CN103739683B - Insecticidal protein, and encoding gene and use thereof - Google Patents

Abstract

The invention relates to an insecticidal protein, and an encoding gene and use thereof. The insecticidal protein comprises (a) protein formed by an amino acid sequence shown in SEQ ID NO:2, or (b) protein which has insecticidal activity and is derived from (a) in a manner of substituting and/or deleting and/or adding one or more amino acids to the amino acid sequence in (a). The insecticidal protein disclosed by the invention is especially applicable to expression in monocotyledons, especially rice, so that not only are the expression quantity and the stability of PIC10-01 insecticidal protein significantly improved, but also the toxicity of the PIC10-01 insecticidal protein on insects and injurious insects, especially lepidoptera insect pests is significantly enhanced.

Description

Insect-killing protein, its encoding gene and purposes

Technical field

The present invention relates to a kind of insect-killing protein, its encoding gene and purposes, particularly relate to a kind of PIC10-01 insect-killing protein of transformation, its encoding gene and purposes.

Background technology

Insect pest of the plant is the principal element causing crop loss, causes great financial loss to peasant, even has influence on the survival state of local population.In order to prevent and treat insect pest of the plant, people use phosphoramidite chemical sterilant and Biocidal preparation usually, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and cause the appearance of resistant insect; And Biocidal preparation is easily degraded in the environment, production needs repetitive administration, considerably increases production cost.

In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists finds the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant.PIC10 insecticidal proteins is the one in numerous insecticidal proteins, is insoluble sexual partner's spore crystalline protein.

PIC10 albumen is taken in by insect and is entered middle intestines, under toxalbumin parent toxin is dissolved in the alkaline pH environment of insect midgut.Parent toxin, by basic protein enzymic digestion, is transformed into active fragments by albumen N-and C-end; Receptors bind on active fragments and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cytolemma to occur perforation focus, destroys osmotic pressure change inside and outside cytolemma and pH balance etc., upsets the digestive process of insect, finally cause it dead.

Paddy rice is Chinese main food crop, every year because the grain loss that insect pest of the plant causes is huge, and such as striped rice borer, yellow rice borer or pink rice borer etc.Do not find the expression level of PIC10 insecticidal proteins in plant and the report of virulence at present.

Summary of the invention

The object of this invention is to provide a kind of insect-killing protein, its encoding gene and purposes, described PIC10-01 insecticidal proteins (being especially paddy rice) in plant has higher expression amount and virulence.

For achieving the above object, the invention provides a kind of insect-killing protein, comprising:

The protein of (a) aminoacid sequence composition as shown in SEQ ID NO:2; Or

B () aminoacid sequence in (a) is through replacing and/or disappearance and/or add one or several amino acid and have the protein derivative by (a) of insecticidal activity.

For achieving the above object, the invention provides a kind of killing gene, comprising:

A () is encoded the nucleotide sequence of described insect-killing protein; Or

B nucleotide sequence hybridization that () limits with (a) under strict conditions and encode there is the nucleotide sequence of the protein of insecticidal activity; Or

C () has the nucleotide sequence shown in SEQ ID NO:1.

Described stringent condition can be at 6 × SSC(Trisodium Citrate), 0.5%SDS(sodium lauryl sulphate) in solution, hybridize at 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

For achieving the above object, present invention also offers a kind of expression cassette, be included in the described killing gene under the regulating and controlling sequence regulation and control effectively connected.

For achieving the above object, present invention also offers a kind of recombinant vectors comprising described killing gene or described expression cassette.

For achieving the above object, present invention also offers a kind of method producing insect-killing protein, comprising:

Obtain the cell comprising the transformed host biology of described killing gene or described expression cassette;

Allowing the cell cultivating described transformed host biology under the condition producing insect-killing protein;

Reclaim described insect-killing protein.

Further, the cell of described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

For achieving the above object, present invention also offers a kind of method for increasing insect target scope, comprising: express together with the second desinsection Nucleotide insect-killing protein of described insect-killing protein or described expression cassette coding being different from plant the insect-killing protein that described insect-killing protein or described expression cassette are encoded with at least one.

Further, described the second desinsection Nucleotide can be encoded Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

Selectively, described the second desinsection Nucleotide is the dsRNA suppressing important gene in target insect pests.

In the present invention, the expression of PIC10-01 insecticidal proteins in a kind of transgenic plant can along with the expression of one or more Cry class insect-killing protein and/or Vip class insect-killing protein.This kind of Pesticidal toxins co expression in same strain transgenic plant that exceedes can make plant comprise by genetic engineering and gene needed for expressing realizes.In addition, a kind of plant (the 1st parent) can express PIC10-01 insect-killing protein by genetic engineering procedure, and the second plant (the 2nd parent) can express Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.The progeny plants of all genes of expressing introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNA interference, RNAi) refer to high conservative during evolution, brought out by double-stranded RNA (double-stranded RNA, dsRNA), the phenomenon of the efficient selective degradation of homologous mRNA.Therefore the expression of RNAi technology specific depletion or closedown specific gene can be used.

For achieving the above object, present invention also offers a kind of method producing zoophobous, comprising: described killing gene or described expression cassette or described recombinant vectors are imported plant.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

For achieving the above object; present invention also offers a kind of for the protection of the method for plant from the damage caused by insect pest; comprise: described killing gene or described expression cassette or described recombinant vectors are imported plant, make the plant after importing produce enough its insect-killing proteins from insect pest amount of protection.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

Described killing gene or described expression cassette or described recombinant vectors are imported plant, be by Exogenous DNA transfered vegetable cell in the present invention, conventional transformation methods includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplastis, electroporation or silicon whisker imports.

For achieving the above object, present invention also offers a kind of method controlling insect pest, comprising: insect pest and the described insect-killing protein of amount of suppression or the insect inhibitory protein of being encoded by described killing gene are contacted.

Preferably, described insect pest is lepidopteran insect pests.

For achieving the above object, the purposes of insect inhibitory protein Quality Control insect pest that present invention also offers a kind of described insect-killing protein or encoded by described killing gene.

The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.

Polynucleotide described in the present invention and/or Nucleotide are formed complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, under polynucleotide of the present invention and/or Nucleotide can being placed in the regulating and controlling sequence control of object host.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand creating DNA in plant.Like this, the present invention includes the use of polynucleotide to example in sequence table and complementary strand thereof." coding strand " that this area often uses refers to the chain be combined with antisense strand.In order to marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template.MRNA is actually and transcribes from " antisense " chain of DNA." have justice " or " coding " chain has a series of codon (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention also comprises RNA and the PNA(peptide nucleic acid(PNA) having suitable function with the DNA of example).

Nucleic acid molecule of the present invention or its fragment are hybridized with killing gene of the present invention under strict conditions.The nucleic acid hybridization of any routine or amplification method may be used to the existence identifying killing gene of the present invention.Nucleic acid molecule or its fragment can carry out specific hybrid with other nucleic acid molecule in any case.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementary completely, then one of them nucleic acid molecule is claimed to be another nucleic acid molecule " complement ".In the present invention, when corresponding nucleotide complementary with another nucleic acid molecule of each Nucleotide of a nucleic acid molecule, then these two nucleic acid molecule are claimed to demonstrate " complete complementary ".If two nucleic acid molecule can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if two nucleic acid molecule can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecule are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecule as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salt concn.

In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salt concn in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salt concn can all change, and also can one of them to remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C, with SEQ ID NO:1, specific hybrid occurs, and then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and the sequence of hybridizing with sequence 1 of the present invention under strict conditions comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homology.Namely the scope of sequence iden is distributed at least approximately 40%-50%, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger.

Gene described in the present invention and protein not only comprise specific exemplary sequence, the part also comprising the insecticidal activity feature of the protein saving described particular example with/fragment (comprising compared with full length protein and/or terminal deletion), variant, mutant, substituent (having alternative amino acid whose protein), mosaic and fusion rotein.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity.Described " equivalent protein " refers to the bioactive albumen with the albumen of claim with identical or substantially identical anti-lepidopteran insect pests.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refers to a part or its artificial reconstructed form (being such as applicable to the sequence of expression of plants) of original DNA or the protein sequence (Nucleotide or amino acid) related to, comprise and close on fragment and the disappearance of inside and/or end compared with full-length molecule, can there is change in the length of foregoing sequences, but length is enough to guarantee that (coding) protein is insect toxins.In some cases (expression particularly in plant), the truncated gene using coding truncated protein matter may be favourable.40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98 or 99% of the general encode full-length proteins of preferred truncated gene.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence dna can be encoded identical aminoacid sequence.Produce the alternative DNA sequence dna of the identical or substantially identical albumen of these codings just in the state of the art of those skilled in the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment retaining insecticidal activity.

The replacement of aminoacid sequence in the present invention, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and namely folding the and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, usually about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and such as aminoterminal extends a methionine residues; Little connection peptides, such as an about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually those aminoacid replacement not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic press (Academic Press) " Protein " that publish in 1979.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region played an important role to molecular function, and still produces active polypeptide.For by polypeptide of the present invention, it is active required and therefore select amino-acid residue of not being substituted, can according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis carry out identifying (as see, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, thus determines the amino-acid residue wanted of overstating to this molecular activity.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (see, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

Therefore, the aminoacid sequence having certain homology with the aminoacid sequence shown in sequence 2 is also included within the present invention.These sequences and sequence similarities/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can according to homogeny particularly and/or similarity scope definition preferred polynucleotide of the present invention and protein.Homogeny and/or the similarity of 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is such as had with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, leader sequence, intron and other be operably connected to the adjustment sequence of described killing gene.

Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected encoding sequence carries out the promotor expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the proteolytic enzyme suppressor gene (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus leaders, as MDMV(Maize Dwarf Mosaic Virus) leader sequence; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.

Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.

For monocotyledons application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledons application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequence encoding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and encoding sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiator codon of encoding sequence.Alternatively, if the connection of promotor and encoding sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and mode of connection make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing genetic expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), the sequence of marker function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. replication orgin of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is insect, such as, but not limited to, most of lepidoptera pest, as Pyrausta nubilalis (Hubern)., yellow rice borer, east armyworm, striped rice borer or pink rice borer etc.

In the present invention, described insect-killing protein is PIC10-01 aminoacid sequence, as shown in SEQ IDNO:2 in sequence table.Described killing gene is PIC10-01 nucleotide sequence, as shown in SEQ ID NO:1 in sequence table.Described killing gene is for plant, the particularly DNA sequence dna of rice conversion, except comprising by except the coding region of the nucleotide sequence coded protein of PIC10-01, also other elements can be comprised, the coding region of the protein of the coding region of such as encoding transit peptides, the protein of encoding selection markers or conferring herbicide resistance.

In the present invention, PIC10-01 insecticidal proteins most of lepidoptera pest of verifying has toxicity.Plant in the present invention, particularly paddy rice, containing foreign DNA in its genome, described foreign DNA comprises PIC10-01 nucleotide sequence, protects it from the threat of insect by this albumen of expression inhibiting amount.Amount of suppression refers to lethal or semilethal dosage.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.In addition, this plant can basically eliminate to the needs of chemistry or biotic pesticide (described chemistry or biotic pesticide are the sterilant for the insect by the nucleotide sequence coded protein institute target of PIC10-01).

In vegetable material, the expression level of insecticidal crystal protein (ICP) detects by multiple method described in this area, such as undertaken quantitatively by applying the mRNA of special primer to the coded insect-killing protein produced in tissue, or the amount of the insect-killing protein of directly specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied.In the present invention, targeted insect is mainly lepidoptera pest, is more specifically pink rice borer or striped rice borer etc.

In addition, the expression cassette comprising insect-killing protein of the present invention (PIC10-01 aminoacid sequence) can also be expressed in plant together with the protein of at least one encoding herbicide resistance gene, described herbicide resistance gene includes but not limited to, glufosinates resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), Glyphosate resistance gene (as EPSPS gene), bromoxynil (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of weedicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (as PPT), thus acquisition had both had high insecticidal activity, there are again the transgenic plant of Herbicid resistant.

The invention provides a kind of insect-killing protein, its encoding gene and purposes, have the following advantages:

1, virulence is strong.The insecticidal toxicity of insect-killing protein PIC10-01 of the present invention is strong, especially for the lepidoptera pest of hazard rice.

2, expression amount is high.Killing gene PIC10-01 of the present invention is the optimization that the preferred codons of foundation paddy rice carries out insect-killing protein PIC10-01, eliminate simultaneously and make the sequence of mRNA instability, PolyA tailing signal and intron shear similar site, and improve GC content, meet the characteristic of paddy gene completely, killing gene of the present invention is made to be particularly suitable for expressing in monocotyledons, especially paddy rice, the high and good stability of its expression amount.

3, insecticidal spectrum is wide.Insect-killing protein PIC10-01 albumen of the present invention not only shows higher resistance to striped rice borer, and also has higher activity to pink rice borer, therefore has a extensive future on plant.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T containing PIC10-01 nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes builds schema;

Fig. 2 is that the recombinant expression vector DBN100323 containing PIC10-01 nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes builds schema;

Fig. 3 is the insect resistant effect figure of the transgenic rice plant inoculation striped rice borer of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 4 is the insect resistant effect figure of the transgenic rice plant inoculation pink rice borer of insect-killing protein of the present invention, its encoding gene and purposes.

Embodiment

The technical scheme of insect-killing protein of the present invention, its encoding gene and purposes is further illustrated below by specific embodiment.

The acquisition of the first embodiment, PIC10-01 gene order and synthesis

The aminoacid sequence (630 amino acid) of PIC10-01 insect-killing protein, as shown in SEQ IDNO:2 in sequence table; The nucleotide sequence (1896 Nucleotide) of coding corresponding to the aminoacid sequence (630 amino acid) of described PIC10-01 insect-killing protein is obtained, as shown in SEQ ID NO:1 according to paddy rice Preference codon.Described PIC10-01 nucleotide sequence (as shown in SEQ ID NO:1 in sequence table) is synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described PIC10-01 nucleotide sequence (SEQ IDNO:1) of synthesis is also connected with SpeI restriction enzyme site, and 3 ' end of described PIC10-01 nucleotide sequence (SEQ ID NO:1) is also connected with PvuI restriction enzyme site.

The structure of the second embodiment, recombinant expression vector and recombinant expression vector transformation Agrobacterium

1, the recombinant cloning vector DBN01-T containing PIC10-01 nucleotide sequence is built

The PIC10-01 nucleotide sequence of synthesis is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by Promega Products pGEM-T carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; PIC10-01 is PIC10-01 nucleotide sequence (SEQ ID NO:1); MCS is multiple clone site).

Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; Ice bath cell 1-2 minute; 37 DEG C at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, penbritin 100mg/L, pH to 7.5 is adjusted with NaOH) middle shaking culture 1 hour (under 100rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-β-D-galactoside on surface) and the chloro-3-indoles of the bromo-4-of X-gal(5--β-D-galactoside) LB solid plate (the Tryptones 10g/L of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, the precipitation thalline solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2MNaOH, 1%SDS(sodium lauryl sulphate) that 200 μ l newly prepare), pipe is put upside down 5 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (3M Potassium ethanoate, 5M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, gets appropriate supernatant, adds 2 times of volume dehydrated alcohols in supernatant liquor, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant liquor, and precipitation concentration (V/V) is dry after the washing with alcohol of 70%; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, pH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after EcoRV and SmaI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described PIC10-01 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:1 in sequence table, and namely PIC10-01 nucleotide sequence correctly inserts.

2, the recombinant expression vector DBN100323 containing PIC10-01 nucleotide sequence is built

With restriction enzyme SpeI and PvuI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), between SpeI and the PvuI site PIC10-01 nucleotide sequence fragment cut being inserted into expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN100323, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:3); PIC10-01:PIC10-01 nucleotide sequence (SEQ ID NO:1); Nos: the terminator (SEQ ID NO:4) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:5); LB: left margin).

By recombinant expression vector DBN100323 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100323), 42 DEG C of water-baths 30 seconds; Ice bath cell 1-2 minute; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake) in LB liquid nutrient medium; Then cultivating 12 hours under temperature 37 DEG C of conditions containing on the LB solid plate of 50mg/L kantlex (Kanamycin), picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme EcoRV of extraction and SmaI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector DBN100323 between SpeI and PvuI site is classified as nucleotide sequence, i.e. PIC10-01 nucleotide sequence shown in SEQ ID NO:1 in sequence table.

3, the recombinant expression vector DBN100323N containing known array is built

Contain the method for the recombinant cloning vector DBN01-T of PIC10-01 nucleotide sequence according to the structure in second embodiment of the invention described in 1, utilize known array (SEQ ID NO:6) to build the recombinant cloning vector DBN01R-T containing known array.Carry out sequence verification to positive colony, result shows that the known array inserted in recombinant cloning vector DBN01R-T is the nucleotide sequence shown in SEQ ID NO:6 in sequence table, and namely known array correctly inserts.

Contain the method for the recombinant expression vector DBN100323 of PIC10-01 nucleotide sequence according to the structure in second embodiment of the invention described in 2, utilize known array to build the recombinant expression vector DBN100323N containing known array.Carry out sequence verification to positive colony, result shows that the known array inserted in recombinant expression vector DBN100323N is the nucleotide sequence shown in SEQ ID NO:6 in sequence table, and namely known array correctly inserts.

4, recombinant expression vector transformation Agrobacterium

To oneself through building correct recombinant expression vector DBN100323 and DBN100323N(known array) be transformed into Agrobacterium LBA4404 (Invitrgen by liquid nitrogen method, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in temperature 28 DEG C, rotating speed is cultivate 2 hours under 200rpm condition, be applied on the LB solid plate containing the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, with restriction enzyme A hdI and EcoRV to recombinant expression vector DBN100323 and DBN100323N(known array) enzyme carries out digestion verification after cutting, result shows recombinant expression vector DBN100323 and DBN100323N(known array) structure is entirely true.

3rd embodiment, the acquisition proceeding to the rice plant of PIC10-01 nucleotide sequence and checking

1, the rice plant proceeding to PIC10-01 nucleotide sequence is obtained

The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the japonica rice variety of the sterile culture fine callus of Japan and the second embodiment described in 4, with by the 2 and 3 recombinant expression vector DBN100323 built and DBN100323N(known arrays in the second embodiment) in T-DNA(comprise the promoter sequence of corn Ubiquitin gene, PIC10-01 nucleotide sequence, known array, PMI gene and Nos terminator sequence) be transferred in rice chromosome group, obtain the rice plant proceeding to PIC10-01 nucleotide sequence and the rice plant proceeding to known array, in contrast with wild rice plant simultaneously.

For agriculture bacillus mediated rice conversion, briefly, rice paddy seed is seeded in inducing culture (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2, 4-dichlorphenoxyacetic acid (2, 4-D) 2mg/L, plant gel 3g/L, pH5.8) on, callus (step 1: callus of induce step) is induced from Mature Embryos of Rice, afterwards, preferred callus, callus is contacted with agrobacterium suspension, wherein PIC10-01 nucleotide sequence and/or known array can be passed at least one cell (step 2: infect step) on callus by Agrobacterium.In this step, callus preferably immerses agrobacterium suspension (OD660=0.3, infect substratum (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) in start infect.Callus and Agrobacterium Dual culture one period (3 days) (step 3: Dual culture step).Preferably, callus after infecting step at solid medium (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, glucose 10g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation.After this Dual culture stage, there is " recovery " step.In " recovery " step, recovery media (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 4: recovering step) of vegetable transformant.Preferably, callus is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the callus of inoculation cultivates the transformed calli (step 5: select step) that also growth selection on the substratum containing selective agent (seminose).Preferably, callus is having the screening solid medium of selective agent (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 10g/L, seminose 10g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 6: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (N6 division culture medium and MS root media) containing the callus that the substratum of selective agent grows.

Screen the resistant calli obtained and transfer to described N6 division culture medium (N6 salt, N6 vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant gel 3g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling is out transferred on described MS root media (MS salt, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8), is cultured to about 10cm high at 25 DEG C, moves to hot-house culture to solid.In greenhouse, every day cultivates at 30 DEG C.

2, the rice plant of PIC10-01 nucleotide sequence is proceeded to TaqMan checking

The blade getting the rice plant proceeding to PIC10-01 nucleotide sequence and the rice plant proceeding to known array is respectively about 100mg as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of PIC10 gene by Taqman fluorescence probe quantitative PCR method.In contrast with wild rice plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

The concrete grammar detecting PIC10 gene copy number is as follows:

Step 11, get each 100mg of blade of the rice plant proceeding to PIC10-01 nucleotide sequence, the rice plant proceeding to known array and wild rice plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;

Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild rice plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting PIC10-01 nucleotide sequence:

Primer 1(CF1): CAGGACTGGATCACCTATAATCGG is as shown in SEQ ID NO:7 in sequence table;

Primer 2 (CR1): AAAGAACGCGGCAATGTCC is as shown in SEQ ID NO:8 in sequence table;

Probe 1(CP1): CAGGCGCGATCTTACTTTGACGGTCC is as shown in SEQ ID NO:9 in sequence table;

Following primer and probe are used for detecting known array:

Primer 3(CF2): CAAGGAATGGGAAGAAGATCCTAAC is as shown in SEQ ID NO:10 in sequence table;

Primer 4(CR2): TTCAAGAAGTCCATCAAGGATACG is as shown in SEQ ID NO:11 in sequence table;

Probe 2(CP2): CCAGCAACCAGGACCAGAGTGATCGATAG is as shown in SEQ ID NO:12 in sequence table;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, all oneself is incorporated in the genome of detected rice plant for PIC10-01 nucleotide sequence and known array, and the rice plant proceeding to PIC10-01 nucleotide sequence all obtains containing single transgenic rice plant copying PIC10 gene with the rice plant proceeding to known array.

2, the insect resistant effect of transgenic rice plant detects

By proceeding to the rice plant of PIC10-01 nucleotide sequence, the rice plant proceeding to known array, wild rice plant and being accredited as not genetically modified rice plant through Taqman, insect resistant effect detection is carried out to pink rice borer and striped rice borer.

(1) striped rice borer: get the rice plant proceeding to PIC10-01 nucleotide sequence respectively, proceed to the rice plant of known array, wild rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed vein, be cut into the strip of about 1cm × 4cm simultaneously, get 1 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, the striped rice borer (newly hatched larvae) of 10 artificial breedings is put in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to Chilo spp larvae development progress, mortality ratio and blade injury rate three indexs, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio 90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of PIC10-01 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of known array, be accredited as not genetically modified (NGM) totally 1 strain through Taqman, (CK) totally 1 strain of wild-type; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic rice plant inoculation striped rice borer

The result of table 2 shows: can choose plant striped rice borer to certain resistance in the rice plant proceeding to PIC10-01 nucleotide sequence and the rice plant proceeding to known array, but the raw total score of surveying proceeding to the rice plant of PIC10-01 nucleotide sequence is significantly higher than the rice plant proceeding to known array.Proceed to the raw total score of surveying of rice plant of PIC10-01 nucleotide sequence at about 240 points, and the life proceeding to the rice plant of known array surveys total score at about 200 points.The result of Fig. 3 shows: compared with the rice plant proceeding to known array, the rice plant proceeding to PIC10-01 nucleotide sequence can cause the mortality of newly hatched larvae, and great suppression is caused to larvae development progress, after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, and its blade injury rate is also less, about 10%.

(2) pink rice borer: get the rice plant proceeding to PIC10-01 nucleotide sequence respectively, proceed to the rice plant of known array, wild rice plant and be accredited as the fresh blade of not genetically modified rice plant (tillering phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then rice leaf is removed vein, be cut into the strip of about 1cm × 4cm simultaneously, get 1 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, the pink rice borer (newly hatched larvae) of 10 artificial breedings is put in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to pink rice borer larvae development progress, mortality ratio and blade injury rate three indexs, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio 90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of PIC10-01 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of known array, be accredited as not genetically modified (NGM) totally 1 strain through Taqman, (CK) totally 1 strain of wild-type; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 2 and Fig. 4.

The pest-resistant experimental result of table 2, transgenic rice plant inoculation pink rice borer

The result of table 2 shows: can choose and have certain inhibiting plant to pink rice borer in the rice plant proceeding to PIC10-01 nucleotide sequence and the rice plant proceeding to known array, but the raw total score of surveying proceeding to the rice plant of PIC10-01 nucleotide sequence is significantly higher than the rice plant proceeding to known array.Proceed to the raw total score of surveying of the rice plant of PIC10-01 nucleotide sequence at about 230 points, and the life proceeding to the rice plant of known array surveys total score at about 160 points.The result of Fig. 4 shows: compared with the rice plant proceeding to known array, the rice plant proceeding to PIC10-01 nucleotide sequence can cause the mortality of newly hatched larvae, and great suppression is caused to larvae development progress, after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, and its blade injury rate is also controlled in less than 15%.

Prove that the rice plant proceeding to PIC10-01 nucleotide sequence has higher insect resistance capacity thus, the rice plant proceeding to PIC10-01 nucleotide sequence of namely expressing PIC10-01 protein level high also has higher virulence, therefore significantly increases according to the PIC10-01 nucleotide sequence of the preferred codons optimization of paddy rice the virulence that PIC10-01 albumen expresses in paddy rice.

In sum, PIC10-01 killing gene of the present invention adopts the preferred codons of paddy rice, killing gene of the present invention is made to be particularly suitable for expressing in monocotyledons, especially paddy rice, PIC10-01 insect-killing protein of the present invention is the high and good stability of expression amount not only, strong to the virulence of insect pest, especially lepidopteran insect pests.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims (16)

1. an insect-killing protein, is characterized in that, the protein of the aminoacid sequence composition as shown in SEQ ID NO:2.

2. a killing gene, is characterized in that, is selected from:

The nucleotide sequence of insect-killing protein described in (a) coding claim 1; Or

B nucleotide sequence hybridization that () limits with (a) under strict conditions and the nucleotide sequence of the protein of the aminoacid sequence as shown in SEQ ID NO:2 of encoding; Or

(c) nucleotide sequence as shown in SEQ ID NO:1.

3. an expression cassette, is characterized in that, is included in killing gene described in the claim 2 under the regulating and controlling sequence regulation and control effectively connected.

4. one kind comprises the recombinant vectors of expression cassette described in killing gene described in claim 2 or claim 3.

5. produce a method for insect-killing protein, it is characterized in that, comprising:

Obtain the cell comprising the transformed host biology of expression cassette described in killing gene described in claim 2 or claim 3;

Allowing the cell cultivating described transformed host biology under the condition producing insect-killing protein;

Reclaim described insect-killing protein.

6. produce the method for insect-killing protein according to claim 5, it is characterized in that, the cell of described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus or algae.

7. produce the method for insect-killing protein according to claim 6, it is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.

8. the method for increasing insect target scope, it is characterized in that, comprising: express together with the second desinsection nucleotide sequence expression cassette described in killing gene described in claim 2 or claim 3 being different from plant expression cassette described in killing gene described in claim 2 or claim 3 with at least one.

9. according to claim 8 for increasing the method for insect target scope, it is characterized in that, described the second desinsection nucleotide sequence coded Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

10. according to claim 8 for increasing the method for insect target scope, it is characterized in that, described the second desinsection nucleotides sequence is classified as the dsRNA suppressing important gene in target insect pests.

11. 1 kinds of methods producing zoophobous, is characterized in that, comprising: recombinant vectors described in expression cassette described in killing gene described in claim 2 or claim 3 or claim 4 is imported plant.

12., according to the method producing zoophobous described in claim 11, is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.

13. 1 kinds for the protection of the method for plant from the damage caused by lepidopteran insect pests; it is characterized in that; comprise: recombinant vectors described in expression cassette described in killing gene described in claim 2 or claim 3 or claim 4 is imported plant, the plant after importing is produced and enough protects its insect-killing protein from lepidopteran insect pests infringement amount.

14. according to described in claim 13 for the protection of the method for plant from the damage caused by lepidopteran insect pests, it is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.

15. 1 kinds of methods controlling lepidopteran insect pests, is characterized in that, comprising: insect-killing protein described in the claim 1 of lepidopteran insect pests and amount of suppression or the insect inhibitory protein matter of being encoded by killing gene described in claim 2 are contacted.

Insect-killing protein described in 16. 1 kinds of claims 1 or the purposes by the insect inhibitory protein Quality Control lepidopteran insect pests of killing gene coding described in claim 2.