CN116034943A - Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk - Google Patents
Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk Download PDFInfo
- Publication number
- CN116034943A CN116034943A CN202310005266.4A CN202310005266A CN116034943A CN 116034943 A CN116034943 A CN 116034943A CN 202310005266 A CN202310005266 A CN 202310005266A CN 116034943 A CN116034943 A CN 116034943A
- Authority
- CN
- China
- Prior art keywords
- breeding
- pigeon
- pigeons
- day
- prolactin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000272201 Columbiformes Species 0.000 title claims abstract description 245
- 238000009395 breeding Methods 0.000 title claims abstract description 138
- 230000001488 breeding effect Effects 0.000 title claims abstract description 125
- 235000013336 milk Nutrition 0.000 title claims abstract description 56
- 239000008267 milk Substances 0.000 title claims abstract description 56
- 210000004080 milk Anatomy 0.000 title claims abstract description 56
- 230000028327 secretion Effects 0.000 title claims abstract description 14
- 102000003946 Prolactin Human genes 0.000 claims abstract description 73
- 108010057464 Prolactin Proteins 0.000 claims abstract description 73
- 229940097325 prolactin Drugs 0.000 claims abstract description 73
- 238000012216 screening Methods 0.000 claims abstract description 38
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 35
- 238000000034 method Methods 0.000 claims abstract description 10
- 230000003248 secreting effect Effects 0.000 claims abstract description 8
- 238000010241 blood sampling Methods 0.000 claims abstract description 5
- 238000005096 rolling process Methods 0.000 claims description 68
- 235000013601 eggs Nutrition 0.000 claims description 47
- 210000004369 blood Anatomy 0.000 claims description 36
- 239000008280 blood Substances 0.000 claims description 36
- 238000003753 real-time PCR Methods 0.000 claims description 20
- 230000012447 hatching Effects 0.000 claims description 17
- 230000005540 biological transmission Effects 0.000 claims description 14
- 238000011144 upstream manufacturing Methods 0.000 claims description 12
- 238000006243 chemical reaction Methods 0.000 claims description 11
- 239000002985 plastic film Substances 0.000 claims description 7
- 229920006255 plastic film Polymers 0.000 claims description 7
- 239000000463 material Substances 0.000 claims description 5
- 238000003860 storage Methods 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 4
- 230000036425 denaturation Effects 0.000 claims description 4
- 210000003746 feather Anatomy 0.000 claims description 4
- 230000004720 fertilization Effects 0.000 claims description 4
- 230000037308 hair color Effects 0.000 claims description 4
- 238000012257 pre-denaturation Methods 0.000 claims description 4
- 238000010187 selection method Methods 0.000 claims 3
- 238000004519 manufacturing process Methods 0.000 abstract description 4
- 230000000638 stimulation Effects 0.000 abstract 1
- 210000002966 serum Anatomy 0.000 description 10
- 238000012360 testing method Methods 0.000 description 10
- 210000003323 beak Anatomy 0.000 description 6
- 230000033001 locomotion Effects 0.000 description 4
- 238000009399 inbreeding Methods 0.000 description 3
- 210000001161 mammalian embryo Anatomy 0.000 description 3
- 230000001568 sexual effect Effects 0.000 description 3
- XEEYBQQBJWHFJM-UHFFFAOYSA-N Iron Chemical compound [Fe] XEEYBQQBJWHFJM-UHFFFAOYSA-N 0.000 description 2
- 102000014171 Milk Proteins Human genes 0.000 description 2
- 108010011756 Milk Proteins Proteins 0.000 description 2
- 238000004458 analytical method Methods 0.000 description 2
- 238000004364 calculation method Methods 0.000 description 2
- 210000002919 epithelial cell Anatomy 0.000 description 2
- 238000009434 installation Methods 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 235000021239 milk protein Nutrition 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 235000016709 nutrition Nutrition 0.000 description 2
- 230000035764 nutrition Effects 0.000 description 2
- 244000144977 poultry Species 0.000 description 2
- 235000013594 poultry meat Nutrition 0.000 description 2
- 238000001243 protein synthesis Methods 0.000 description 2
- 230000004936 stimulating effect Effects 0.000 description 2
- 230000014616 translation Effects 0.000 description 2
- 241000251468 Actinopterygii Species 0.000 description 1
- 241000283690 Bos taurus Species 0.000 description 1
- OYPRJOBELJOOCE-UHFFFAOYSA-N Calcium Chemical compound [Ca] OYPRJOBELJOOCE-UHFFFAOYSA-N 0.000 description 1
- 102000002322 Egg Proteins Human genes 0.000 description 1
- 108010000912 Egg Proteins Proteins 0.000 description 1
- 241000287828 Gallus gallus Species 0.000 description 1
- 206010062767 Hypophysitis Diseases 0.000 description 1
- 241001494479 Pecora Species 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000017531 blood circulation Effects 0.000 description 1
- 210000004204 blood vessel Anatomy 0.000 description 1
- 230000037396 body weight Effects 0.000 description 1
- 229910052791 calcium Inorganic materials 0.000 description 1
- 239000011575 calcium Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 235000013330 chicken meat Nutrition 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 210000003278 egg shell Anatomy 0.000 description 1
- 210000002257 embryonic structure Anatomy 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000012465 hatching behavior Effects 0.000 description 1
- 238000011534 incubation Methods 0.000 description 1
- 230000006698 induction Effects 0.000 description 1
- 229910052742 iron Inorganic materials 0.000 description 1
- 150000002632 lipids Chemical class 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 235000015097 nutrients Nutrition 0.000 description 1
- 230000000050 nutritive effect Effects 0.000 description 1
- 230000017448 oviposition Effects 0.000 description 1
- 210000003635 pituitary gland Anatomy 0.000 description 1
- 239000004033 plastic Substances 0.000 description 1
- 230000003068 static effect Effects 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- 230000007704 transition Effects 0.000 description 1
- 235000019155 vitamin A Nutrition 0.000 description 1
- 239000011719 vitamin A Substances 0.000 description 1
- 235000019156 vitamin B Nutrition 0.000 description 1
- 239000011720 vitamin B Substances 0.000 description 1
- 235000019165 vitamin E Nutrition 0.000 description 1
- 239000011709 vitamin E Substances 0.000 description 1
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/02—Breeding vertebrates
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Zoology (AREA)
- Animal Husbandry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk, which comprises the following steps: 1) Selecting breeding pigeons which can be used as nurse pigeons for continuous breeding to obtain F1 generation; 2) Breeding F2 generation by taking F1 generation as breeding pigeon; 3) Screening F3 generation according to stimulation of the egg-guiding pair to the nest-stage breeding pigeon, the change of the prolactin content level and the change of the prolactin gene copy number; 4) When the F3 generation is subjected to next round breeding, the ringing time in the egg-guiding part is one day in advance, the blood sampling time is correspondingly one day in advance, the step 3) is repeated to screen out the F4 generation, and the steps are repeated to screen out the breeding pigeons capable of secreting pigeon milk in advance. The method can screen pigeons which produce pigeon milk more prematurely, can better meet production requirements when being used as a nurse pigeon, shortens the duration of producing the pigeon milk, and improves the utilization rate of the nurse pigeon.
Description
Technical Field
The invention belongs to the field of poultry breeding. More particularly, the invention relates to a breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk.
Background
The pigeon meat is rich in elements such as calcium, iron and the like, vitamins A, B, E and the like, and has higher nutritive value than chickens, cows, fish and sheep, and is widely used as fourth-sized poultry in China. The pigeons are produced by observing strict 'one couple' with the pigeons, after the pigeons are successfully matched, the pigeons are needed to feed pigeon milk in a mouth-to-mouth mode after the pigeons are born, the pigeons below 7 days old mainly depend on the pigeon milk to obtain nutrients, the pigeons at 8-14 days old mainly comprise pigeon milk and feed primarily digested by the pigeons, and the pigeons at 14 days old gradually transition to feed independently until the pigeons come into the market (about 28 days old). If the breeding pigeons are used for breeding the young pigeons, the production period is longer, and the breeding pigeons for producing the meat pigeons can have larger body types and are not good for hatching, brooding and the like. At present, the pigeon eggs are usually hatched manually, so that the breeding pigeons enter the next egg laying period, the utilization rate of the breeding pigeons is improved, and the young pigeons hatched manually are fed by using the nurse pigeons. Hu Xiaochao in the "physiological structures of different breeding cycle breeding pigeons and the mechanism of Pigeon milk protein synthesis" discloses that under the induction of hatching behavior, the prolactin secreted by the pituitary gland acts on the crop tissue, the crop epithelial cells start to proliferate around 8 th day of the hatching of pigeon embryo, the crop thickness and weight are respectively increased by 3-5 times by 18 th day, and the crop mucosa weight is increased by 10 times. Simultaneously, the blood flow of the blood vessel of the crop wall is rapidly increased, the protein synthesis amount in the epithelial cells is rapidly increased and the lipid drops are enriched, and finally the liquid drops drop into the crop cavity to form cheese-like, oily and milky pigeon milk. It can be seen that pigeons form pigeon milk from the beginning of hatching pigeon eggs, which takes up to 18 days. If the pigeon for the babysitter generating pigeon milk can be screened earlier, the utilization rate of the pigeon for the babysitter can be greatly improved.
Disclosure of Invention
It is an object of the present invention to solve at least the above problems and to provide at least the advantages to be described later.
The invention aims to provide a breeding pigeon molecule assisted breeding method for early secretion of pigeon milk, which can screen pigeons producing pigeon milk more early, can better meet production requirements when being used as a nurse pigeon, shortens the duration of producing pigeon milk, and improves the utilization rate of the nurse pigeon.
To achieve these objects and other advantages and in accordance with the purpose of the invention, there is provided a breeding pigeon molecular assisted breeding method for early secretion of pigeon milk, comprising:
1) Selecting breeding pigeons with short and upturned chest, flat head, compact feathers, uniform hair color, weight of more than or equal to 800g, short and thick neck, high laying rate and high fertilization rate as a basic breeding population, and continuously breeding by using the basic breeding population to obtain F1 generation;
2) F1, pairing, namely eliminating individuals with the weight lower than 10% of the average weight when the incubated young pigeons are 25 days old, wearing individual identification rings by the young pigeons with reserved seeds, and feeding the young pigeons serving as reserve breeding pigeons to obtain F2 generation;
3) During the first screening, taking out the pigeon eggs from F2 generation breeding pigeons to perform artificial hatching after the breeding pigeons lay eggs, hatching and egg-leading the breeding pigeons, taking venous blood on the 15 th day, then making the interior of the egg-leading egg emit rolling sound, making the interior of the egg-leading egg emit rolling sound and pecking sound on the 16 th day, taking the pigeon venous blood on the 17 th day, detecting the content of prolactin in the 15 th and 17 th day venous blood, and calculating the relative increment of the content of the prolactin on the 17 th day relative to the 15 th day in venous blood, namely the difference value between the content of the prolactin in the serum on the 17 th day and the content of the prolactin on the 15 th day; extracting total DNA of venous blood on 15 days, carrying out real-time fluorescent quantitative PCR reaction, calculating the average relative copy number of F2 generation prolactin genes, eliminating breeding pigeons with the relative increment of the prolactin being lower than 5% of the average relative increment and breeding pigeons with poor quality generated by pigeon milk on 17 days, taking the breeding pigeons as next screening after the breeding pigeons are grown up after artificial hatching of pigeon eggs corresponding to the non-eliminated breeding pigeons, repeating screening steps in the first screening, namely hatching and breeding the pigeons corresponding to the first screening, pairing and breeding after the breeding to sexual maturity, and avoiding inbreeding; on the 15 th day of nest, venous blood is taken, then the interior of the egg-guiding device sounds, on the 17 th day, reserve pigeon venous blood is taken, then the interior of the egg-guiding device sounds, the relative increment of prolactin in venous blood is detected, namely, the difference value between the content of the prolactin in the serum on the 17 th day and the content of the prolactin in the serum on the 15 th day is detected, the pigeons with the relative increment of the prolactin being lower than 5% of the average relative increment are eliminated, and N rounds of screening are carried out to ensure that the expression of the prolactin is relatively stable, namely, the difference value between the relative increment of the prolactin content and the average relative increment is less than 5% of the average relative increment; detecting and calculating the relative copy number of the prolactin gene in venous blood during the last round of screening, and selecting breeding pigeons with the relative copy number of the prolactin gene being more than 3% higher than the average relative copy number during the first round of screening as F3 generation;
4) When the F3 generation is subjected to next round breeding, the rolling sound making time in the egg guiding part is one day in advance, the blood sampling time is correspondingly one day in advance, the step 3) is repeated to screen out the F4 generation, and the steps are repeated to screen out the breeding pigeons capable of secreting pigeon milk in advance.
Preferably, the target gene primer pair P1 of the real-time fluorescence quantitative PCR is as follows:
upstream primer F1: tcctggaacgatcccctgat;
downstream primer R1: tctgcagctggctgagaagatt;
the reference gene primer pair P2 is:
the upstream primer F2: tccttcgtctggatctggctgg;
downstream primer R2: ctctctcggctgtggtggtgaa.
Preferably, the reaction system of the real-time fluorescence quantitative PCR is as follows: 2uL 10ng/uL DNA template, 10uL 2 Xfluorescent quantitative PCR buffer, upstream primer and downstream primer each 0.5uL,7 uL ddH 2 O。
Preferably, the reaction procedure of the real-time fluorescent quantitative PCR is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 35s, extension at 72℃for 40s,40 cycles; extending at 72 ℃ for 10min; preserving at 20 ℃.
