CN103757049A - Pest control constructor and method thereof - Google Patents

Pest control constructor and method thereof Download PDF

Info

Publication number
CN103757049A
CN103757049A CN201310722915.9A CN201310722915A CN103757049A CN 103757049 A CN103757049 A CN 103757049A CN 201310722915 A CN201310722915 A CN 201310722915A CN 103757049 A CN103757049 A CN 103757049A
Authority
CN
China
Prior art keywords
insect
albumen
plant
cry2aa
cry1ab
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201310722915.9A
Other languages
Chinese (zh)
Other versions
CN103757049B (en
Inventor
韩超
庞洁
丁德荣
李胜兵
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Dabeinong Biotechnology Co Ltd
Original Assignee
BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd
Beijing Dabeinong Technology Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd, Beijing Dabeinong Technology Group Co Ltd filed Critical BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd
Priority to CN201310722915.9A priority Critical patent/CN103757049B/en
Publication of CN103757049A publication Critical patent/CN103757049A/en
Application granted granted Critical
Publication of CN103757049B publication Critical patent/CN103757049B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The invention relates to a pest control constructor and a method thereof. The constructor includes Cry2Aa protein and Cry1A protein. The pest control constructor and the method disclosed by the invention control pests through the Cry2Aa protein and the Cry1Ab/Ac protein generated in plants; the constructor and the method, compared to an agricultural control method, a chemical control method and a biological control method in the prior art, are not only strong in toxicity and thorough in effect, but also capable of preventing and controlling pests through protecting the whole plants in the whole growth period; and the constructor is free of pollution and residues, stable in effect, simple, convenient and economical.

Description

The construct of Control pests and method thereof
Technical field
The present invention relates to a kind of construct and method thereof of Control pests, particularly relate to a kind of construct of expressing Cry2Aa albumen and Cry1Ab/Ac albumen in plant that is used in and carry out the cause harm method of plant of Control pests.
Background technology
Corn and paddy rice are the important food crop of China, and the grain loss causing because of insect pest of the plant is every year huge, have influence on what is more the survival state of local population.In order to prevent and treat insect pest of the plant, people use phosphoramidite chemical sterilant and Biocidal preparation conventionally, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and cause the appearance of resistance insect; And the easily degraded in environment of Biocidal preparation needs repetitive administration on producing, greatly increased production cost.
In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants with control insect pest of the plant.Cry2Aa albumen and Cry1Ab/Ac albumen are Bt toxin, are insoluble sexual partner's spore crystalline proteins, and this proteinoid is taken in and entered middle intestines by insect, and toxalbumin parent toxin is dissolved under the alkaline pH environment of insect midgut.Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragments by parent toxin; Receptors bind on active fragments and insect midgut epithelial cell membrane upper surface, insertion goldbeater's skin, causes cytolemma to occur perforation focus, destroys the inside and outside osmotic pressure variation of cytolemma and pH balance etc., upsets the digestive process of insect, finally causes its death.
Cry2Aa albumen and Cry1Ab/Ac albumen major part are applied in plant with monogenic form at present, especially Cry2Aa albumen, it is not high to the resistance of striped rice borer and pink rice borer while existing with single-gene form, may cause the generation to these two independent resistances of gene of striped rice borer and pink rice borer, hinder the popularization of transgenosis resistant material.
Summary of the invention
The construct and the method thereof that the object of this invention is to provide a kind of Control pests, provide first the construct of expressing Cry2Aa albumen and Cry1Ab/Ac albumen by generation to carry out the Control pests method of plant that causes harm, and effectively overcome the technological deficiencies such as prior art cultural control, chemical prevention and biological control.
For achieving the above object, the invention provides a kind of construct, comprise Cry2Aa albumen and Cry1A albumen.
Further, described construct comprises the first expression cassette and the second expression cassette, and described the first expression cassette comprises Cry2Aa albumen, and described the second expression cassette comprises Cry1A albumen.
Further, described the first expression cassette also comprises the regulating and controlling sequence being effectively connected with Cry2Aa albumen, and described the second expression cassette also comprises the regulating and controlling sequence being effectively connected with Cry1A albumen.
On the basis of technique scheme, the aminoacid sequence of described Cry2Aa albumen has the aminoacid sequence shown in SEQ ID NO:1.The nucleotide sequence of described Cry2Aa albumen has the nucleotide sequence shown in SEQ ID NO:3.
Further, described Cry1A albumen is Cry1Ab/Ac albumen.The aminoacid sequence of described Cry1Ab/Ac albumen has the aminoacid sequence shown in SEQ ID NO:2.The nucleotide sequence of described Cry1Ab/Ac albumen has the nucleotide sequence shown in SEQ ID NO:4.
For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described construct.
For achieving the above object, the present invention also provides a kind of method that produces insect-killing protein, comprising:
The cell of the transformed host biology that acquisition comprises described construct;
Under the condition that allows generation insect-killing protein, cultivate the cell of described transformed host biology;
Reclaim described insect-killing protein.
Further, described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.
Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.
For achieving the above object, the present invention also provides a kind of method for increasing insect target scope, comprising: the insect-killing protein of described construct coding is expressed in plant together with at least one the third desinsection Nucleotide of insect-killing protein that is different from described construct coding.
Further, can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase of described the third desinsection Nucleotide.
Selectively, described the third desinsection Nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.
In the present invention, the expression of described construct in a kind of transgenic plant can be accompanied by the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein.Thisly surpass a kind of Pesticidal toxins co expression in same strain transgenic plant and can plant be comprised and express required gene and realize by genetic engineering.In addition, a kind of plant (the 1st parent) can be expressed the protein of described construct coding by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.By the 1st parent and the 2nd parent, hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent.
RNA disturbs (RNA interference, RNAi) to refer to the phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA during evolution.Therefore can use RNAi technology specific depletion or close the expression of specific gene.
For achieving the above object, the present invention also provides a kind of method that produces zoophobous, comprising: described construct or described recombinant vectors are imported to plant.
For achieving the above object; the present invention also provides a kind of method of the damage of avoiding being caused by insect pest for the protection of plant; comprise: described construct or described recombinant vectors are imported to plant, make the plant generation after importing enough protect it to avoid the insect-killing protein of insect pest infringement amount.
Described construct or described recombinant vectors are imported to plant, in the present invention for foreign DNA is imported to vegetable cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.
For achieving the above object, the present invention also provides a kind of method of controlling insect pest, comprising: insect pest is contacted with the insect repressible protein of the described construct coding of amount of suppression.
Further, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the vegetable cell that produces it, and described insect pest contacts with described Cry1Ab/Ac albumen with described Cry2Aa albumen by the described vegetable cell of ingesting.
Further, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the transgenic plant that produce it, described insect pest contacts with described Cry1Ab/Ac albumen with described Cry2Aa albumen by the tissue of the described transgenic plant that ingest, after contact, the growth of described insect pest is suppressed and/or causes death, to realize the cause harm control of plant of insect pest.
On the basis of technique scheme, described transgenic plant can be in any breeding time.
The tissue of described transgenic plant can be blade, stem stalk, tassel, female fringe, flower pesticide or filigree.
Described to insect pest cause harm plant control because of plantation place change do not change.
Described insect pest is caused harm to the control of plant not because the change of implantation time changes.
Described plant can be from corn, paddy rice, Chinese sorghum, wheat, grain, cotton, reed, sugarcane, wild rice stem, broad bean or rape.
Step before described contact procedure is for planting the plant of the polynucleotide that contain the described Cry2Aa albumen of coding and described Cry1Ab/Ac albumen.
On the basis of technique scheme, described insect pest is lepidopterous insects insect.Preferably, described lepidopterous insects insect is pink rice borer and/or striped rice borer.
For achieving the above object, the present invention also provides a kind of purposes of insect repressible protein Quality Control insect pest processed of described construct coding.
The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.
Polynucleotide described in the present invention and/or Nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, polynucleotide of the present invention and/or Nucleotide can be placed under object host's regulating and controlling sequence control.
Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes the use to the polynucleotide of example in sequence table and complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, typical case is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." have justice " or " coding " chain has a series of codons (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention also comprises that the DNA with example has RNA and the PNA(peptide nucleic acid(PNA) of suitable function).
Amplifying nucleic acid molecule of the present invention or its fragment under stringent condition with Cry2Aa gene of the present invention and/or Cry1Ab/Ac gene recombination.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of Cry2Aa gene of the present invention and/or Cry1Ab/Ac gene.Nucleic acid molecule or its fragment can be carried out specific hybrid with other nucleic acid molecule under a stable condition.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementarity completely, claim that one of them nucleic acid molecule is another nucleic acid molecule " complement ".In the present invention, when each Nucleotide of a nucleic acid molecule and the corresponding Nucleotide complementation of another nucleic acid molecule, claim these two nucleic acid molecule to demonstrate " complete complementary ".If thereby two nucleic acid molecule can make with enough stability phase mutual crosses them anneal and be bonded to each other under at least conventional " low strict " condition, claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if thereby two nucleic acid molecule can make with enough stability phase mutual crosses them under " highly strict " condition of routine, anneal and be bonded to each other, and claim these two nucleic acid molecule to there is " complementarity ".From complete complementary, depart from and can allow, as long as this, depart from two molecules of incomplete prevention and form duplex structure.In order to make a nucleic acid molecule as primer or probe, only need to guarantee that it has sufficient complementarity in sequence, so that can form stable duplex structure under adopted specific solvent and salt concn.
In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under height stringent condition can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matching.Promote the applicable stringent condition of DNA hybridization, for example, process greatly under 45 ℃ of conditions by 6.0 * sodium chloride/sodium citrate (SSC), then under 50 ℃ of conditions, with 2.0 * SSC, wash, these conditions are known to those skilled in the art.For example, the salt concn in washing step can be selected from the approximately 2.0 * SSC, 50 ℃ of low stringent condition to the approximately 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can, from approximately 22 ℃ of the room temperatures of low stringent condition, be elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salt concn can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, at 65 ℃, with SEQ ID NO:3 and/or SEQ ID NO:4, specific hybrid occurs, and then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.
Therefore, there is anti-insect activity and comprise in the present invention with the sequence of SEQ ID NO:3 of the present invention and/or SEQ ID NO:4 hybridization under stringent condition.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.
Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise the part and/fragment (comprise with full length protein and comparing and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), mosaic and fusion rotein of the insecticidal activity feature of the protein of having preserved described particular example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the albumen of equal value of insecticidal activity.Described " albumen of equal value " refers to the bioactive albumen with the albumen of claim with identical or essentially identical anti-lepidopterous insects insect.
" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that is for example applicable to expression of plants) of the original DNA that relates to or protein sequence (Nucleotide or amino acid), can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.
Use standard technique can modifying factor and the easy gene variant that builds.For example, the technology of well known manufacturing place sudden change.For example U.S. Patent number 5605793 has been described the method for using DNA to reassembly other molecular diversity of generation after random fracture again.Can use commercialization endonuclease to manufacture the fragment of full-length gene, and can use exonuclease according to standard program.For example, can use enzyme such as Bal31 or site-directed mutagenesis from the end system of these genes excise Nucleotide.Can also use multiple restriction enzyme to obtain the gene of coding active fragments.Can use proteolytic enzyme directly to obtain the active fragments of these toxin.
The present invention can derive from B.t. isolate and/or DNA library the gene of albumen of equal value and/or these albumen of equal value of encoding.There is several different methods to obtain insecticidal proteins of the present invention.For example, can use the antibody of the open and claimed insecticidal proteins of the present invention to identify and separated other albumen from protein mixture.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then can by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western trace method use these antibody single-minded identify the albumen of equal value of feature activity.Can use this area standard program to be easy to the antibody of the fragment of disclosed albumen in preparation the present invention or albumen of equal value or this proteinoid.Then can from microorganism, obtain the gene of these albumen of coding.
Due to the Feng Yuxing of genetic codon, the multiple different DNA sequence dna identical aminoacid sequence of can encoding.Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's state of the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment that retains insecticidal activity.
In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, i.e. and the folding and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and for example aminoterminal extends a methionine residues; Little connection peptides, for example an about 20-25 residue is long.
The conservative example replacing is the replacement occurring in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Conventionally those aminoacid replacement that do not change given activity are well-known in this area, and by, for example, N.Neurath and R.L.Hill are described in the < < Protein > > of new york academic press (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.
For a person skilled in the art apparently, this replacement can occur outside the region that molecular function is played an important role, and still produces active polypeptide.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino-acid residue, can be according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thereby determines the amino-acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).
In the present invention, Cry1A albumen includes but not limited to Cry1Ab, Cry1Ac, Cry1Ab/Ac or Cry1Ah albumen, or has at least 70% homology with the aminoacid sequence of above-mentioned albumen and pink rice borer is had to desinsection fragment or the functional area of insecticidal activity.
Therefore the aminoacid sequence that, has certain homology with the aminoacid sequence shown in sequence 1 and/or sequence 2 is also included within the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotide of the present invention and protein.For example there are 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity with the sequence of example of the present invention.
Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, and leader sequence, intron and other are operably connected to the adjusting sequence of described Cry2Aa albumen and described Cry1A albumen.
Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected encoding sequence is expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, the corn Ubi promotor of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization of plant (can be tested and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound causing, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the proteolytic enzyme suppressor gene of potato and tomato (pin I and pin II) and zein enzyme suppressor gene (MPI).
Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.
Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus group leader sequence, as the MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.
Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.
For monocotyledons application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledons application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.
Described terminator can be the applicable polyadenylation signal sequence working in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene polyadenylation signal sequence, derive from proteinase inhibitor II (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.
Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.In the present invention, " effectively connect " and can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control.When interested sequence encoding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is the expression of transcript fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiator codon of encoding sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and mode of connection make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of genetic expression function is provided, promotor for example, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, sequence external or the interior assistance of body series of operations (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).
It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is pink rice borer and/or striped rice borer insect.
In the present invention, Cry2A albumen has toxicity to pink rice borer insect.Plant in the present invention, particularly paddy rice and corn, in its genome, contain foreign DNA, the nucleotide sequence that described foreign DNA comprises coding Cry2Aa albumen and Cry1A albumen, insect pest is organized with this albumen and is contacted by feeding plant, and after contact, pink rice borer insect growth is suppressed and/or causes death.Suppress to refer to lethal or sub-lethal.Meanwhile, plant should be normal in form, and can under ordinary method, cultivate consumption and/or the generation for product.In addition, this plant can basically eliminate to the needs of chemistry or biotic pesticide (described chemistry or biotic pesticide are the sterilant for the pink rice borer insect of Cry2A albumen institute target).
The expression level of insecticidal crystal protein in vegetable material (ICP) can detect by described several different methods in this area, for example by application special primer to organizing the mRNA of the coded insect-killing protein of interior generation to carry out quantitatively, or the direct amount of the insect-killing protein of specific detection generation.
Can apply the insecticidal effect of ICP in different test determination plants.In the present invention, targeted insect is mainly pink rice borer and/or striped rice borer.
In the present invention, described Cry2Aa albumen can have the aminoacid sequence shown in SEQ ID NO:1 in sequence table; Described Cry1Ab/Ac albumen can have the aminoacid sequence shown in SEQ ID NO:2 in sequence table.Except the coding region that comprises Cry2Aa albumen and Cry1A albumen, also can comprise other elements, the protein of the coding region of the transit peptides of for example encoding or codes selection mark.
In addition, the construct that comprises code book invention Cry2Aa albumen and Cry1A albumen can also be expressed with together with the protein of at least one herbicide resistance gene of encoding in plant, described herbicide resistance gene includes but not limited to, glufosinates resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), glyphosate resistance gene (as EPSPS gene), bromoxynil (bromoxynil) resistant gene, sulfonylurea resistant gene, resistant gene to weedicide dalapon, resistant gene to the resistant gene of cyanamide or glutamine synthetase inhibitor (as PPT), thereby obtain, both there is high insecticidal activity, the transgenic plant again with Herbicid resistant.
The construct and the method thereof that the invention provides a kind of Control pests, have the following advantages:
1, virulence is strong, effect is thorough.The Cry2Aa albumen and the Cry1A albumen that comprise two kinds of different insecticidal mechanisms due to construct of the present invention, the insecticidal toxicity of the transgenic plant that make to comprise construct of the present invention is strong, especially pink rice borer and striped rice borer, the prevention effect of newly hatched larvae is almost absolutely, the also stasi substantially of larva of surviving extremely individually, after 3 days, larva substantially still incubates state in just, and stasi, and transgenic plant are only subject to slight damage substantially.
2, internal cause control.Prior art is to be mainly that external cause is controlled causing harm of insect pest by external action, as cultural control, chemical prevention and biological control; And the present invention to be Cry2Aa albumen and the Cry1A albumen can kill pink rice borer and striped rice borer by producing in plant materials carry out Control pests, by internal cause, prevent and treat.
3, pollution-free, noresidue.Although the chemical prevention and control method that prior art is used has played certain effect to causing harm of Control pests, also people, animal and farmland ecosystem have been brought to pollution, destruction and residual simultaneously; Use construct and the method thereof of Control pests of the present invention, can eliminate above-mentioned adverse consequences.
4, control in the time of infertility.The method of the Control pests that prior art is used is all interim; and the present invention carries out the protection in the time of infertility to plant; transgenic plant (Cry2Aa albumen and Cry1A albumen) from germinateing, growth, until bloom, result, can avoid suffering the infringement of insect.
5, whole plant control.The method of the Control pests that prior art is used is locality mostly, as foliage-spray; And the present invention protects whole plant, as the blade of transgenic plant (Cry2Aa albumen and Cry1A albumen), stem stalk, tassel, female fringe, flower pesticide, filigree etc. all can be resisted insect infringement.
6, effect stability.The biotic pesticide that prior art is used need to directly spray application to crop surface, therefore cause activated crystalline protein (comprising Cry2Aa albumen and Cry1A albumen) to be degraded in environment; The present invention expresses described Cry2Aa albumen and Cry1A albumen in plant materials, effectively avoided biotic pesticide in the unsettled defect of nature, and the prevention effect of transgenic plant of the present invention (Cry2Aa albumen and Cry1A albumen) in different location, different time, different genetic background be all also stable and consistent.
7, simple, convenient, economical.The biotic pesticide that prior art is used are easily degraded in environment, therefore need duplication of production and repeated application, and for the practical application in agriculture production brings difficulty, have increased widely cost; The present invention only need plant the transgenic plant that can express Cry2Aa albumen and Cry1A albumen, and does not need to adopt other measure, thereby has saved a large amount of human and material resources and financial resources.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 is that the construct of Control pests of the present invention and the recombinant cloning vector DBN01-T of method thereof build schema;
Fig. 2 is that the construct of Control pests of the present invention and the recombinant expression vector DBN100074 of method thereof build schema;
Fig. 3 is the pest-resistant design sketch of the construct of Control pests of the present invention and the transgenic corn plant of method inoculation pink rice borer thereof;
Fig. 4 is the pest-resistant design sketch of the construct of Control pests of the present invention and the transgenic rice plant of method inoculation pink rice borer thereof;
Fig. 5 is the pest-resistant design sketch of the construct of Control pests of the present invention and the transgenic rice plant of method inoculation striped rice borer thereof.
Embodiment
Below by specific embodiment, further illustrate the construct of Control pests of the present invention and the technical scheme of method thereof.
The acquisition of the first embodiment, Cry2Aa gene and Cry1Ab/Ac gene and synthetic
1, obtain Cry2Aa and Cry1Ab/Ac nucleotide sequence
The aminoacid sequence of Cry2Aa insect-killing protein (633 amino acid), as shown in SEQ ID NO:1 in sequence table; Coding is corresponding to the Cry2Aa nucleotide sequence (1902 Nucleotide) of the aminoacid sequence (633 amino acid) of described Cry2Aa insect-killing protein, as shown in SEQ ID NO:3 in sequence table.
The aminoacid sequence of Cry1Ab/Ac insect-killing protein (609 amino acid), as shown in SEQ ID NO:2 in sequence table; Coding is corresponding to the Cry1Ab/Ac nucleotide sequence (1830 Nucleotide) of the aminoacid sequence (609 amino acid) of described Cry1Ab/Ac insect-killing protein, as shown in SEQ ID NO:4 in sequence table.
2, synthetic above-mentioned nucleotide sequence
Described Cry2Aa nucleotide sequence (as shown in SEQ ID NO:3 in sequence table) and as described in Cry1Ab/Ac nucleotide sequence (as shown in SEQ ID NO:4 in sequence table) by Nanjing Genscript Biotechnology Co., Ltd., synthesized; 5 ' end of synthetic described Cry2Aa nucleotide sequence (SEQ ID NO:3) is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry2Aa nucleotide sequence (SEQ ID NO:3) is also connected with BamHI restriction enzyme site; 5 ' end of synthetic described Cry1Ab/Ac nucleotide sequence (SEQ ID NO:4) is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1Ab/Ac nucleotide sequence (SEQ ID NO:4) is also connected with KpnI restriction enzyme site.
The structure of the second embodiment, recombinant expression vector and recombinant expression vector transform Agrobacterium
1, build the recombinant cloning vector that contains Cry2Aa gene and Cry1Ab/Ac gene
Synthetic Cry2Aa nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry2Aa is Cry2Aa nucleotide sequence (SEQ ID NO:3); MCS is multiple clone site).
Then recombinant cloning vector DBN01-T is transformed to intestinal bacteria T1 competent cell (Transgen by heat shock method, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaking culture 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble IPTG(isopropylthio-β-D-galactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl10g/L, penbritin 100mg/L, adjusts pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that adds the new preparation of 200 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (3M Potassium ethanoate, 5M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by concentration (V/V), dries; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.
The plasmid extracting is cut after evaluation through XhoI and BamHI enzyme, positive colony is carried out to sequence verification, result shows that the described Cry2Aa nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:3 in sequence table as, and Cry2Aa nucleotide sequence correctly inserts.
According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described Cry1Ab/Ac nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, Cry1Ab/Ac is Cry1Ab/Ac nucleotide sequence (SEQ ID NO:4).Enzyme is cut with Cry1Ab/Ac nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T and is correctly inserted.
2, build the recombinant expression vector that contains Cry2Aa gene and Cry1Ab/Ac gene
With restriction enzyme NcoI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the Cry2Aa nucleotide sequence fragment cutting is inserted between the NcoI and BamHI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, be built into recombinant expression vector DBN100074, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:5); Cry2Aa:Cry2Aa nucleotide sequence (SEQ ID NO:3); Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:6); PMI: Phophomannose isomerase gene (SEQ ID NO:7); LB: left margin).
Recombinant expression vector DBN100074 is transformed to intestinal bacteria T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100074), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaking culture 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, kantlex 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme XhoI and BamHI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector DBN100074 between NcoI and BamHI site classify sequence table as in nucleotide sequence, i.e. Cry2Aa nucleotide sequence shown in SEQ ID NO:3.
According to the method for above-mentioned structure recombinant expression vector DBN100074, NcoI and KpnI enzyme are cut to the described Cry1Ab/Ac nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression vector DBN100056.Enzyme is cut with sequence verification recombinant expression vector DBN100056 containing nucleotide sequence shown in SEQ ID NO:4 in ordered list, i.e. Cry2Aa nucleotide sequence, and described Cry2Aa nucleotide sequence can connect described Ubi promotor and Nos terminator.
According to the method for above-mentioned structure recombinant expression vector DBN100074, by NcoI and BamHI, NcoI and KpnI respectively enzyme cut described Cry2Aa nucleotide sequence and the Cry1Ab/Ac nucleotide sequence that recombinant cloning vector DBN01-T and DBN02-T cut and insert expression vector DBNBC-01, obtain recombinant expression vector DBN100058.Enzyme is cut with sequence verification recombinant expression vector DBN100058 containing nucleotide sequence shown in SEQ ID NO:3 in ordered list and SEQ ID NO:4, be Cry2Aa nucleotide sequence and Cry1Ab/Ac nucleotide sequence, described Cry2Aa nucleotide sequence can be connected described Ubi promotor and Nos terminator with Cry1Ab/Ac nucleotide sequence.
3, recombinant expression vector transforms Agrobacterium
Oneself is transformed into Agrobacterium LBA4404 (Invitrgen through building correct recombinant expression vector DBN100074, DBN100056 and DBN100058 by liquid nitrogen method, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, with restriction enzyme A hdI and XhoI to recombinant expression vector DBN100074, DBN100056 and DBN100058 enzyme carry out enzyme after cutting and cut checking, result shows recombinant expression vector DBN100074, DBN100056 and DBN100058 structure are entirely true.
The 3rd embodiment, proceed to acquisition and the checking of the milpa of Cry2Aa and Cry1Ab/Ac gene
1, obtain the milpa that proceeds to Cry2Aa and Cry1Ab/Ac gene
The Agrobacterium infestation method adopting according to routine, the corn variety of sterile culture is combined to 31(Z31) rataria and the second embodiment in Agrobacterium described in 3 cultivate altogether, with by the 2 recombinant expression vector DBN100074 that build in the second embodiment, T-DNA(in DBN100056 and DBN100058 comprises the promoter sequence of corn Ubiquitin gene, Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtained the milpa that proceeds to Cry2Aa nucleotide sequence, proceed to the milpa and the milpa that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence of Cry1Ab/Ac nucleotide sequence, in contrast with wild-type milpa simultaneously.
For agriculture bacillus mediated corn, transform, briefly, separated immature rataria from corn, with agrobacterium suspension, contact rataria, wherein Agrobacterium can be passed to Cry2Aa nucleotide sequence and/or Cry1Ab/Ac nucleotide sequence at least one cell (step 1: infect step) of one of rataria, in this step, rataria preferably immerses agrobacterium suspension (OD 660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.
The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.
2, with TaqMan checking, proceed to the milpa of Cry2Aa and Cry1Ab/Ac gene
Get respectively and proceed to the milpa of Cry2Aa nucleotide sequence, the about 100mg of blade of milpa that proceeds to the milpa of Cry1Ab/Ac nucleotide sequence and proceed to Cry2Aa-Cry1Ab/Ac nucleotide sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Cry2Aa gene and Cry1Ac/Ab gene.In contrast with wild-type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.
The concrete grammar that detects Cry2Aa gene and Cry1Ac/Ab gene copy number is as follows:
Step 11, get each 100mg of blade that proceeds to the milpa of Cry2Aa nucleotide sequence, the milpa that proceeds to Cry1Ab/Ac nucleotide sequence, the milpa that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence and wild-type milpa respectively, in mortar, with liquid nitrogen, be ground into homogenate respectively, each sample is got 3 repetitions;
The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;
Step 14, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;
Step 15, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard substance, with the sample of wild-type milpa in contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Following primer and probe are used for detecting Cry2Aa nucleotide sequence:
Primer 1(CF1): TCGGCACAGTCTCCAGCTTC is as shown in SEQ ID NO:8 in sequence table;
Primer 2 (CR1): CCACAGCTCACTGAGAATCCG is as shown in SEQ ID NO:9 in sequence table;
Probe 1(CP1): CCTGAAGAAGGTCGGCTCGCTGATC is as shown in SEQ ID NO:10 in sequence table;
Following primer and probe are used for detecting Cry1Ab/Ac nucleotide sequence:
Primer 3(CF2): TGCGTATTCAATTCAACGACATG is as shown in SEQ ID NO:11 in sequence table;
Primer 4(CR2): CTTGGTAGTTCTGGACTGCGAAC is as shown in SEQ ID NO:12 in sequence table;
Probe 2(CP2): CAGCGCCTTGACCACAGCTATCCC is as shown in SEQ ID NO:13 in sequence table;
PCR reaction system is:
Figure BDA0000445468450000141
Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l1 * TE damping fluid, and at 4 ℃, be housed in amber test tube.
PCR reaction conditions is:
Figure BDA0000445468450000142
Utilize SDS2.3 software (Applied Biosystems) analytical data.
Experimental result shows, all oneself is incorporated in the genome of detected milpa for Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence and Cry2Aa-Cry1Ab/Ac nucleotide sequence, and proceed to the milpa of Cry2Aa nucleotide sequence, the milpa that proceeds to the milpa of Cry1Ab/Ac nucleotide sequence and proceed to Cry2Aa-Cry1Ab/Ac nucleotide sequence has all obtained the transgenic corn plant that contains single copy Cry2Aa gene and/or Cry1Ab/Ac gene.
The pest-resistant effect detection of the 4th embodiment, transgenic corn plant
By proceeding to the milpa of Cry2Aa nucleotide sequence, the milpa that proceeds to Cry1Ab/Ac nucleotide sequence, the milpa that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type milpa and being accredited as not genetically modified milpa through Taqman, pink rice borer is carried out to pest-resistant effect detection.
Get respectively the milpa that proceeds to Cry2Aa nucleotide sequence, proceed to the milpa of Cry1Ab/Ac nucleotide sequence, proceed to the milpa of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type milpa and be accredited as the fresh blade (lobus cardiacus) of not genetically modified milpa (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm * 4cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the pink rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to pink rice borer larvae development progress, three indexs of mortality ratio and blade injury rate, obtain resistance total points: total points=100 * mortality ratio+[100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM1) totally 1 strain, (CK1) of wild-type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 1 and Fig. 3.
The pest-resistant experimental result of table 1, transgenic corn plant inoculation pink rice borer
Figure BDA0000445468450000151
The result of table 1 shows: milpa raw that proceeds to the milpa of Cry2Aa nucleotide sequence and proceed to Cry1Ab/Ac nucleotide sequence survey total points all about 200 minutes or more than, milpa raw that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence survey total points can be up to 280 minutes about; And through Taqman, be accredited as not genetically modified milpa and wild-type milpa raw survey total points generally about 50 minutes or below.The result of Fig. 3 shows: compare with wild-type milpa, the milpa that proceeds to Cry2Aa nucleotide sequence all can be caused the death of pink rice borer larva with the milpa that proceeds to Cry1Ab/Ac nucleotide sequence, its blade still can be subject to the damage of 25% left and right, and the milpa that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence is almost absolutely just incubating the prevention effect of pink rice borer larva, the also stasi substantially of larva of surviving extremely individually, after 3 days, larva substantially still incubates state in just, and the milpa that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence is only subject to slight damage substantially, it on blade, is only the damage of minute quantity Pinhole-shaped, its blade injury rate is in 3% left and right or following.
The milpa that proof proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence thus demonstrates the activity of high resistance pink rice borer, thereby this activity is enough to that the growth of pink rice borer is produced to ill effect, it is controlled.
The 5th embodiment, proceed to acquisition and the checking of the rice plant of Cry2Aa and Cry1Ab/Ac gene
1, obtain the rice plant that proceeds to Cry2Aa and Cry1Ab/Ac gene
The Agrobacterium infestation method adopting according to routine, Agrobacterium described in 3 in the fine callus of japonica rice variety Japan of sterile culture and the second embodiment is cultivated altogether, with by the 2 recombinant expression vector DBN100074 that build in the second embodiment, T-DNA(in DBN100056 and DBN100058 comprises the promoter sequence of corn Ubiquitin gene, Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in rice chromosome group, obtained the rice plant that proceeds to Cry2Aa nucleotide sequence, proceed to the rice plant and the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence of Cry1Ab/Ac nucleotide sequence, in contrast with wild-type rice plant simultaneously.
For agriculture bacillus mediated rice conversion, briefly, rice paddy seed is seeded in to inducing culture (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2, 4-dichlorphenoxyacetic acid (2, 4-D) 2mg/L, plant gel 3g/L, pH5.8) on, from Mature Embryos of Rice, induce callus (step 1: callus of induce step), afterwards, preferred callus, with agrobacterium suspension, contact callus, wherein Agrobacterium can be passed at least one cell (step 2: infect step) on callus by Cry2Aa nucleotide sequence and/or Cry1Ab/Ac nucleotide sequence.In this step, callus preferably immerses agrobacterium suspension (OD660=0.3, infect substratum (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in, to start, infect.Callus and Agrobacterium are cultivated one period (3 days) (step 3: be total to culturing step) altogether.Preferably, callus after infecting step at solid medium (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation.After this common cultivation stage, there is " recovery " step.In " recovery " step, recovery media (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 4: recovering step) of not adding vegetable transformant.Preferably, callus is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the callus of inoculation is containing the transformed calli (step 5: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, callus is having the screening solid medium of selective agent (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 10g/L, seminose 10g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 6: regeneration step), preferably, above cultivate with aftergrowth at solid medium (N6 division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.
The resistant calli that screening obtains is transferred to described N6 division culture medium (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, pH5.8) upper, cultivate differentiation at 25 ℃.It is upper that seedling out of differentiation is transferred to described MS root media (MS salt, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8), is cultured to about 10cm at 25 ℃ high, moves to hot-house culture to solid.In greenhouse, cultivate every day at 30 ℃.
2, with TaqMan checking, proceed to the rice plant of Cry2Aa and Cry1Ab/Ac gene
Get respectively and proceed to the rice plant of Cry2Aa nucleotide sequence, the about 100mg of blade of rice plant that proceeds to the rice plant of Cry1Ab/Ac nucleotide sequence and proceed to Cry2Aa-Cry1Ab/Ac nucleotide sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of Cry2Aa gene and Cry1Ab/Ac gene.In contrast with wild-type rice plant, according to 2 use TaqMan in above-mentioned the 3rd embodiment, verify that the method for the milpa that proceeds to Cry2Aa and Cry1Ab/Ac gene detects analysis simultaneously.3 repetitions are established in experiment, average.
Experimental result shows, all oneself is incorporated in the genome of detected rice plant for Cry2Aa nucleotide sequence, Cry1Ab/Ac nucleotide sequence and Cry2Aa-Cry1Ab/Ac nucleotide sequence, and proceed to the rice plant of Cry2Aa nucleotide sequence, the rice plant that proceeds to the rice plant of Cry1Ab/Ac nucleotide sequence and proceed to Cry2Aa-Cry1Ab/Ac nucleotide sequence has all obtained the transgenic rice plant that contains single copy Cry2Aa gene and/or Cry1Ab/Ac gene.
The pest-resistant effect detection of the 6th embodiment, transgenic rice plant
By proceeding to the rice plant of Cry2Aa nucleotide sequence, the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence, the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type rice plant and being accredited as not genetically modified rice plant through Taqman, pink rice borer and striped rice borer are carried out to pest-resistant effect detection.
(1) pink rice borer: get respectively the rice plant that proceeds to Cry2Aa nucleotide sequence, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence, proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed to vein, be cut into the strip of about 1cm * 4cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the pink rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to pink rice borer larvae development progress, three indexs of mortality ratio and blade injury rate, obtain resistance total points: total points=100 * mortality ratio+[100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S10, S11 and S12) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S13, S14 and S15) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild-type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 2 and Fig. 4.
The pest-resistant experimental result of table 2, transgenic rice plant inoculation pink rice borer
Figure BDA0000445468450000181
The result of table 2 shows: rice plant raw that proceeds to the rice plant of Cry2Aa nucleotide sequence and proceed to Cry1Ab/Ac nucleotide sequence surveyed total points all about 220 minutes, and rice plant raw that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence surveyed total points can be up to more than 280 minutes; And the raw total points of surveying that is accredited as not genetically modified rice plant and wild-type rice plant through Taqman is generally about 55 minutes.The result of Fig. 4 shows: compare with wild-type rice plant, the rice plant that proceeds to Cry2Aa nucleotide sequence all can cause the death of pink rice borer larva with the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence, its blade still can be subject to 25% left and right damage, and the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence is almost absolutely just incubating the prevention effect of pink rice borer larva, the also stasi substantially of larva of surviving extremely individually, after 3 days, larva substantially still incubates state in just, and the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence is only subject to slight damage substantially, it on blade, is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 5%.
The rice plant that proof proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence thus demonstrates the activity of high resistance pink rice borer, thereby this activity is enough to that the growth of pink rice borer is produced to ill effect, it is controlled.
(2) striped rice borer: get respectively the rice plant that proceeds to Cry2Aa nucleotide sequence, proceed to the rice plant of Cry1Ab/Ac nucleotide sequence, proceed to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence, wild-type rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed to vein, be cut into the strip of about 1cm * 4cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the striped rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to Chilo spp larvae development progress, three indexs of mortality ratio and blade injury rate, obtain resistance total points: total points=100 * mortality ratio+[100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)]+100 * (1-blade injury rate).Proceed to totally 3 strains (S10, S11 and S12) of Cry2Aa nucleotide sequence, proceed to totally 3 strains (S13, S14 and S15) of Cry1Ab/Ac nucleotide sequence, proceed to totally 3 strains (S16, S17 and S18) of Cry2Aa-Cry1Ab/Ac nucleotide sequence, through Taqman, be accredited as not genetically modified (NGM2) totally 1 strain, (CK2) of wild-type be totally 1 strain; From each strain, select 3 strains to test, every strain repeats 6 times.Result is as shown in table 3 and Fig. 5.
The pest-resistant experimental result of table 3, transgenic rice plant inoculation striped rice borer
Figure BDA0000445468450000191
Figure BDA0000445468450000201
The result of table 3 shows: the life that proceeds to the rice plant of Cry2Aa nucleotide sequence was surveyed total points about 220 minutes, and the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence all can be up to more than 290 minutes with the raw survey total points that proceeds to the rice plant of Cry2Aa-Cry1Ab/Ac nucleotide sequence; And through Taqman, be accredited as not genetically modified rice plant and wild-type rice plant raw survey total points generally about 50 minutes or below.The result of Fig. 5 shows: compare with wild-type rice plant, the rice plant that proceeds to Cry2Aa nucleotide sequence can cause the death of Chilo spp larvae, its blade still can be subject to the damage of 20% left and right, and the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence is almost absolutely just incubating the prevention effect of Chilo spp larvae with the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence, the also stasi substantially of larva of surviving extremely individually, after 3 days, larva substantially still incubates state in just, and the rice plant that proceeds to Cry1Ab/Ac nucleotide sequence is only subject to slight damage substantially with the rice plant that proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence, it on blade, is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 2%.
The rice plant that proof proceeds to Cry2Aa-Cry1Ab/Ac nucleotide sequence thus demonstrates the activity of high resistance striped rice borer, thereby this activity is enough to that the growth of striped rice borer is produced to ill effect, it is controlled.
In sum, the construct of Control pests of the present invention and method thereof are by producing Cry2Aa and Cry1Ab/Ac albumen carrys out Control pests in plant materials; Compare with cultural control method, chemical prevention and control method and biological control method that prior art is used; not only virulence is strong in the present invention, effect is thorough; and plant is carried out to the protection of the time of infertility, whole plant with the infringement of pest control; and pollution-free, noresidue; effect stability, simple, convenient, economical.
It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.
Figure IDA0000445468510000011
Figure IDA0000445468510000021
Figure IDA0000445468510000031
Figure IDA0000445468510000041
Figure IDA0000445468510000051
Figure IDA0000445468510000061
Figure IDA0000445468510000071
Figure IDA0000445468510000081
Figure IDA0000445468510000091
Figure IDA0000445468510000101
Figure IDA0000445468510000111
Figure IDA0000445468510000121

Claims (29)

1. a construct, is characterized in that, comprises Cry2Aa albumen and Cry1A albumen.
2. construct according to claim 1, is characterized in that, described construct comprises the first expression cassette and the second expression cassette, and described the first expression cassette comprises Cry2Aa albumen, and described the second expression cassette comprises Cry1A albumen.
3. construct according to claim 2, is characterized in that, described the first expression cassette also comprises the regulating and controlling sequence being effectively connected with Cry2Aa albumen, and described the second expression cassette also comprises the regulating and controlling sequence being effectively connected with Cry1A albumen.
4. according to construct described in claim 1-3 any one, it is characterized in that, the aminoacid sequence of described Cry2Aa albumen has the aminoacid sequence shown in SEQ ID NO:1.
5. construct according to claim 4, is characterized in that, the nucleotide sequence of described Cry2Aa albumen has the nucleotide sequence shown in SEQ ID NO:3.
6. according to construct described in claim 1-5 any one, it is characterized in that, described Cry1A albumen is Cry1Ab/Ac albumen.
7. construct according to claim 6, is characterized in that, the aminoacid sequence of described Cry1Ab/Ac albumen has the aminoacid sequence shown in SEQ ID NO:2.
8. construct according to claim 7, is characterized in that, the nucleotide sequence of described Cry1Ab/Ac albumen has the nucleotide sequence shown in SEQ ID NO:4.
9. a recombinant vectors that comprises construct described in claim 1-8 any one.
10. a method that produces insect-killing protein, is characterized in that, comprising:
The cell that acquisition comprises the transformed host biology of construct described in claim 1-8 any one;
Under the condition that allows generation insect-killing protein, cultivate the cell of described transformed host biology;
Reclaim described insect-killing protein.
11. produce the method for insect-killing protein according to claim 10, it is characterized in that, described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.
12. according to the method that produces insect-killing protein described in claim 11, it is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.
13. 1 kinds of methods for increasing insect target scope, it is characterized in that, comprising: together with the third desinsection Nucleotide of the insect-killing protein that the insect-killing protein of construct coding described in claim 1-8 any one is encoded with construct described at least one is different from claim 1-8 any one in plant, express.
14. according to described in claim 13 for increasing the method for insect target scope, it is characterized in that described the third desinsection Nucleotide can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.
15. according to described in claim 13 for increasing the method for insect target scope, it is characterized in that, described the third desinsection Nucleotide is for suppressing the dsRNA of important gene in targeted insect insect.
16. 1 kinds of methods that produce zoophobous, is characterized in that, comprising: recombinant vectors described in construct described in claim 1-8 any one or claim 9 is imported to plant.
The method of 17. 1 kinds of damages of avoiding being caused by insect pest for the protection of plant; it is characterized in that; comprise: recombinant vectors described in construct described in claim 1-8 any one or claim 9 is imported to plant, make the plant generation after importing enough protect it to avoid the insect-killing protein of insect pest infringement amount.
18. 1 kinds of methods of controlling insect pest, is characterized in that, comprising: the insect repressible protein matter of construct coding described in the claim 1-8 any one of insect pest and amount of suppression is contacted.
The method of 19. control insect pests according to claim 18, it is characterized in that, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the vegetable cell that produces it, and described insect pest contacts with described Cry1Ab/Ac albumen with described Cry2Aa albumen by the described vegetable cell of ingesting.
The method of 20. control insect pests according to claim 19, it is characterized in that, described Cry2Aa albumen and described Cry1Ab/Ac albumen are present in the transgenic plant that produce it, described insect pest contacts with described Cry1Ab/Ac albumen with described Cry2Aa albumen by the tissue of the described transgenic plant that ingest, after contact, the growth of described insect pest is suppressed and/or causes death, to realize the cause harm control of plant of insect pest.
The method of 21. control insect pests according to claim 20, is characterized in that, described transgenic plant can be in any breeding time.
The method of 22. control insect pests according to claim 20, is characterized in that, the tissue of described transgenic plant can be blade, stem stalk, tassel, female fringe, flower pesticide or filigree.
The method of 23. control insect pests according to claim 20, is characterized in that, described to insect pest cause harm plant control because of plantation place change do not change.
The method of 24. control insect pests according to claim 20, is characterized in that, described insect pest is caused harm to the control of plant not because the change of implantation time changes.
25. according to the method for the control insect pest described in claim 19-24 any one, it is characterized in that, described plant can be from corn, paddy rice, Chinese sorghum, wheat, grain, cotton, reed, sugarcane, wild rice stem, broad bean or rape.
26. according to the method for the control insect pest described in claim 19-25 any one, it is characterized in that, the step before described contact procedure is for planting the plant of the polynucleotide that contain the described Cry2Aa albumen of coding and described Cry1Ab/Ac albumen.
27. according to the method for controlling insect pest described in claim 18-26 any one, it is characterized in that, described insect pest is lepidopterous insects insect.
28. according to the method for controlling insect pest described in claim 27, it is characterized in that, described lepidopterous insects insect is pink rice borer and/or striped rice borer.
The purposes of the insect repressible protein Quality Control insect pest processed of construct coding described in 29. 1 kinds of claim 1-8 any one.
CN201310722915.9A 2013-12-24 2013-12-24 Control structure body and the method thereof of insect Active CN103757049B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310722915.9A CN103757049B (en) 2013-12-24 2013-12-24 Control structure body and the method thereof of insect

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310722915.9A CN103757049B (en) 2013-12-24 2013-12-24 Control structure body and the method thereof of insect

Publications (2)

Publication Number Publication Date
CN103757049A true CN103757049A (en) 2014-04-30
CN103757049B CN103757049B (en) 2016-06-08

Family

ID=50524367

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310722915.9A Active CN103757049B (en) 2013-12-24 2013-12-24 Control structure body and the method thereof of insect

Country Status (1)

Country Link
CN (1) CN103757049B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015070783A1 (en) * 2013-11-18 2015-05-21 北京大北农科技集团股份有限公司 Method for controlling pest
WO2016086513A1 (en) * 2014-12-05 2016-06-09 江苏省农业科学院 Human insecticidal gene and insecticidal peptide encoded thereby, and use thereof
CN106749566A (en) * 2016-11-21 2017-05-31 北京大北农科技集团股份有限公司 The method that insecticidal proteins are combined and its manage insect-resistant
CN109804832A (en) * 2019-01-31 2019-05-28 北京大北农生物技术有限公司 The purposes of insecticidal proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102762095A (en) * 2009-12-16 2012-10-31 陶氏益农公司 Insecticidal protein combination comprising cry1ab and cry2aa for controlling european corn borer, and methods for insect resistance management
CN103190316A (en) * 2013-02-25 2013-07-10 北京大北农科技集团股份有限公司 Method for controlling insect pest

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102762095A (en) * 2009-12-16 2012-10-31 陶氏益农公司 Insecticidal protein combination comprising cry1ab and cry2aa for controlling european corn borer, and methods for insect resistance management
CN103190316A (en) * 2013-02-25 2013-07-10 北京大北农科技集团股份有限公司 Method for controlling insect pest

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
XU W ET AL: "Safety assessment of Cry1Ab/Ac fusion protein", 《FOOD AND CHEMICAL TOXICOLOGY》 *
杨宙: "双价Bt抗虫水稻的培育和转基因水稻回交效应分析", 《中国博士学位论文全文数据库 农业科技辑 D047-1》 *
陈中义 等: "双价苏云金芽孢杆菌cry基因载体构建及其在大肠杆菌中表达杀虫活性", 《农业生物技术学报》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015070783A1 (en) * 2013-11-18 2015-05-21 北京大北农科技集团股份有限公司 Method for controlling pest
WO2016086513A1 (en) * 2014-12-05 2016-06-09 江苏省农业科学院 Human insecticidal gene and insecticidal peptide encoded thereby, and use thereof
US9725521B2 (en) 2014-12-05 2017-08-08 Jiangsu Academy Of Agricultural Sciences Human-derived insecticidal gene and insecticidal peptide encoded thereby and application thereof
CN106749566A (en) * 2016-11-21 2017-05-31 北京大北农科技集团股份有限公司 The method that insecticidal proteins are combined and its manage insect-resistant
CN106749566B (en) * 2016-11-21 2020-05-05 北京大北农科技集团股份有限公司 Insecticidal protein combinations and methods of managing insect resistance
CN109804832A (en) * 2019-01-31 2019-05-28 北京大北农生物技术有限公司 The purposes of insecticidal proteins
CN109804832B (en) * 2019-01-31 2021-07-30 北京大北农生物技术有限公司 Use of insecticidal proteins

Also Published As

Publication number Publication date
CN103757049B (en) 2016-06-08

Similar Documents

Publication Publication Date Title
CN103509808B (en) Insecticidal gene and applications thereof
CN103718896B (en) The method of Control pests
CN103688974B (en) Method for controlling injurious insect
CN102972426B (en) Pest control method
CN103718895A (en) Method for controlling injurious insects
CN104824010A (en) Application of insecticidal protein
CN102786584B (en) Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein
CN103757049B (en) Control structure body and the method thereof of insect
CN104286014A (en) Application of insecticidal protein
CN102786585B (en) Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein
CN104886111A (en) Purpose of insecticidal protein
CN103739683B (en) Insecticidal protein, and encoding gene and use thereof
CN103145814B (en) Insecticidal protein, and coding gene and use thereof
CN103734169A (en) Pest control method
CN102796183B (en) Insecticidal protein, and coding gene and purposes thereof
CN103725704B (en) The construct of Control pests and method thereof
CN104920425A (en) Application of insecticidal protein
CN104621171A (en) Use of insecticidal protein
CN104522033A (en) Application of insecticidal protein
CN102796182B (en) Insecticidal protein, as well as coding gene and application thereof
CN105660674A (en) Use of insecticidal protein
CN104798802A (en) Application of insecticidal protein
CN102993281B (en) Insecticidal protein and coding gene and application thereof
CN102993280B (en) Insecticidal protein and coding gene and application thereof
CN104604924A (en) Application of insecticidal protein

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27,

Applicant after: Beijing Dabeinong Technology Group Co., Ltd.

Applicant after: BEIJING DBN BIOTECH CO., LTD.

Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27,

Applicant before: Beijing Dabeinong Technology Group Co., Ltd.

Applicant before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd.

COR Change of bibliographic data
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20200812

Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49

Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District

Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd.

Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd.