2018-06-29 | 兰州大学 | A kind of drylot feeding type Mutton Sheep male parent line breeding method |
CN108308416A (en) * | 2018-03-22 | 2018-07-24 | 甘肃傲农饲料科技有限公司 | Du Bo × Small-fat-tail sheep first familiar generation Lamb Period health-care feed and preparation method thereof |
CN111345266B (en) * | 2020-03-31 | 2022-03-01 | 唐山市畜牧技术推广站 | Method for producing ternary hybrid mutton sheep |
CN111449022B (en) * | 2020-06-04 | 2022-03-29 | 河南牧业经济学院 | Method for breeding novel variety of Huang-Huai mutton sheep |
CN114009396A (en) * | 2021-10-20 | 2022-02-08 | 赤峰市吉羊牧业有限公司 | Method for breeding small-tailed sheep hybrid variety by hybridization of Dorper sheep and small-tailed Han sheep |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2229224C2 (en) * | 2002-02-19 | 2004-05-27 | Научно-исследовательский институт сельского хозяйства Юго-Востока РАСХН | Method for obtaining fine-fleece breeder crossbred sheep |
CN101861847A (en) * | 2010-06-29 | 2010-10-20 | 河南科技大学 | Method for breeding new strain for Yuxi fatty-tailed mutton |
CN102524181A (en) * | 2012-01-13 | 2012-07-04 | 河南科技大学 | Method for cultivating new strain of meat type large-tailed han sheep |
CN103081859A (en) * | 2013-01-25 | 2013-05-08 | 权凯 | Cultivation method for central plain table purpose mutton new strain |
CN103404482A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Highly-productive mutton sheep new strain breeding method |
-
2014
- 2014-08-06 CN CN201410382958.1A patent/CN104186404B/en not_active Expired - Fee Related
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
RU2229224C2 (en) * | 2002-02-19 | 2004-05-27 | Научно-исследовательский институт сельского хозяйства Юго-Востока РАСХН | Method for obtaining fine-fleece breeder crossbred sheep |
CN101861847A (en) * | 2010-06-29 | 2010-10-20 | 河南科技大学 | Method for breeding new strain for Yuxi fatty-tailed mutton |
CN102524181A (en) * | 2012-01-13 | 2012-07-04 | 河南科技大学 | Method for cultivating new strain of meat type large-tailed han sheep |
CN103081859A (en) * | 2013-01-25 | 2013-05-08 | 权凯 | Cultivation method for central plain table purpose mutton new strain |
CN103404482A (en) * | 2013-08-30 | 2013-11-27 | 洛宁农本畜牧科技开发有限公司 | Highly-productive mutton sheep new strain breeding method |
Non-Patent Citations (2)
Title |
---|
杜泊绵羊与小尾寒羊杂交后代的屠宰性能和肉品质性状研究;王德芹 等;《中国草食动物》;20081015;第28卷(第5期);第22-25页 * |
杜泊绵羊与小尾寒羊杂交肥羔肉质特性的研究;王金文 等;《中国畜牧杂志》;20070210;第43卷(第3期);第4-6页 * |
Also Published As
Publication number | Publication date |
---|---|
CN104186404A (en) | 2014-12-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104186404B (en) | The hybridization breeding method of a kind of section agriculture mutton sheep new lines | |
CN104186403B (en) | The hybridization breeding method of a kind of this sheep of agriculture | |
CN101828539B (en) | Method for breeding Sujiang pig variety | |
CN101878745B (en) | Production method of lean meat type hybrid miniature pigs | |
CN101919367B (en) | Method for producing breed of black-shin dorking | |
CN110367197B (en) | Hybridization matching combination research method of meat pigeons | |
CN106332838B (en) | A kind of breeding method of the meat new lines of Small-fat-tail sheep | |
CN104285884A (en) | Culture method of new Shanxi white pig variety | |
CN102124997B (en) | Method for breeding two-point-pattern lacy duck new breed | |
CN106359259A (en) | Breeding method for novel mutton variety of Hu-sheep | |
CN109105338A (en) | A kind of producing method for seed of red plumage white shell egg chicken breed system | |
CN108184760A (en) | A kind of breeding method of black meat rabbit new lines | |
CN109526872B (en) | Breeding method of new variety of meat and milk sheep | |
CN103380761B (en) | Novel Yimeng black pig breeding method | |
CN104186422A (en) | Method for breeding novel variety of high-quality mutton sheep | |
CN106069895A (en) | The construction method of a kind of Heterologous Hybridization strain and offspring seed cultivation method thereof | |
CN107361013A (en) | A kind of Du based on agricultural economy moors sheep cross breeding method | |
CN106386670A (en) | Method for breeding Du-Sa black pigs in plateaus | |
CN106036251A (en) | Feed special for use at earlier stage of yellow river carps and preparation method thereof | |
CN105123610B (en) | A kind of hybridization production method of high-quality meat pig | |
CN108849724A (en) | A kind of bar of Du pig and its breeding method | |
CN106591467A (en) | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon | |
CN106360117A (en) | Composite premix feed for freshwater fishes | |
CN108713526A (en) | A kind of breeding method of market pig | |
CN106172095B (en) | Breeding method of large-size Yangtze river system river crab fine breeds |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C41 | Transfer of patent application or patent right or utility model | ||
TA01 | Transfer of patent application right |
Effective date of registration: 20160223 Address after: Luoning County, Henan province 471719 Luoyang Xishan Di Xiang sun Dong Cun, development of modern agricultural science and Technology Park Applicant after: NONGBEN ANIMAL HUSBANDRY DEVELOPMENT Co.,Ltd. Address before: 471000 Xiyuan Road, Jianxi District, Henan, No. 48, No. Applicant before: Henan University of Science and Technology |
|
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160504 Termination date: 20210806 |
|
CF01 | Termination of patent right due to non-payment of annual fee |