It is preferred that the composition of the present invention,
the egg guiding device comprises:
a housing part having an ellipsoidal structure, the housing part being made of a hard material;
a rolling element provided in the housing member, the rolling element having a circular cross section and being in contact with an inner wall of the housing member;
the driving structure is fixed in the shell piece through a connecting piece and is used for driving the rolling bodies to rotate;
the controller is connected with the driving structure to control the start and stop of the driving structure, and is in signal connection with an external control system through a wireless transmission device;
the storage battery is electrically connected with the driving structure, the controller and the wireless transmission device to provide power for the driving structure, the controller and the wireless transmission device.
Preferably, an elastic plastic film is provided on the inner wall of the housing part, and the arcuate surface of the rolling element is in contact with the elastic plastic film.
Preferably, the driving structure is a stepper motor, and an output shaft of the stepper motor is connected with the rolling bodies to drive the rolling bodies to rotate in the housing member.
Preferably, a first unidirectional rotating bearing is arranged on an output shaft of the stepping motor, and the rolling body is fixedly connected with the first unidirectional rotating bearing.
Preferably, the beak structure further comprises a beak housing structure comprising:
the second unidirectional rotating bearing is arranged on the output shaft of the stepping motor, a gear is arranged on the second unidirectional rotating bearing, and the rotating direction of the second unidirectional rotating bearing is opposite to the rotating direction of the first unidirectional rotating bearing;
the fixing column is connected with the inner wall of the shell, and a connecting hole is formed in one end, far away from the inner wall of the shell, of the fixing column;
the first connecting part of the reciprocating rod slidably penetrates through the connecting hole, the tail end of the first connecting part of the reciprocating rod is abutted against the shell piece, a spring is arranged on the first connecting part of the reciprocating rod, and the second connecting part of the reciprocating rod is matched with the gear;
the spring is in an extending state at the beginning so as to eject the reciprocating rod rightwards to be abutted on the shell piece; when the stepping motor reversely rotates, the stepping motor drives the gear to rotate, and the gear drives the reciprocating rod to move left through the second connecting part of the reciprocating rod.
Preferably, the end of the first connecting portion of the reciprocating lever has a cone-shaped structure.
The invention at least comprises the following beneficial effects:
the first step, the breeding pigeon group which can generate pigeon milk in advance is screened to serve as a nurse pigeon, so that the time required by the nurse pigeon to generate the pigeon milk is shortened, and the utilization rate of the nurse pigeon is improved; and the pigeon breeding group which generates pigeon milk in advance at different time is established, so that the production requirement can be better and more flexibly met.
Second, the egg-guiding device can simulate the turning of embryos in the shell and the sound of pecking the shell so as to stimulate the expression of related genes such as prolactin in the breeding pigeon body and the like, so that the breeding pigeon can be promoted to produce pigeon milk.
Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.
Drawings
FIG. 1 is a graph of prolactin content for various test conditions;
FIG. 2 is a schematic view of an exemplary egg-guiding structure;
fig. 3 is a schematic view of a beak structure (driving structure, rolling element not shown) according to an embodiment of the invention.
1. A housing member; 2. a rolling element; 3. a driving motor; 4. a connecting piece; 5. a first one-way rotating bearing; 6. an output shaft; 7. a gear; 8. fixing the column; 9. a second one-way rotating bearing; 10. a mounting part; 11. a second connecting portion; 12. a spring; 13. a first connection portion.
Detailed Description
The present invention is described in further detail below with reference to the drawings to enable those skilled in the art to practice the invention by referring to the description.
It will be understood that terms, such as "having," "including," and "comprising," as used herein, do not preclude the presence or addition of one or more other elements or groups thereof.
It should be noted that the experimental methods described in the following embodiments, unless otherwise specified, are all conventional methods, and the reagents and materials, unless otherwise specified, are all commercially available; in the description of the present invention, it should be noted that, unless explicitly stated and limited otherwise, the terms "mounted," "connected," and "disposed" are to be construed broadly, and may be fixedly connected, disposed, or detachably connected, disposed, or integrally connected, disposed, for example. The specific meaning of the above terms in the present invention will be understood in specific cases by those of ordinary skill in the art. The terms "transverse," "longitudinal," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," "outer," and the like are used for convenience in describing and simplifying the description of the present invention based on the orientation or positional relationship shown in the drawings, and do not denote or imply that the devices or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and thus are not to be construed as limiting the present invention.
As shown in FIG. 1, the invention provides a breeding pigeon molecule assisted breeding method for early secretion of pigeon milk, which comprises the following steps:
1) Selecting breeding pigeons with short and upturned chest, flat head, compact feathers, uniform hair color, weight of more than or equal to 800g, short and thick neck, high laying rate and high fertilization rate as a basic breeding population, and continuously breeding by using the basic breeding population to obtain F1 generation;
2) F1, pairing, namely eliminating individuals with the weight lower than 10% of the average weight when the incubated young pigeons are 25 days old, wearing individual identification rings by the young pigeons with reserved seeds, and feeding the young pigeons serving as reserve breeding pigeons to obtain F2 generation;
3) During the first screening, taking out the pigeon eggs from F2 generation breeding pigeons to perform artificial hatching after the breeding pigeons lay eggs, hatching and egg-leading the breeding pigeons, taking venous blood on the 15 th day, then making the interior of the egg-leading egg emit rolling sound, making the interior of the egg-leading egg emit rolling sound and pecking sound on the 16 th day, taking the pigeon venous blood on the 17 th day, detecting the content of prolactin in the 15 th and 17 th day venous blood, and calculating the relative increment of the content of the prolactin on the 17 th day relative to the 15 th day in venous blood, namely the difference value between the content of the prolactin in the serum on the 17 th day and the content of the prolactin on the 15 th day; extracting total DNA of the 15 th day venous blood, performing real-time fluorescent quantitative PCR reaction, and calculating the average relative copy number of the F2 generation prolactin gene; the breeding pigeons with the relative increment of the prolactin being lower than 5% of the average relative increment and the pigeons on day 17 are eliminated to generate the breeding pigeons with poor quality, namely the pigeon milk protein content is lower than 10%, the fat content is lower than 7%, the pigeon eggs corresponding to the non-eliminated breeding pigeons are fed and grown up by the nurse pigeons to be used as the next screening after artificial hatching, and the screening steps in the first screening are repeated in the second screening, namely the breeding pigeons corresponding to the first screening are hatched, fed to sexual maturity, paired and bred, and inbreeding is avoided; on the 15 th day of nest, venous blood is taken, then the interior of the egg-guiding device sounds, on the 17 th day, reserve pigeon venous blood is taken, then the interior of the egg-guiding device sounds, the relative increment of the prolactin content in the venous blood is detected, namely, the difference value between the prolactin content in the serum on the 17 th day and the prolactin content in the serum on the 15 th day is detected, the pigeons with the relative increment of the prolactin content lower than 5% of the average relative increment are eliminated, and N rounds of screening are carried out to ensure that the expression of the prolactin is relatively stable, namely, the difference value between the relative increment of the prolactin content and the average relative increment is less than 5% of the average relative increment; detecting and calculating the relative copy number of the prolactin gene in venous blood (the copy number of the prolactin gene is relative to that of a reference gene) in the last round of screening, and selecting breeding pigeons with the relative copy number of the prolactin gene being more than 3% higher than the average relative copy number in the first round of screening as F3 generation;
4) When the F3 generation is subjected to next round breeding, the rolling sound making time in the egg guiding part is one day in advance, the blood sampling time is correspondingly one day in advance, the step 3) is repeated to screen out the F4 generation, and the steps are repeated to screen out the breeding pigeons capable of secreting pigeon milk in advance.
In another technical scheme, the target gene primer pair P1 of the real-time fluorescence quantitative PCR is as follows:
upstream primer F1: tcctggaacgatcccctgat;
downstream primer R1: tctgcagctggctgagaagatt;
the reference gene primer pair P2 is:
the upstream primer F2: tccttcgtctggatctggctgg;
downstream primer R2: ctctctcggctgtggtggtgaa.
In another technical scheme, the reaction system of the real-time fluorescence quantitative PCR is as follows: 2uL 10ng/uL DNA template, 10uL 2 Xfluorescent quantitative PCR buffer, upstream primer and downstream primer each 0.5uL,7 uL ddH 2 O。
In another technical scheme, the reaction program of the real-time fluorescence quantitative PCR is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 35s, extension at 72℃for 40s,40 cycles; extending at 72 ℃ for 10min; preserving at 20 ℃.
In another technical solution, as shown in fig. 2 and 3, the egg guiding method includes:
a housing part 1 having an ellipsoidal structure, the housing part 1 being made of a hard material;
a rolling element 2 provided inside the housing member 1, the rolling element 2 having a circular cross section, the rolling element 2 abutting against an inner wall of the housing member 1;
a driving structure fixed inside the housing member 1 through a connecting member 4, the driving structure being for driving the rolling elements 2 to rotate;
the controller is connected with the driving structure to control the start and stop of the driving structure, and is in signal connection with an external control system through a wireless transmission device;
the storage battery is electrically connected with the driving structure, the controller and the wireless transmission device to provide power for the driving structure, the controller and the wireless transmission device.
The shape of the egg is similar to that of the pigeon egg, the color is similar to that of the pigeon egg, and the size of the egg can be set according to the requirements, namely, the size of the breeder pigeon and the size of the breeder pigeon body. The housing part 1 may be of a rigid plastic. The longitudinal section of the rolling element 2 may be circular, semicircular or fan-shaped, and the outer surface of the rolling element 2 abuts against the inner wall of the housing member 1. The outer surface of the rolling elements 2 may have a wave-like structure to reduce friction of the rolling elements 2 with the inner wall of the housing part 1. The driving structure is a driving motor 3 which is arranged in the shell member 1 and fixedly connected with the inner wall of the shell member 1 through a connecting member 4, and the rolling bodies 2 can be driven to rotate when the driving structure rotates. The controller, the wireless transmission device and the storage battery are all arranged in the shell part 1. The wireless transmission device can transmit the instruction sent by the control system to the controller, and the controller controls the start and stop of the driving structure according to the instruction.
In another embodiment, the inner wall of the housing part 1 is provided with an elastic plastic film, on which the arcuate surface of the rolling element 2 is in contact.
In another embodiment, the driving structure is a stepper motor, and an output shaft 6 of the stepper motor is connected to the rolling elements 2 to drive the rolling elements 2 to rotate in the housing member 1. When the stepping motor is started, the rolling bodies 2 are driven to rotate in the shell piece 1 so as to simulate the turning of the embryo in the eggshell in the later incubation period of the pigeon eggs.
In another technical scheme, a first unidirectional rotation bearing 5 is arranged on the output shaft 6 of the stepping motor, and the rolling bodies 2 are fixedly connected with the first unidirectional rotation bearing 5. In this embodiment, if the first unidirectional rotation bearing 5 is rotatable in the forward direction and in the locked state in the reverse direction, the first unidirectional rotation bearing 5 rotates along with the output shaft to drive the rolling element 2 to rotate when the stepper motor rotates in the reverse direction; the stepper motor rotates positively, the first unidirectional rotation bearing 5 is in a rotatable state, and the relative rotation of the first unidirectional rotation bearing 5 is prevented due to the friction force between the rolling bodies 2 and the inner wall of the shell piece 1, so that the stepper motor output shaft 6 can rotate, and when the first unidirectional rotation bearing is motionless, the rolling bodies 2 keep in a static state.
In another embodiment, the beak structure further includes a beak housing structure as shown in fig. 3, the beak housing structure includes:
a second unidirectional rotation bearing 9, which is arranged on the output shaft 6 of the stepper motor, wherein a gear 7 is arranged on the second unidirectional rotation bearing 9, and the rotatable direction of the second unidirectional rotation bearing 9 is opposite to the rotatable direction of the first unidirectional rotation bearing 5;
the fixing column 8 is connected with the inner wall of the shell member 1, and a connecting hole is formed at one end of the fixing column 8 away from the inner wall of the shell member 1;
the first connecting part 13 of the reciprocating rod slidably penetrates through the connecting hole, the tail end of the first connecting part 13 of the reciprocating rod is in abutting contact with the shell piece 1, the first connecting part 13 of the reciprocating rod is provided with a spring 12, and the second connecting part 11 of the reciprocating rod is matched with the gear 7;
wherein initially the spring 12 is in an extended state to spring the reciprocating lever to the right against the housing part 1; when the stepping motor reversely rotates, the stepping motor drives the gear 7 to rotate, and the gear 7 drives the reciprocating rod to move left through the second connecting part 11 of the reciprocating rod.
In this embodiment, when the driving motor 3 rotates forward, the second unidirectional rotating bearing 9 is in a locked state, so that the second unidirectional rotating bearing 9 can drive the gear 7 to rotate, the gear 7 toggles the reciprocating rod to move leftwards, that is, when the first gear tooth of the gear 7 is separated from the second connecting portion 11 of the reciprocating rod, the reciprocating rod moves rightwards under the tension of the spring 12, and as the gear 7 rotates, the second gear tooth contacts with the second connecting portion 11 of the reciprocating rod and toggles the reciprocating rod leftwards, so that the left-right movement of the reciprocating rod is realized. When the reciprocating lever moves rightward, it abuts against the inside of the case member 1 to strike the case member 1, thereby simulating the pecking shell of the pigeon. When the driving motor 3 rotates reversely, the gear 7 rotates reversely and is abutted on the second connecting part 11 of the reciprocating rod, and the reciprocating rod lacks space for rightward movement, so that the rotation of the gear 7 is prevented, and further, the relative rotation of the second unidirectional rotating bearing 9 is prevented, and at the moment, the second unidirectional rotating bearing 9 does not rotate. The rolling body 2 and the reciprocating rod are driven by the same motor respectively through the first unidirectional rotating bearing 5 and the second unidirectional rotating bearing 9, so that the effect of simulating the first creep and then pecking of the young pigeon is achieved.
In another technical scheme, the tail end of the first connecting part 13 of the reciprocating rod is in a cone-shaped structure. The first connecting portion 13 of the reciprocating lever is provided in a cone-like structure which simulates the sound of the chick pecking shell when it impinges on the inner wall of the housing part 1.
In another technical solution, the rolling element 2 is provided with a mounting portion 10, and the fixing post 8 is fixed on the mounting portion 10 so that the fixing post 8 rotates along with the rolling element 2 when the rolling element 2 rotates. In this embodiment, the fixed post 8 is disposed on the mounting portion 10, so that the fixed post 8 rotates along with the rotation of the rolling element 2, and the reciprocating lever of the gear 7 is impacted at different positions of the housing member 1 when the reciprocating lever performs reciprocating motion.
Example 1 ]
A breeding pigeon molecule assisted breeding method for early secretion of pigeon milk comprises the following steps:
1) Selecting breeding pigeons with short and upturned chest, flat head, compact feathers, uniform hair color, weight of more than or equal to 800g, short and thick neck, high laying rate and high fertilization rate as a basic breeding population, and continuously breeding by using the basic breeding population to obtain F1 generation;
2) F1, pairing, namely eliminating individuals with the weight lower than 10% of the average weight when the incubated young pigeons are 25 days old, wearing individual identification rings by the young pigeons with reserved seeds, and feeding the young pigeons serving as reserve breeding pigeons to obtain F2 generation;
3) During the first screening, taking out the pigeon eggs from F2 generation breeding pigeons to perform artificial hatching after the breeding pigeons lay eggs, hatching and egg-leading the breeding pigeons, taking venous blood on the 15 th day, then making the interior of the egg-leading egg emit rolling sound, making the interior of the egg-leading egg emit rolling sound and pecking sound on the 16 th day, taking the pigeon venous blood on the 17 th day, detecting the content of prolactin in the 15 th and 17 th day venous blood, and calculating the relative increment of the content of the prolactin on the 17 th day relative to the 15 th day in venous blood, namely the difference value between the content of the prolactin in the serum on the 17 th day and the content of the prolactin on the 15 th day; extracting total DNA of venous blood on 15 days, carrying out real-time fluorescence quantitative PCR reaction, calculating the average relative copy number of F2 generation prolactin genes, eliminating breeding pigeons with the relative increment of the prolactin being lower than 5% of the average relative increment and breeding pigeons with poor quality generated by pigeon milk on 17 days, namely, the protein content of the pigeon milk is lower than 10%, the fat content of the pigeon milk is lower than 7%, and the pigeon eggs corresponding to the non-eliminated breeding pigeons are bred by a nurse pigeon after growing up for the next screening, and repeating screening steps in the first screening, namely, hatching and breeding the pigeon eggs corresponding to the first screening pigeon, pairing after breeding after sexual maturity, and avoiding inbreeding; on the 15 th day of nest, venous blood is taken, then the interior of the egg-guiding device sounds, on the 17 th day, the venous blood of the reserve breeding pigeon is taken, then the interior of the egg-guiding device sounds and pecks the shell, the relative increment of prolactin in the venous blood is detected, namely, the difference value between the content of the prolactin in the serum on the 17 th day and the content of the prolactin in the serum on the 15 th day is detected, the breeding pigeon with the relative increment of the prolactin being lower than 5% of the average relative increment is eliminated, and N rounds of screening are carried out to ensure that the expression of the prolactin is relatively stable, namely, the relative increment of the prolactin is lower than 5% of the average relative increment; detecting and calculating the relative copy number of the prolactin gene in venous blood (the copy number of the prolactin gene is relative to that of a reference gene) in the last round of screening, and selecting breeding pigeons with the relative copy number of the prolactin gene being more than 3% higher than the average relative copy number in the first round of screening as F3 generation;
4) When the F3 generation is bred in the next round, the ringing time in the egg-guiding part is one day in advance, namely, the ringing sound is generated in the egg-guiding part in 14 days of the nest, the blood-sampling time is correspondingly one day in advance, namely, the blood is sampled in the day 14 of the nest and the blood is sampled in the day 16 of the nest, the step 3) is repeated to screen out the F4 generation, and the steps are repeated to screen out the F5 generation and the F6 generation of breeding pigeons which can even secrete pigeon milk earlier in advance.
Wherein, the target gene primer pair P1 of the real-time fluorescence quantitative PCR is:
upstream primer F1: tcctggaacgatcccctgat;
downstream primer R1: tctgcagctggctgagaagatt;
the reference gene primer pair P2 is:
the upstream primer F2: tccttcgtctggatctggctgg;
downstream primer R2: ctctctcggctgtggtggtgaa.
The reaction system of the real-time fluorescence quantitative PCR is as follows: 2uL 10ng/uL DNA template, 10uL 2 Xfluorescent quantitative PCR buffer, upstream primer and downstream primer each 0.5uL,7 uL ddH 2 O。
The reaction procedure of the real-time fluorescent quantitative PCR is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 35s, extension at 72℃for 40s,40 cycles; extending at 72 ℃ for 10min; preserving at 20 ℃.
The pigeon used in this example was Bai Yuwang pigeon. If the pigeons of different varieties are screened, the relation between the relative increment of prolactin and the average relative increment can be correspondingly adjusted. The relationship between the relative copy number of the final prolactin gene and the average relative copy number of the F2 generation can also be adjusted accordingly.
Example 2 ]
An egg as used in example 1, the egg comprising:
a housing member 1 having an ellipsoidal structure, wherein a rotation lever is rotatably provided in the housing member 1 along a longitudinal direction thereof, and the housing member 1 is made of a hard material;
the rolling body 2 is arranged in the shell member 1, the cross section of the rolling body 2 is circular, the rolling body 2 is fixedly connected with the rotating rod, and the arc-shaped surface of the rolling body 2 is abutted against the inner wall of the shell member 1;
the driving structure is arranged in the shell piece 1 and fixedly connected with the interior of the shell piece 1, and is used for driving the rotating rod to rotate;
the controller is connected with the driving structure to control the start and stop of the driving structure, and is in signal connection with an external control system through a wireless transmission device;
the storage battery is electrically connected with the driving structure, the controller and the wireless transmission device to provide power for the driving structure, the controller and the wireless transmission device.
Further, an elastic plastic film is arranged on the inner wall of the shell member 1, and the arc-shaped surface of the rolling body 2 is abutted against the elastic plastic film.
Further, a first gear 7 is arranged on the rotating rod, the driving structure is a stepping motor, a second gear 7 is arranged on an output shaft 6 of the stepping motor, and the first gear 7 is matched with the second gear 7.
Further, a first unidirectional rotation bearing 5 is arranged on the output shaft 6 of the stepper motor, the second gear 7 is arranged on the first unidirectional rotation bearing 5, when the stepper motor rotates forward, the first unidirectional rotation bearing 5 is in a locking state, and the stepper motor drives the rolling body 2 to rotate through the first gear 7 and the second gear 7.
Further, the pecking cover structure is also included, and the pecking cover structure comprises:
a second unidirectional rotation bearing 9 provided on the output shaft 6 of the stepping motor, the gear 7 being provided on the third unidirectional rotation bearing;
the fixing column 8 is connected with the inner wall of the shell member 1, and a connecting hole is formed at one end of the fixing column 8 away from the inner wall of the shell member 1;
the first connecting part 13 of the reciprocating rod slidably penetrates through the connecting hole, the tail end of the first connecting part 13 of the reciprocating rod is in abutting contact with the shell piece 1, the first connecting part 13 of the reciprocating rod is provided with a spring 12, and the second connecting part 11 of the reciprocating rod is matched with the gear 7;
wherein initially the spring 12 is in an extended state to spring the reciprocating lever to the right against the housing part 1; when the stepping motor reversely rotates, the stepping motor drives the gear 7 to rotate, and the gear 7 drives the reciprocating rod to move left through the second connecting part 11 of the reciprocating rod.
Further, the end of the first connecting portion 13 of the reciprocating lever has a cone-shaped structure.
Further, the rolling element 2 is provided with an installation portion 10, and the fixing post 8 is fixed on the installation portion 10 so that the fixing post 8 rotates along with the rolling element 2 when the rolling element 2 rotates.
The application method of the egg guiding device comprises the following steps: on the 15 th day of the nest of the breeding pigeon, the external control system sends a rolling instruction of the rolling body 2 to the controller, and the controller starts the stepping motor to rotate reversely, namely the rolling body 2 rotates on the 15 th day, every 6 hours, the rolling body 2 rotates once, and the rotation angle is 10 degrees; every 3h of rotation every 6 hours before 16 days, the rotation angle is 10 degrees, then the driving motor 3 drives the rolling body 2 to rotate 20 degrees, the controller controls the stepping motor to rotate forward, and the driving motor 3 drives the pecking shell structure to work for 20s; after the interval of 6 hours, the controller starts the driving motor 3 to reversely rotate to drive the rolling bodies 2 to rotate at an angle of 40 degrees, the controller controls the stepping motor to positively rotate, and the driving motor 3 drives the pecking shell structure to work for 25 seconds; after 5 hours of interval, the controller starts the driving motor 3 to reversely rotate to drive the rolling bodies 2 to rotate at an angle of 60 degrees, the controller controls the stepping motor to positively rotate, and the driving motor 3 drives the pecking shell structure to work for 25s; after the interval of 4 hours, the controller starts the driving motor 3 to reversely rotate to drive the rolling bodies 2 to rotate at an angle of 60 degrees, the controller controls the stepping motor to positively rotate, and the driving motor 3 drives the pecking shell structure to work for 20s; after the interval of 2 hours, the controller starts the driving motor 3 to reversely rotate to drive the rolling bodies 2 to rotate at an angle of 90 degrees, the controller controls the stepping motor to positively rotate, and the driving motor 3 drives the pecking shell structure to work for 15s; after 1h interval, the controller starts the driving motor 3 to rotate reversely to drive the rolling bodies 2 to rotate at an angle of 90 degrees, and the controller controls the stepping motor to rotate forward to drive the driving motor 3 to drive the pecking shell structure to work for 10s. Pigeon blood was taken on day 17 and total DNA was extracted.
< test 1>
Test group, in example 2, the results of the prolactin content in the sera of the breeding pigeons at 15, 16 and 17 days when the 1 st round of screening was performed are shown in Table 1.
In the control group, in example 2, the results of the detection of prolactin content in the serum of the breeding pigeon on day 15, day 16, and day 17, in which the eggs were not rattled and pecked during the 1 st round of screening, are shown in Table 1.
TABLE 1
| Average prolactin content (ng/mL) | |
| |
0.065±0.019 |
| |
0.128±0.028 |
| |
0.184±0.035 |
| |
0.061±0.012 |
| |
0.073±0.017 |
| |
0.077±0.026 |
As is clear from the results in Table 1, after the inside of the egg-guiding ring, the content of prolactin was remarkably increased on days 16 and 17, which indicates that the egg-guiding ring stimulated the expression of the prolactin gene in the breeding pigeon and increased the content of prolactin in the breeding pigeon.
< test two >
Based on CT value, use 2 -△△Ct The method performs copy number calculation and analysis.
Average relative copy numbers of prolactin gene according to 1000 pairs of F2 breeding pigeons are shown in Table 2.
Average relative copy numbers of prolactin gene according to 1000 pairs of F3 breeding pigeons are shown in Table 2.
Average relative copy numbers of prolactin gene according to 1000 pairs of F4 breeding pigeons are shown in Table 2.
Average relative copy numbers of prolactin gene according to 1000 pairs of F5 breeding pigeons are shown in Table 2.
Average relative copy numbers of prolactin gene according to 1000 pairs of F6 breeding pigeons are shown in Table 2.
Average relative copy numbers of prolactin gene according to 1000 pairs of F7 breeding pigeons are shown in Table 2.
TABLE 2
Note that: table 2 shows the data corrected for the F2 copy number of 1 after calculation, and belongs to the relative copy numbers.
As can be seen from the results of Table 2, the average relative copy number of the breeding pigeon prolactin gene of the F7 generation is improved by 34.1% compared with that of the F1 generation through the screening of the invention.
< test three >
The pigeon milk quality of pigeon milk produced by the breeding pigeon screened in example 2 after 14 days was analyzed, and the results are shown in Table 3.
The quality of pigeon milk produced by the breeding pigeons screened in example 2 after 15 days of nest was analyzed, and the results are shown in Table 3.
The quality of pigeon milk produced by the breeding pigeons screened in example 2 after 16 days of nest was analyzed, and the results are shown in Table 3.
The quality of pigeon milk produced by the non-screened breeding pigeons at nest for 18 days was analyzed and the results are shown in Table 3.
Pigeon milk from 10 pigeons was randomly taken for analysis and the average was calculated and the results are shown in Table 3.
TABLE 3 Pigeon milk composition comparison
As shown in the results of Table 3, after the breeding pigeons are screened, the quality difference range of the protein content of the pigeon milk produced by the breeding pigeons in the nest for 14 days is within 10% and the quality difference range of the fat content of the pigeon milk produced by the breeding pigeons in the control nest for 18 days is within 10%, and the nutrition components completely accord with the growth of young pigeons.
< test IV >
60 pairs of breeding pigeons are selected and randomly divided into 3 groups, and the 3 groups of breeding pigeons are hatched and egg-led until 16 days.
Group a: and continuing hatching the egg, and generating no ringing sound and no pecking shell sound inside the egg.
Group B: pigeon eggs that had been hatched for 16 days to prepare shells were replaced with the guide eggs.
Group C: and continuing hatching the egg and generating sound and pecking shell sound inside the egg.
The results of measuring the prolactin content on days 15, 16 and 17 are shown in FIG. 1.
As can be seen from the results of FIG. 1, the stimulating effect of the sound and pecking shell sound generated by the egg-guiding device of the invention on the breeding pigeon is similar to the stimulating effect of the embryo movement in the egg of the breeding pigeon.
< test five >
TABLE 4 Table 4
| Birth weight (g) | Body weight (g) of 4 weeks old | |
| Pigeon milk for |
17.59±2.83 | 615.4±63.8 |
| Pigeon milk for nest 14 days | 17.38±2.54 | 614.1±64.1 |
| Pigeon milk for 15 days | 17.32±2.80 | 627.7±61.5 |
| Pigeon milk for |
17.35±2.81 | 631.5±62.8 |
| Pigeon milk for 17 days | 17.51±2.86 | 637.9±65.1 |
| Pigeon milk for nest 18 days | 17.42±2.88 | 637.4±62.3 |
As shown in Table 4, the pigeon milk produced in advance by the screening method has sufficient nutrition and can fully satisfy the growth of the young pigeons.
Although embodiments of the present invention have been disclosed above, it is not limited to the details and embodiments shown and described, it is well suited to various fields of use for which the invention would be readily apparent to those skilled in the art, and accordingly, the invention is not limited to the specific details and illustrations shown and described herein, without departing from the general concepts defined in the claims and their equivalents.
Claims (10)
1. The auxiliary breeding method of pigeon seed molecules for early secretion of pigeon milk is characterized by comprising the following steps:
1) Selecting breeding pigeons with short and upturned chest, flat head, compact feathers, uniform hair color, weight of more than or equal to 800g, short and thick neck, high laying rate and high fertilization rate as a basic breeding population, and continuously breeding by using the basic breeding population to obtain F1 generation;
2) F1, pairing, namely eliminating individuals with the weight lower than 10% of the average weight when the incubated young pigeons are 25 days old, wearing an individual identification ring by the young pigeon individuals with reserved seeds, and transferring the young pigeons into a young pigeon house to serve as a backup breeding pigeon to feed, so as to obtain F2 generation;
3) During the first screening, taking out the pigeon eggs after the F2 generation breeding pigeons lay eggs for artificial hatching, hatching the breeding pigeons and leading the eggs to be in nest 15 th day, taking venous blood, then enabling the interior of the leading eggs to emit rolling sound, enabling the interior of the leading eggs to emit rolling sound and pecking sound 16 th day, taking the breeding pigeon venous blood 17 th day, detecting the content of prolactin in the venous blood 15 th and 17 th day, and calculating the relative increment of the content of the prolactin 17 th day relative to the content of the prolactin 15 th day in the venous blood; extracting total DNA of 15 th day venous blood, carrying out real-time fluorescence quantitative PCR reaction, calculating the average relative copy number of F2 generation prolactin genes, eliminating breeding pigeons with the relative increment of the prolactin content being lower than 5% of the average relative increment and breeding pigeons with poor quality generated by 17 th day pigeon milk, artificially incubating pigeon eggs corresponding to the non-eliminated breeding pigeons, feeding the breeding pigeons by a nurse pigeon for growth, taking the breeding pigeons as a next screening round, and repeating the screening step in the first screening round during the second screening round, and carrying out N screening rounds to ensure that the expression of the prolactin is relatively stable; detecting and calculating the relative copy number of the prolactin gene in venous blood during the last round of screening, and selecting breeding pigeons with the relative copy number of the prolactin gene being more than 3% higher than the average relative copy number during the first round of screening as F3 generation;
4) When the F3 generation is subjected to next round breeding, the rolling sound making time in the egg guiding part is one day in advance, the blood sampling time is correspondingly one day in advance, the step 3) is repeated to screen out the F4 generation, and the steps are repeated to screen out the breeding pigeons capable of secreting pigeon milk in advance.
2. The breeding pigeon molecular assisted selection method for early secretion of pigeon milk according to claim 1, wherein the target gene primer pair P1 of the real-time fluorescent quantitative PCR is:
upstream primer F1: tcctggaacgatcccctgat;
downstream primer R1: tctgcagctggctgagaagatt;
the reference gene primer pair P2 is:
the upstream primer F2: tccttcgtctggatctggctgg;
downstream primer R2: ctctctcggctgtggtggtgaa.
3. The breeding pigeon molecular assisted breeding method for early secretion of pigeon milk according to claim 2, wherein the real-time fluorescent quantitative PCR reaction system is as follows: 2uL 10ng/uL DNA template, 10uL 2 Xfluorescent quantitative PCR buffer, upstream primer and downstream primer each 0.5uL,7 uL ddH 2 O。
4. The breeding pigeon molecular assisted selection method for early secretion of pigeon milk according to claim 2, wherein the reaction procedure of the real-time fluorescent quantitative PCR is as follows: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 35s, extension at 72℃for 40s,40 cycles; extending at 72 ℃ for 10min; preserving at 20 ℃.
5. The breeding pigeon molecular assisted selection method for early secretion of pigeon milk according to claim 1, wherein the egg guiding comprises:
a housing part having an ellipsoidal structure, the housing part being made of a hard material;
a rolling element provided in the housing member, the rolling element having a circular cross section and being in contact with an inner wall of the housing member;
the driving structure is fixed in the shell piece through a connecting piece and is used for driving the rolling bodies to rotate;
the controller is connected with the driving structure to control the start and stop of the driving structure, and is in signal connection with an external control system through a wireless transmission device;
the storage battery is electrically connected with the driving structure, the controller and the wireless transmission device to provide power for the driving structure, the controller and the wireless transmission device.
6. The auxiliary breeding method for pigeon molecules capable of secreting pigeon milk in advance according to claim 5, wherein an elastic plastic film is arranged on the inner wall of the shell, and the arc-shaped surface of the rolling body is abutted against the elastic plastic film.
7. The breeding pigeon molecule assisted breeding method for early secretion of pigeon milk according to claim 6, wherein the driving structure is a stepping motor, and an output shaft of the stepping motor is connected with the rolling body to drive the rolling body to rotate in the housing member.
8. The auxiliary breeding method for pigeon molecules capable of secreting pigeon milk in advance as claimed in claim 7, wherein a first unidirectional rotating bearing is arranged on an output shaft of the stepping motor, and the rolling body is fixedly connected with the first unidirectional rotating bearing.
9. The method for molecular assisted breeding of pigeons secreting pigeons early in claim 8, further comprising a pecking structure comprising:
the second unidirectional rotating bearing is arranged on the output shaft of the stepping motor, a gear is arranged on the second unidirectional rotating bearing, and the rotating direction of the second unidirectional rotating bearing is opposite to the rotating direction of the first unidirectional rotating bearing;
the fixing column is connected with the inner wall of the shell, and a connecting hole is formed in one end, far away from the inner wall of the shell, of the fixing column;
the first connecting part of the reciprocating rod slidably penetrates through the connecting hole, the tail end of the first connecting part of the reciprocating rod is abutted against the shell piece, a spring is arranged on the first connecting part of the reciprocating rod, and the second connecting part of the reciprocating rod is matched with the gear;
the spring is in an extending state at the beginning so as to eject the reciprocating rod rightwards to be abutted on the shell piece; when the stepping motor reversely rotates, the stepping motor drives the gear to rotate, and the gear drives the reciprocating rod to move left through the second connecting part of the reciprocating rod.
10. The method for molecular assisted breeding of pigeons secreting pigeons in advance according to claim 9, wherein the end of the first connecting portion of the reciprocating lever is of a cone-shaped structure.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310005266.4A CN116034943B (en) | 2023-01-04 | 2023-01-04 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310005266.4A CN116034943B (en) | 2023-01-04 | 2023-01-04 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116034943A true CN116034943A (en) | 2023-05-02 |
| CN116034943B CN116034943B (en) | 2024-04-16 |
Family
ID=86132595
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310005266.4A Active CN116034943B (en) | 2023-01-04 | 2023-01-04 | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116034943B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU6259590A (en) * | 1989-09-21 | 1991-03-28 | Infigen, Inc. | Enhanced gene expression in response to lactation signals |
| CN104770333A (en) * | 2015-04-10 | 2015-07-15 | 柳州市大金农业科技有限公司 | Artificial hatching method for pigeon eggs |
| CN205611531U (en) * | 2016-02-02 | 2016-10-05 | 扬州大学 | Anti cold stress use nest egg by dove |
| CN106591467A (en) * | 2017-01-04 | 2017-04-26 | 安徽农业大学 | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon |
| CN208354327U (en) * | 2018-07-05 | 2019-01-11 | 王妙娟 | A kind of henhouse of simple free-ranging chicken |
| CN109439768A (en) * | 2018-11-30 | 2019-03-08 | 贵州省畜牧兽医研究所 | The method of one breeder MH7 gene C NV marking supplementary breeding egg production |
| CN209002599U (en) * | 2018-02-13 | 2019-06-21 | 中国农业大学 | Breeding layer chicken field nest egg device |
| CN110367197A (en) * | 2019-08-26 | 2019-10-25 | 浙江省农业科学院 | A kind of corss combination combination research method of pigeon for meat |
-
2023
- 2023-01-04 CN CN202310005266.4A patent/CN116034943B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU6259590A (en) * | 1989-09-21 | 1991-03-28 | Infigen, Inc. | Enhanced gene expression in response to lactation signals |
| CN104770333A (en) * | 2015-04-10 | 2015-07-15 | 柳州市大金农业科技有限公司 | Artificial hatching method for pigeon eggs |
| CN205611531U (en) * | 2016-02-02 | 2016-10-05 | 扬州大学 | Anti cold stress use nest egg by dove |
| CN106591467A (en) * | 2017-01-04 | 2017-04-26 | 安徽农业大学 | Molecular marker assisted selection method for improving breast and leg muscle percentages of young Columba pigeon |
| CN209002599U (en) * | 2018-02-13 | 2019-06-21 | 中国农业大学 | Breeding layer chicken field nest egg device |
| CN208354327U (en) * | 2018-07-05 | 2019-01-11 | 王妙娟 | A kind of henhouse of simple free-ranging chicken |
| CN109439768A (en) * | 2018-11-30 | 2019-03-08 | 贵州省畜牧兽医研究所 | The method of one breeder MH7 gene C NV marking supplementary breeding egg production |
| CN110367197A (en) * | 2019-08-26 | 2019-10-25 | 浙江省农业科学院 | A kind of corss combination combination research method of pigeon for meat |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116034943B (en) | 2024-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103210863B (en) | Establishing method of procambarus clarkia family | |
| US20010027569A1 (en) | Method of fertilizing an avian egg in the shell | |
| CN102835352A (en) | Breeding and feeding method for special wild boars | |
| CN102077806A (en) | Method for artificial propagation of giant salamanders and cultivation of baby giant salamanders | |
| CN110352877B (en) | All-season artificial propagation method for micropterus salmoides | |
| CN104082213A (en) | Artificial propagation method for Taiwan mud fishes | |
| CN102524128B (en) | Artificial reproduction method for Pseudobagras ussuriensis | |
| CN103651245A (en) | Cock breeding method | |
| CN110226561A (en) | The method of low cost cultivation laying hen based on big data | |
| CN116034943B (en) | Breeding pigeon molecule auxiliary breeding method for early secretion of pigeon milk | |
| RU2014105167A (en) | METHOD FOR USING ACTIVATED FUNCTIONAL PROTEINS TO IMPROVE ANIMAL HEALTH | |
| CN105075949B (en) | A kind of spot trout artificial breeding method | |
| CN102369907A (en) | Method for breeding special wild chicken through artificial fertilization | |
| CN109937964B (en) | Genetic improvement method for conversion rate of high-quality chicken feed | |
| CN106172135A (en) | A kind of method of Puffer fish natural propagation | |
| CN107027674A (en) | A kind of increasing of quality and production cultural method of crab | |
| Sedykh et al. | The effect of different suckling feeding modes on the growth and development of calves in postnatal ontogenesis | |
| CN103081828A (en) | Method for artificially propagating parabramis pekinensis | |
| CN106618790B (en) | A kind of drake semen collection method | |
| Aras-Hisar et al. | Hatchery and growth performance of two trout pure breeds, Salvelinus alpinus and Salmo trutta fario, and their hybrid | |
| CN109452226A (en) | A method of improving methionine content in weanling pig serum | |
| CN106332846B (en) | Reduce the cultural method that earthworm absorbs enrichment to lead element in excrement material | |
| CN110463664A (en) | A kind of preparation method of Hucho taimen triploid seed | |
| Asipa et al. | Effect of in-ovo feeding of honey solution on hatchability and growth performance of turkey eggs and poults (A review) | |
| CN108782359A (en) | A method of control goldfish bred at annual any one day |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |