CN102993281B - Insecticidal protein and coding gene and application thereof - Google Patents

Abstract

The invention relates to an insecticidal protein and a coding gene and an application thereof. The insecticidal protein contains a protein (a) formed by an amino acid sequence from 1st to 650th sites shown as SEQ ID NO:2, or a protein (b) formed by the amino acid sequence shown as the SEQ ID NO:2, or a protein (c) with insecticidal activity, which is derived from the protein (a) or (b), and is formed by replacing and/or deleting and/or adding one or more amino acid in the amino acid sequence of the protein (a) or (b), or a protein (d) formed by an amino acid sequence with at least 90% of sequence identity with the amino acid sequence of the protein (a) or (b). The insecticidal protein has the advantages of high expression quantity, good stability, and high toxicity to insect pests.

Description

Insect-killing protein, its encoding gene and purposes

Technical field

The present invention relates to a kind of insect-killing protein, its encoding gene and purposes, particularly relate to a kind of PIC6-01t insect-killing protein, its encoding gene and purposes of transformation.

Background technology

Insect pest of the plant is the principal element that causes crop loss, causes great financial loss to peasant, even has influence on the survival state of local population.In order to prevent and treat insect pest of the plant, people use phosphoramidite chemical sterilant and Biocidal preparation conventionally, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and cause the appearance of resistance insect; And the easily degraded in environment of Biocidal preparation needs repetitive administration on producing, greatly increase production cost.

In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants with control insect pest of the plant.PIC6 insecticidal proteins is the one in numerous insecticidal proteins, is the companion cell crystalline protein being produced by bacillus thuringiensis.

PIC6 albumen is taken in and is entered middle intestines by insect, and toxalbumin parent toxin is dissolved under the alkaline PH environment of insect midgut.Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragments by parent toxin; Receptors bind on active fragments and insect midgut epithelial cell membrane upper surface, insertion goldbeater's skin, causes cytolemma to occur perforation focus, destroys cytolemma inside and outside osmotic pressure variation and PH balance etc., upsets the digestive process of insect, finally causes its death.

The annual grain loss causing because of insect pest of the plant is huge, such as small cabbage moth, Pyrausta nubilalis (Hubern)., bollworm, east armyworm or striped rice borer etc.Do not find at present the expression level of PIC6 insecticidal proteins in plant and the report of virulence.

Summary of the invention

The object of this invention is to provide a kind of insect-killing protein, its encoding gene and purposes, described PIC6-01t insecticidal proteins (being especially corn) in plant has higher expression amount and virulence.

For achieving the above object, the invention provides a kind of insect-killing protein, comprising:

(a) protein of the composition of the 1-650 amino acids sequence as shown in SEQ ID NO:2; Or

(b) protein of the composition of the aminoacid sequence as shown in SEQ ID NO:2; Or

(c) aminoacid sequence at (a) or (b) through replacement and/or disappearance and/or add one or several amino acid and have insecticidal activity by (a) or (b) derivative protein; Or

(d) aminoacid sequence and (a) or (b) has the protein of the aminoacid sequence composition of at least 90% sequence identity.

Further, described insect-killing protein be with the 1-650 position of SEQ ID NO:2 have at least 95% sequence identity aminoacid sequence composition protein or there is the protein of the aminoacid sequence composition of at least 95% sequence identity with SEQ ID NO:2.

Further, described insect-killing protein be with the 1-650 position of SEQ ID NO:2 have at least 99% sequence identity aminoacid sequence composition protein or there is the protein of the aminoacid sequence composition of at least 99% sequence identity with SEQ ID NO:2.

For achieving the above object, the invention provides a kind of killing gene, comprising:

(a) nucleotide sequence of insect-killing protein described in coding claim 1-3 any one; Or

(b) under stringent condition, there is the nucleotide sequence of the protein of insecticidal activity with the nucleotide sequence hybridization (a) limiting and coding; Or

(c) there is the nucleotide sequence shown in the 1-1950 position of SEQ ID NO:1; Or

(d) there is the nucleotide sequence shown in SEQ ID NO:1.

Described stringent condition can be the Trisodium Citrate at 6 × SSC(), 0.5%SDS(sodium lauryl sulphate) in solution, at 65 ℃, hybridization, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

For achieving the above object, the present invention also provides a kind of expression cassette, is included in the described killing gene under the regulating and controlling sequence regulation and control of effective connection.

For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described killing gene or described expression cassette.

For achieving the above object, the present invention also provides a kind of transformed host biology that comprises described killing gene or described expression cassette, comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

Further, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

For achieving the above object, the present invention also provides a kind of method that produces insect-killing protein, comprising:

Obtain the cell of described transformed host biology;

Under the condition that allows to produce insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

For achieving the above object, the present invention also provides a kind of method for increasing insect target scope, comprising: the insect-killing protein of described insect-killing protein or described expression cassette coding is expressed in plant together with at least one the second desinsection Nucleotide of insect-killing protein that is different from described insect-killing protein or described expression cassette coding.

Further, can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase of described the second desinsection Nucleotide.

Selectively, described the second desinsection Nucleotide is the dsRNA that suppresses important gene in targeted insect insect.

In the present invention, the expression of PIC6-01t insecticidal proteins in a kind of transgenic plant can be accompanied by the expression of one or more Cry class insect-killing proteins and/or Vip class insect-killing protein.This kind of Pesticidal toxins co expression in same strain transgenic plant that exceedes can comprise plant and be expressed required gene and realize by genetic engineering.In addition, a kind of plant (the 1st parent) can be expressed PIC6-01t insect-killing protein by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.Hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent by the 1st parent and the 2nd parent.

RNA disturbs (RNA interference, RNAi) to refer to the phenomenon of the efficient specificity degraded of high conservative, that brought out by double-stranded RNA (double-stranded RNA, dsRNA), homologous mRNA during evolution.Therefore can use RNAi technology specific depletion or close the expression of specific gene.

For achieving the above object, the present invention also provides a kind of method that produces zoophobous, comprising: by described killing gene or described expression cassette or described recombinant vectors importing plant.

Preferably, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

For achieving the above object; the present invention also provides a kind of method of the damage of avoiding being caused by insect pest for the protection of plant; comprise: described killing gene or described expression cassette or described recombinant vectors are imported to plant, plant after importing is produced and enough protect it to avoid the insect-killing protein of insect pest infringement amount.

Preferably, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

Described killing gene or described expression cassette or described recombinant vectors are imported to plant, in the present invention for foreign DNA is imported to vegetable cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.

For achieving the above object, the present invention also provides a kind of method of controlling insect pest, comprising: make insect pest and the described insect-killing protein of amount of suppression or the insect repressible protein of being encoded by described killing gene contacts.

Preferably, described insect pest is lepidopterous insects insect.

For achieving the above object, the present invention also provides a kind of nucleotide sequence coded heterozygosis insect-killing protein by comprising described killing gene.

Preferably, described heterozygosis insect-killing protein is nucleotide sequence coded by as shown in SEQ ID NO:3.

The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.

Polynucleotide described in the present invention and/or Nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, polynucleotide of the present invention and/or Nucleotide can be placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes polynucleotide to example in sequence table and the use of complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, typical case is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." have justice " or " coding " chain has a series of codons (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention also comprises the RNA and the PNA(peptide nucleic acid(PNA) that there are suitable function with the DNA of example).

Amplifying nucleic acid molecule of the present invention or its fragment are hybridized with killing gene of the present invention under stringent condition.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of killing gene of the present invention.Nucleic acid molecule or its fragment can be carried out specific hybrid with other nucleic acid molecule under a stable condition.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementarity completely, claim that one of them nucleic acid molecule is another nucleic acid molecule " complement ".In the present invention, in the time of each Nucleotide of a nucleic acid molecule and the corresponding Nucleotide complementation of another nucleic acid molecule, claim these two nucleic acid molecule to demonstrate " complete complementary ".If thereby two nucleic acid molecule can make them anneal and be bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, claim these two nucleic acid molecule for " minimum level complementation ".Similarly, if thereby two nucleic acid molecule can make them under " highly strict " condition of routine, anneal and be bonded to each other with enough stability phase mutual crosses, and claim these two nucleic acid molecule to there is " complementarity ".From complete complementary, depart from and can allow, depart from two molecules of incomplete prevention as long as this and form duplex structure.In order to make a nucleic acid molecule can serve as primer or probe, only need to guarantee that it has sufficient complementarity in sequence, to make to form stable duplex structure under the specific solvent being adopted and salt concn.

In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under height stringent condition can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matching.Promote the applicable stringent condition of DNA hybridization, for example, process greatly under 45 ℃ of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then under 50 ℃ of conditions, wash with 2.0 × SSC, these conditions are known to those skilled in the art.For example, the salt concn in washing step can be selected from the approximately 2.0 × SSC, 50 ℃ of low stringent condition to the approximately 0.2 × SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can be from approximately 22 ℃ of the room temperatures of low stringent condition, are elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salt concn can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, at 65 ℃, with SEQ ID NO:1, specific hybrid occurs, and then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and the sequence of hybridizing with sequence 1 of the present invention comprises in the present invention under stringent condition.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also including part and/fragment (comprising compared with full length protein and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), mosaic and the fusion rotein of insecticidal activity feature of protein of having preserved described specific example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the albumen of equal value of insecticidal activity.Described " albumen of equal value " refers to the bioactive albumen with the albumen of claim with identical or essentially identical anti-lepidopterous insects insect.

" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (being for example applicable to the sequence of expression of plants) of the original DNA that relates to or protein sequence (Nucleotide or amino acid), comprise the disappearance of closing on fragment and inside compared with full-length molecule and/or end, can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.(the particularly expression in plant) in some cases, it may be favourable using the truncated gene of coding truncated protein matter.Preferred truncated gene 40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98 or 99% of the full length protein of generally encoding.

Due to the Feng Yuxing of genetic codon, the multiple different DNA sequence dna identical aminoacid sequence of can encoding.Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's state of the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment that retains insecticidal activity.

In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, i.e. and the folding and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and for example aminoterminal extends a methionine residues; Little connection peptides, for example an about 20-25 residue is long.

The conservative example replacing is the replacement occurring in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Conventionally those aminoacid replacement that do not change given activity are well-known in this area, and by, for example, N. Neurath and R. L. Hill are described in " Protein " of new york academic press (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region that molecular function is played an important role, and still produces active polypeptide.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino-acid residue, can be according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science 244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thereby determines this molecular activity and the amino-acid residue of wanting of overstating.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science 255:306-312; Smith etc., 1992, J. Mol. Biol 224:899-904; Wlodaver etc., 1992, FEBS Letters 309:59-64).

Therefore the aminoacid sequence that, has certain homology with the aminoacid sequence shown in sequence 2 is also included within the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotide of the present invention and protein.For example there are 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, and leader sequence, intron and other are operably connected to the adjusting sequence of described killing gene.

Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected encoding sequence is expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, ubi promotor, the promotor of paddy rice GOS2 gene etc. of cauliflower mosaic virus.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization of plant (can be tested and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer in the time that plant is stood machinery or gnaws by insect the wound causing, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the proteolytic enzyme suppressor gene (pin I and pin II) of potato and tomato and the promotor of zein enzyme suppressor gene (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus group leader sequence, as the MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.

Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.

For monocotyledons application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledons application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence working in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene polyadenylation signal sequence, derive from proteinase inhibitor II (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.Described " effectively connecting " can be that promotor is connected with interested sequence in the present invention, makes transcribing of this interested sequence be subject to this promotor control and regulation and control.When interested sequence encoding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is transcript fusion and the expression of albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiator codon of encoding sequence.Alternatively, if when promotor is translation fusion and the expression of albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and mode of connection make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of genetic expression function is provided, for example promotor, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, the interior sequence of assisting series of operations of external or body (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is insect, such as, but not limited to, most of lepidoptera pest, as Pyrausta nubilalis (Hubern)., striped rice borer, bollworm, small cabbage moth or east armyworm etc.

" hybrid protein " described in the present invention is made Pesticidal toxins, it comprises and the amino acid region or the fragment that derive from a kind of toxin that different toxin amino acid regions or fragment connect, include but not limited to, connect the PIC6 C-stub area that derives from SEQ ID NO:2 and the N-stub area that derives from the 661st to 699 of SEQ ID NO:5, produced the hybrid protein with aminoacid sequence described in SEQ ID NO:4.

In the present invention, described insect-killing protein is PIC6-01t aminoacid sequence, as shown in SEQ ID NO:2 in sequence table.Described killing gene is PIC6-01t nucleotide sequence, as shown in SEQ ID NO:1 in sequence table.Described killing gene is for plant, the DNA sequence dna that particularly corn transforms, except the coding region that comprises the protein nucleotide sequence coded by PIC6-01t, also can comprise other elements, the coding region of coding region, the protein of codes selection mark or the protein of conferring herbicide resistance of the transit peptides of for example encoding.

In the present invention, PIC6-01t insecticidal proteins most of lepidoptera pests of verifying have toxicity.Plant in the present invention, particularly corn contain foreign DNA in its genome, and described foreign DNA comprises PIC6-01t nucleotide sequence, protect it to avoid the threat of insect by this albumen of expression inhibiting amount.Amount of suppression refers to lethal or semilethal dosage.Meanwhile, plant should be normal in form, and can under ordinary method, cultivate consumption and/or the generation for product.In addition, this plant can the needs (described chemistry or biotic pesticide be the sterilant of insect for by PIC6-01t nucleotide sequence coded protein institute target) of basically eliminate to chemistry or biotic pesticide.

The expression level of insecticidal crystal protein in vegetable material (ICP) can detect by described several different methods in this area, for example by application special primer, the mRNA of the coded insect-killing protein of organizing interior generation is carried out quantitatively, or the amount of the insect-killing protein that directly specific detection produces.

Can apply the insecticidal effect of ICP in different test determination plants.In the present invention, targeted insect is mainly lepidoptera pest, is more specifically Ostrinia furnacalis, east armyworm or striped rice borer etc.

In addition, the expression cassette that comprises insect-killing protein of the present invention (PIC6-01t aminoacid sequence) can also be expressed in plant together with the protein of at least one herbicide resistance gene of encoding, described herbicide resistance gene includes but not limited to, glufosinates resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), glyphosate resistance gene (as EPSPS gene), bromoxynil (bromoxynil) resistant gene, sulfonylurea resistant gene, to the resistant gene of weedicide dalapon, the resistant gene of the resistant gene to cyanamide or glutamine synthetase inhibitor (as PPT), both there is high insecticidal activity thereby obtain, there are again the transgenic plant of Herbicid resistant.

The invention provides a kind of insect-killing protein, its encoding gene and purposes, have the following advantages:

1, virulence is strong.The insecticidal toxicity of insect-killing protein PIC6-01t of the present invention is strong, especially for the lepidoptera pest that endangers corn.

2, expression amount is high.Killing gene PIC6-01t of the present invention adopts the preference codon of corn, meets the characteristic of corn gene completely, makes killing gene of the present invention be particularly suitable for expressing in monocotyledons, especially corn, the high and good stability of its expression amount.

3, insecticidal spectrum is wide.Insect-killing protein PIC6-01t albumen of the present invention not only shows higher resistance to Ostrinia furnacalis, and reported first insect-killing protein PIC6-01t albumen of the present invention east armyworm and striped rice borer are also had to higher activity, therefore on plant, have a extensive future.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T that contains PIC6-01t nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes builds schema;

Fig. 2 is that the recombinant expression vector DBN100086t that contains PIC6-01t nucleotide sequence of insect-killing protein of the present invention, its encoding gene and purposes builds schema;

Fig. 3 is that the recombinant expression vector DBN100086N that contains native sequences of insect-killing protein of the present invention, its encoding gene and purposes builds schema;

Fig. 4 is the mRNA relative content figure of the PIC6 insect-killing protein of the transgenic corn plant of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 5 is the pest-resistant design sketch of the transgenic corn plant inoculation Ostrinia furnacalis of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 6 is the pest-resistant design sketch of the transgenic corn plant inoculation striped rice borer of insect-killing protein of the present invention, its encoding gene and purposes;

Fig. 7 is the pest-resistant design sketch of the transgenic corn plant inoculation east armyworm of insect-killing protein of the present invention, its encoding gene and purposes.

Embodiment

Further illustrate the technical scheme of insect-killing protein of the present invention, its encoding gene and purposes below by specific embodiment.

The acquisition of the first embodiment, PIC6-01t gene order and synthetic

1, obtain PIC6-01t gene order

The aminoacid sequence (660 amino acid) of PIC6-01t insect-killing protein, as shown in SEQ ID NO:2 in sequence table; Obtain the nucleotide sequence (1983 Nucleotide) of coding corresponding to the aminoacid sequence (660 amino acid) of described PIC6-01t insect-killing protein according to corn Preference codon, as shown in SEQ ID NO:1 in sequence table.The codon usage bias of corn can be with reference to http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi species=381124.

2, synthetic above-mentioned PIC6-01t nucleotide sequence

Described PIC6-01t nucleotide sequence (as shown in SEQ ID NO:1 in sequence table) is synthetic by Nanjing Jin Sirui biotechnology company; 5 ' end of synthetic described PIC6-01t nucleotide sequence (SEQ ID NO:1) is also connected with SpeI restriction enzyme site, and 3 ' end of described PIC6-01t nucleotide sequence (SEQ ID NO:1) is also connected with SwaI restriction enzyme site.

Meanwhile, synthetic PIC6-01t substituted nucleosides acid sequence (as shown in SEQ ID NO:6 in sequence table), it is that in described PIC6-01t aminoacid sequence (as shown in SEQ ID NO:2 in sequence table), the 659th Lys replaces with Glu; 5 ' end of synthetic described PIC6-01t substituted nucleosides acid sequence (SEQ ID NO:6) is also connected with SpeI restriction enzyme site, and 3 ' end of described PIC6-01t substituted nucleosides acid sequence (SEQ ID NO:6) is also connected with SwaI restriction enzyme site.

Meanwhile, synthetic PIC6-01t disappearance nucleotide sequence (as shown in SEQ ID NO:7 in sequence table), it is the amino acid of disappearance 651-660 position in described PIC6-01t aminoacid sequence (as shown in SEQ ID NO:2 in sequence table); 5 ' end of synthetic described PIC6-01t disappearance nucleotide sequence (SEQ ID NO:7) is also connected with SpeI restriction enzyme site, and 3 ' end of described PIC6-01t disappearance nucleotide sequence (SEQ ID NO:7) is also connected with SwaI restriction enzyme site.

Simultaneously, the nucleotide sequence (as shown in SEQ ID NO:3 in sequence table) of the synthetic PIC6-Ib heterozygosis insect-killing protein of optimizing, it is the aminoacid sequence that reconnects one section of Cry1Ib gene after described PIC6 aminoacid sequence (as shown in SEQ ID NO:2 in sequence table), and the PIC6-Ib aminoacid sequence obtaining is as shown in SEQ ID NO:4 in sequence table.The aminoacid sequence of described Cry1Ib gene is selected from Li, the 661st to 699 of the aminoacid sequences of the natural Cry1Ib6 gene that the sequence number that H. waits people to register in 2010 is ADK38579.1, the aminoacid sequence of natural Cry1Ib6 gene is as shown in SEQ ID NO:5 in sequence table.5 ' end of synthetic described PIC6-Ib nucleotide sequence (SEQ ID NO:3) is also connected with SpeI restriction enzyme site, and 3 ' end of described PIC6-Ib nucleotide sequence (SEQ ID NO:3) is also connected with SwaI restriction enzyme site.

The structure of the second embodiment, recombinant expression vector and recombinant expression vector transform Agrobacterium

1, build the recombinant cloning vector DBN01-T that contains PIC6-01t nucleotide sequence

Synthetic PIC6-01t nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6 rna polymerase promoter; T7 is T7 RNA polymerase promoter; PIC6-01t is PIC6-01t nucleotide sequence (SEQ ID NO:1); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by heat shock method; Cat. No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (shaking table shake under 100rpm rotating speed), scribble the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside on surface) LB flat board (the Tryptones 10g/L of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH to 7.5) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1% SDS(sodium lauryl sulphate) of the new preparation of 150 μ l), pipe is put upside down 4 times, mix, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add 30 μ l containing Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; ℃ save backup in temperature-20.

The plasmid extracting is cut after evaluation through SpeI and SwaI enzyme, positive colony is carried out to sequence verification, result shows that the described PIC6-01t nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:1 in sequence table as, and PIC6-01t nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-01t substituted nucleosides acid sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, miPIC6-01t is PIC6-01t substituted nucleosides acid sequence (SEQ ID NO:6).Enzyme is cut with PIC6-01t substituted nucleosides acid sequence described in sequence verification recombinant cloning vector DBN02-T and is correctly inserted.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-01t disappearance nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN03-T, wherein, mdPIC6-01t is PIC6-01t disappearance nucleotide sequence (SEQ ID NO:7).Enzyme is cut with the disappearance of PIC6-01t described in sequence verification recombinant cloning vector DBN03-T nucleotide sequence and is correctly inserted.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC6-Ib nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN04-T, wherein, PIC6-Ib is the nucleotide sequence (SEQ ID NO:3) of heterozygosis insect-killing protein PIC6-Ib.Enzyme is cut with PIC6-Ib nucleotide sequence described in sequence verification recombinant cloning vector DBN04-T and is correctly inserted.

2, build the recombinant expression vector DBN100086t that contains PIC6-01t nucleotide sequence

With restriction enzyme SpeI and SwaI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the PIC6-01t nucleotide sequence fragment cutting is inserted between the SpeI and SwaI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, SpeI in expression vector DBNBC-01 and SwaI restriction enzyme site are also to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100086t, it builds flow process (Kan: kanamycin gene as shown in Figure 2, RB: right margin, Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:8), PIC6-01t:PIC6-01t nucleotide sequence (SEQ ID NO:1), Nos: the terminator (SEQ ID NO:9) of rouge alkali synthetase, PMI: Phophomannose isomerase gene (SEQ ID NO:10), LB: left margin).

Recombinant expression vector DBN100086t is transformed to intestinal bacteria T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100086t), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (shaking table shake under 100rpm rotating speed); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH to 7.5) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme SpeI and SwaI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector DBN100086t between SpeI and SwaI site classify sequence table as in nucleotide sequence, i.e. PIC6-01t nucleotide sequence shown in SEQ ID NO:1.

According to the method for above-mentioned structure recombinant expression vector DBN100086t, SpeI and SwaI enzyme are cut to the described PIC6-01t substituted nucleosides acid sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression vector DBN100086t-i.Enzyme is cut and sequence verification recombinant expression vector DBN100086t-i is described PIC6-01t substituted nucleosides acid sequence between SpeI and SwaI site.

According to the method for above-mentioned structure recombinant expression vector DBN100086t, SpeI and SwaI enzyme are cut to the described PIC6-01t disappearance nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN03-T cuts, obtain recombinant expression vector DBN100086t-d.Enzyme is cut and sequence verification recombinant expression vector DBN100086t-d is described PIC6-01t disappearance nucleotide sequence between SpeI and SwaI site.

According to the method for above-mentioned structure recombinant expression vector DBN100086t, SpeI and SwaI enzyme are cut to the described PIC6-Ib nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN04-T cuts, obtain recombinant expression vector DBN100086t-h.Enzyme is cut and sequence verification recombinant expression vector DBN100086t-h is described PIC6-Ib interpolation nucleotide sequence between SpeI and SwaI site.

3, build the recombinant expression vector DBN100086N(positive control that contains native sequences)

The method of the recombinant cloning vector DBN01-T that contains PIC6-01 nucleotide sequence according to the structure described in 1 in second embodiment of the invention, utilizes native sequences (SEQ ID NO:11) to build the recombinant cloning vector DBN01R-T that contains native sequences.Positive colony is carried out to sequence verification, and result shows that the native sequences of inserting in recombinant cloning vector DBN01R-T is the nucleotide sequence shown in SEQ ID NO:11 in sequence table, and native sequences is correctly inserted.

The method of the recombinant expression vector DBN100086t that contains PIC6-01 nucleotide sequence according to the structure described in 2 in second embodiment of the invention, utilize native sequences to build the recombinant expression vector DBN100086N that contains native sequences, it builds flow process (carrier framework: pCAMBIA2301(CAMBIA mechanism can provide) as shown in Figure 3; Kan: kanamycin gene; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:8); MN: native sequences (SEQ ID NO:11); Nos: the terminator (SEQ ID NO:9) of rouge alkali synthetase; PMI: Phophomannose isomerase gene (SEQ ID NO:10); LB: left margin).Positive colony is carried out to sequence verification, and result shows that the native sequences of inserting in recombinant expression vector DBN100086N is the nucleotide sequence shown in SEQ ID NO:11 in sequence table, and native sequences is correctly inserted.

4, recombinant expression vector transforms Agrobacterium

To oneself through building correct recombinant expression vector DBN100086t, DBN100086t-i, DBN100086t-d, DBN100086t-h and DBN100086N(native sequences) be transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA by liquid nitrogen method, Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the kantlex (Kanamycin) of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, cut DBN100086 with restriction enzyme StyI and BglII enzyme, DBN100086-i, after DBN100086-t and DBN100086-a, carry out enzyme and cut checking, cut DBN100086N(native sequences with restriction enzyme StyI and BglI enzyme) after carry out enzyme and cut checking, result shows recombinant expression vector DBN100086t, DBN100086t-i, DBN100086t-d, DBN100086t-h and DBN100086N(native sequences) structure is entirely true.

The 3rd embodiment, proceed to acquisition and the checking of the milpa of PIC6-01t nucleotide sequence

1, obtain the milpa that proceeds to PIC6-01t nucleotide sequence

The Agrobacterium infestation method adopting according to routine, the corn variety of sterile culture is combined to 31(Z31) rataria and the second embodiment in Agrobacterium described in 4 cultivate altogether, with by the second embodiment 2 and 3 build recombinant expression vector DBN100086t, DBN100086t-i, DBN100086t-d, DBN100086t-h and DBN100086N(native sequences) in T-DNA(comprise the promoter sequence of corn Ubiquitin gene, PIC6-01t nucleotide sequence, PIC6-01t substituted nucleosides acid sequence, PIC6-01t lacks nucleotide sequence, PIC6-Ib nucleotide sequence, native sequences, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa that proceeds to PIC6-01t nucleotide sequence, proceed to the milpa of PIC6-01t substituted nucleosides acid sequence, proceed to the milpa of PIC6-01t disappearance nucleotide sequence, proceed to the milpa and the milpa (positive control) that proceeds to native sequences of PIC6-Ib nucleotide sequence, simultaneously using wild-type milpa as negative contrast.

Transform for agriculture bacillus mediated corn, briefly, from corn, separate immature rataria, contact rataria with agrobacterium suspension, wherein Agrobacterium can be passed to PIC6-01t nucleotide sequence at least one cell (step 1: infect step) of one of rataria.In this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: culturing step altogether) altogether.Preferably, rataria is infecting after step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, to eliminate Agrobacterium and to provide decubation as infected cell.Then, the rataria of inoculation is containing cultivating and select the transformed calli (step 4: selection step) of growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivates with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.

The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

2, proceed to the milpa of PIC6-01t nucleotide sequence with TaqMan checking

Get respectively and proceed to the milpa of PIC6-01t nucleotide sequence, the milpa that proceeds to PIC6-01t substituted nucleosides acid sequence, the milpa that proceeds to PIC6-01t disappearance nucleotide sequence, the about 100mg of blade of milpa that proceeds to the milpa of PIC6-Ib nucleotide sequence and proceed to native sequences as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detect the copy number of PIC6 gene by Taqman fluorescence probe quantitative PCR method.Using wild-type milpa as negative contrast, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects PIC6 gene copy number is as follows:

Step 11, respectively get proceed to PIC6-01t nucleotide sequence milpa, proceed to PIC6-01t substituted nucleosides acid sequence milpa, proceed to the each 100mg of blade of milpa, the milpa that proceeds to PIC6-Ib nucleotide sequence, the milpa that proceeds to native sequences and the wild-type milpa of PIC6-01t disappearance nucleotide sequence, in mortar, be ground into homogenate with liquid nitrogen respectively, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, with NanoDrop 2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;

Step 14, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 15, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using the sample through identifying known copy number as standard substance, with the sample of wild-type milpa in contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting PIC6-01t nucleotide sequence, PIC6-01t substituted nucleosides acid sequence, PIC6-01t disappearance nucleotide sequence and PIC6-Ib nucleotide sequence:

Primer 1(CF1): ACCAGGACAAGCACCAGAGC is as shown in SEQ ID NO:12 in sequence table;

Primer 2 (CR1): CTTCAGGCTGTCGGTGCTG is as shown in SEQ ID NO:13 in sequence table;

Probe 1(CP1): AGCAGCAACGCCAAGGTGGACAAG is as shown in SEQ ID NO:14 in sequence table;

Following primer and probe are used for detecting native sequences:

Primer 3(CF2): CAAACAGGTATTGGTATTGCGG is as shown in SEQ ID NO:15 in sequence table;

Primer 4(CR2): CCCTTAGGCCATAGCTCACCT is as shown in SEQ ID NO:16 in sequence table;

Probe 2(CP2): CTTGGTACCCTAGGCGTTCCTTTTGCAG is as shown in SEQ ID NO:17 in sequence table;

PCR reaction system is:

The each 45 μ l of every kind of primer that described 50 × primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 × TE damping fluids, and at 4 ℃, be housed in amber test tube.

PCR reaction conditions is:

Utilize SDS2. 3 softwares (Applied Biosystems) analytical data.

Experimental result shows, PIC6-01t nucleotide sequence, PIC6-01t substituted nucleosides acid sequence, all oneself is incorporated in the genome of detected milpa for PIC6-01t disappearance nucleotide sequence PIC6-Ib nucleotide sequence and native sequences, and proceed to the milpa of PIC6-01t nucleotide sequence, proceed to the milpa of PIC6-01t substituted nucleosides acid sequence, proceed to the milpa of PIC6-01t disappearance nucleotide sequence, the milpa that proceeds to PIC6-Ib nucleotide sequence has all obtained with the milpa that proceeds to native sequences the transgenic corn plant that contains single copy PIC6 gene.

The RT-PCR of the 4th embodiment, transgenic corn plant detects

1, the mRNA content detection of the insect-killing protein of transgenic corn plant (PIC6 albumen)

Get respectively 0.2g and proceed to the milpa of PIC6-01t nucleotide sequence, the milpa that proceeds to PIC6-01t substituted nucleosides acid sequence, the milpa that proceeds to PIC6-01t disappearance nucleotide sequence, the fresh blade (lobus cardiacus) of milpa that proceeds to the milpa of PIC6-Ib nucleotide sequence and proceed to native sequences as sample, after liquid nitrogen grinding, add described in 800 μ l and extract damping fluid, centrifugal 10min under the rotating speed of 4000rpm, get 40 times of described extraction damping fluid dilutions for supernatant liquor, the supernatant liquor of getting after 80 μ l dilutions detects for RT-PCR.Liquid nitrogen grinding is collected 100-200mg tissue, after add TRIZOL extracting solution described in 1ml, vortex makes the abundant cracking of sample, room temperature is placed 5min; Add 0.2ml chloroform (chloroform) thermal agitation to mix 15s, room temperature is placed 10min; At 4 ℃, centrifugal 10min under the rotating speed of 12000rpm, gets supernatant liquor and adds 0.5ml(or 0.5X to start volume) RNase-Free water, then add the Virahol (1:1 volume) of 1ml, fully mix, room temperature is placed 10min, precipitation; At 4 ℃, centrifugal 10min under the rotating speed of 12000rpm, getting precipitation, to add 1ml massfraction be 75% washing with alcohol RNA precipitation; At 4 ℃, under the rotating speed of 8000rpm, centrifugal 10min, removes supernatant, and RNA slightly dries about 10-15min, adds the RNase-Free water of 100 μ l volumes fully to dissolve; RNA sample DAaseI enzyme is cut,

As: 20 μ l RNA samples (≤5 μ g, water-soluble or TE Buffer)

Mix, 37 ℃ of temperature are bathed 30min, DNaseI deactivation (DNaseI specification sheets)

Add 3M NaOAc(RNase free, the pH5.2 of 1/10 volume) and the ethanol precipitated rna of 3V; At-80 ℃, place 2 h, at 2-8 ℃, centrifugal 10min under the rotating speed of 12000rpm; Add the washing with alcohol that 500 μ l massfractions are 75%, at 2-8 ℃, centrifugal 5min under the rotating speed of 10000 rpm; Adding massfraction is that 75% ethanol is washed once again, centrifugal after, then sky gets rid of once, blots the ethanol on centrifugal tube wall.Drying at room temperature 10-15 min; Add 100 μ l RNase free water fully to dissolve, centrifugal decon, supernatant is total RNA of preparation; Optical densitometric method is measured concentration and the purity (OD of total RNA ₂₆₀/ OD ₂₈₀) (Gene Quant); Total RNA electrophoresis, detects total RNA whether degrade (can be placed on-80 ℃ of preservations).Add the total RNA of 2 μ g, 1 μ l primer, 1 μ l 10mM dNTPs, moisturizing (RNase-free water) is to 13 μ l; Ice bath 2min immediately after 65 ℃ of sex change 10min, annealing; Add 4 μ l 5 × M-MLV buffer, 1 μ l 20mM DTT, 1 μ l RNase Inhibitor and 1 μ l M-MLV(Invitrigen); 42 ℃ of temperature are bathed after 1-2h, take out in-20 ℃ and save backup.Every duplicate samples is got 0.1 μ g for Real-time PCR(RT-PCR) detect, primer is as follows:

Method of calculation are with reference to Livak et al. " Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 ^{-Δ Δ CT}method ", Method(2001) 25(4): 402-408.

Be accredited as not genetically modified milpa in contrast with wild-type milpa with through quantitative fluorescent PCR, detect according to the method described above analysis simultaneously.Proceed to totally 3 strains (S1, S2 and S3) of PIC6-01t nucleotide sequence, proceed to totally 2 strains (S4 and S5) of PIC6-01t substituted nucleosides acid sequence, proceed to totally 2 strains (S6 and S7) of PIC6-01t disappearance nucleotide sequence, proceed to totally 2 strains (S8 and S9) of PIC6-Ib nucleotide sequence, proceed to totally 2 strains (S10 and S11) of native sequences, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.

The average experimental result of the mRNA content of the PIC6 insect-killing protein of transgenic corn plant as shown in Figure 4.Result shows, the mRNA relative content that proceeds to the PIC6 insect-killing protein in the milpa of PIC6-01t nucleotide sequence is 15 times of left and right that proceed to the milpa of native sequences.Well known to those skilled in the art, RT-PCR technology is sensitive and of many uses, can be directly used in the transcriptional level that detects gene in cell, and then expression level and expressing quantity and the stability of this gene are described indirectly.Therefore, this result shows to have increased significantly according to the codon optimized PIC6-01t nucleotide sequence of the preference of corn stability and expression amount that PIC6-01t albumen is expressed in corn.Meanwhile, the mRNA that proceeds to the PIC6-Ib insect-killing protein in the milpa of PIC6-Ib nucleotide sequence also has higher content.In addition, with proceed to PIC6-01t nucleotide sequence milpa compared with, the mRNA content that proceeds to the milpa of PIC6-01t substituted nucleosides acid sequence and proceed to PIC6 insect-killing protein in the milpa of PIC6-01t disappearance nucleotide sequence is without significant difference.

2, the pest-resistant effect detection of transgenic corn plant

By proceed to PIC6-01t nucleotide sequence milpa, proceed to PIC6-01t substituted nucleosides acid sequence milpa, proceed to milpa, the milpa that proceeds to PIC6-Ib nucleotide sequence, the milpa that proceeds to native sequences, the wild-type milpa of PIC6-01t disappearance nucleotide sequence and be accredited as not genetically modified milpa (V3-V4 period) through quantitative fluorescent PCR and respectively Ostrinia furnacalis, east armyworm and striped rice borer are carried out to pest-resistant effect detection.

(1) Ostrinia furnacalis: get respectively the milpa that proceeds to PIC6-01t nucleotide sequence, proceed to the milpa of PIC6-01t substituted nucleosides acid sequence, proceed to the milpa of PIC6-01t disappearance nucleotide sequence, proceed to the milpa of PIC6-Ib nucleotide sequence, proceed to the milpa of native sequences, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, clean and the water on blade is blotted with gauze with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm × 2cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the Ostrinia furnacalis (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days and add up larva death condition, calculate the average mortality of continent, each sample Central Asia Pyrausta nubilalis (Hubern)..Proceed to totally 3 strains (S1, S2 and S3) of PIC6-01t nucleotide sequence, proceed to totally 2 strains (S4 and S5) of PIC6-01t substituted nucleosides acid sequence, proceed to totally 2 strains (S6 and S7) of PIC6-01t disappearance nucleotide sequence, proceed to totally 2 strains (S8 and S9) of PIC6-Ib nucleotide sequence, proceed to totally 2 strains (S10 and S11) of native sequences, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 1 and Fig. 5.

The result of table 1 shows: proceed to PIC6-01t nucleotide sequence milpa, proceed to the milpa of PIC6-Ib nucleotide sequence and proceed in the milpa of native sequences and can choose plant Ostrinia furnacalis to certain resistance, but the examination worm mortality ratio that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to the milpa of PIC6-Ib nucleotide sequence is significantly higher than the milpa that proceeds to native sequences.The examination worm mortality ratio of milpa that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence is more than 55%, and the examination worm mortality ratio of milpa that proceeds to native sequences is in 13% left and right.The result of Fig. 5 shows: although the milpa that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence can not caused the mortality of newly hatched larvae, but but larvae development progress is caused to great inhibition, after 3 days, larva is substantially still in just incubating state or between just incubate-negative control state, and its blade injury rate is also less.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation Ostrinia furnacalis

(2) striped rice borer: get respectively the milpa that proceeds to PIC6-01t nucleotide sequence, proceed to the milpa of PIC6-01t substituted nucleosides acid sequence, proceed to the milpa of PIC6-01t disappearance nucleotide sequence, proceed to the milpa of PIC6-Ib nucleotide sequence, proceed to the milpa of native sequences, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, clean and the water on blade is blotted with gauze with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm × 2cm simultaneously, getting 3 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the striped rice borer (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to Chilo spp larvae development progress, three indexs of mortality ratio and blade injury rate, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of PIC6-01t nucleotide sequence, proceed to totally 2 strains (S4 and S5) of PIC6-01t substituted nucleosides acid sequence, proceed to totally 2 strains (S6 and S7) of PIC6-01t disappearance nucleotide sequence, proceed to totally 2 strains (S8 and S9) of PIC6-Ib nucleotide sequence, proceed to totally 2 strains (S10 and S11) of native sequences, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 2 and Fig. 6.

The result of table 2 shows: proceed to PIC6-01t nucleotide sequence milpa, proceed to the milpa of PIC6-Ib nucleotide sequence and proceed in the milpa of native sequences and can choose plant striped rice borer to certain resistance, but the raw total score of surveying that proceeds to the milpa of PIC6-01 nucleotide sequence and proceed to the milpa of PIC6-Ib nucleotide sequence is significantly higher than the milpa that proceeds to native sequences.Milpa raw that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence surveyed total score all more than 160 points, and the raw total score of surveying of milpa that proceeds to native sequences is 80 points of left and right.The result of Fig. 6 shows: although the milpa that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence can not caused the mortality of newly hatched larvae, but but larvae development progress is caused to great inhibition, after 3 days, larva is substantially still in just incubating state or between just incubate-negative control state, and its blade injury rate is below 30%.

The pest-resistant experimental result of table 2, transgenic corn plant inoculation striped rice borer

(3) east armyworm: get respectively the milpa that proceeds to PIC6-01t nucleotide sequence, proceed to the milpa of PIC6-01t substituted nucleosides acid sequence, proceed to the milpa of PIC6-01t disappearance nucleotide sequence, proceed to the milpa of PIC6-Ib nucleotide sequence, proceed to the milpa of native sequences, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, clean and the water on blade is blotted with gauze with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm × 2cm simultaneously, getting 3 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, in each culture dish, put the east armyworm (newly hatched larvae) of 10 artificial breedings, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, under the condition of photoperiod (light/dark) 16:8, place after 3 days, according to east armyworm larvae development progress, three indexs of mortality ratio and blade injury rate, obtain resistance total score: total score=100 × mortality ratio+[100 × mortality ratio+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of PIC6-01t nucleotide sequence, proceed to totally 2 strains (S4 and S5) of PIC6-01t substituted nucleosides acid sequence, proceed to totally 2 strains (S6 and S7) of PIC6-01t disappearance nucleotide sequence, proceed to totally 2 strains (S8 and S9) of PIC6-Ib nucleotide sequence, proceed to totally 2 strains (S10 and S11) of native sequences, be accredited as not genetically modified (NGM) totally 1 strain through quantitative fluorescent PCR, (CK) of wild-type be totally 1 strain; Select 5 strains to test from each strain, every strain repeats 6 times.Result as shown in Table 3 and Figure 7.

The result of table 3 shows: proceed to PIC6-01t nucleotide sequence milpa, proceed to the milpa of PIC6-Ib nucleotide sequence and proceed in the milpa of native sequences and can choose plant oriental armyworm to certain resistance, but the raw total score of surveying that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to the milpa of PIC6-Ib nucleotide sequence is significantly higher than the milpa that proceeds to native sequences.Milpa raw that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence surveyed total score all more than 110 points, and the raw total score of surveying of milpa that proceeds to native sequences is 35 points of left and right.The result of Fig. 7 shows: although the milpa that proceeds to the milpa of PIC6-01t nucleotide sequence and proceed to PIC6-Ib nucleotide sequence can not caused the mortality of newly hatched larvae, but but larvae development progress is caused to great inhibition, after 3 days, larva is substantially still in just incubating state or between just incubate-negative control state, and its blade injury rate is in 50% left and right.

Prove that thus the milpa that proceeds to PIC6-01t nucleotide sequence has higher insect resistance capacity with the milpa that proceeds to PIC6-Ib nucleotide sequence, the milpa of expressing the milpa that proceeds to PIC6-01t nucleotide sequence that PIC6-01t albumen and PIC6-Ib protein level are high and proceeding to PIC6-Ib nucleotide sequence all has higher virulence, has therefore all increased significantly according to the codon optimized PIC6-01t nucleotide sequence of the preference of corn and PIC6-Ib nucleotide sequence the virulence that PIC6-01t albumen and PIC6-Ib albumen are expressed in corn.In addition, with proceed to PIC6-01t nucleotide sequence milpa compared with, the virulence that proceeds to the milpa of PIC6-01t substituted nucleosides acid sequence and proceed to PIC6-01t albumen in the milpa of PIC6-01t disappearance nucleotide sequence is without significant difference.

In sum, PIC6-01t killing gene of the present invention adopts the preference codon of corn, meet the characteristic of corn gene completely, make killing gene of the present invention be particularly suitable for expressing in monocotyledons, especially corn, not only expression amount is high and good stability for PIC6-01t insect-killing protein of the present invention, strong to the virulence of insect pest, especially lepidopterous insects insect.

The pest-resistant experimental result of table 3, transgenic corn plant inoculation east armyworm

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.

Claims (16)

1. an insect-killing protein, is characterized in that, as:

(a) protein of the composition of the 1-650 amino acids sequence shown in SEQ ID NO:2; Or

(b) protein of the composition of the aminoacid sequence shown in SEQ ID NO:2; Or

(c) the nucleotide sequence coded protein shown in SEQ ID NO:6.

2. a killing gene, is characterized in that, as:

(a) nucleotide sequence of insect-killing protein described in coding claim 1; Or

(b) nucleotide sequence shown in the 1-1950 position of SEQ ID NO:1; Or

(c) nucleotide sequence shown in SEQ ID NO:1.

3. an expression cassette, is characterized in that, is included in killing gene described in the claim 2 under the regulating and controlling sequence regulation and control of effective connection.

4. a recombinant vectors that comprises expression cassette described in killing gene described in claim 2 or claim 3.

5. a method that produces insect-killing protein, is characterized in that, comprising:

The cell that acquisition comprises the transformed host biology of expression cassette described in killing gene described in claim 2 or claim 3;

Under the condition that allows to produce insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

6. the method that produces according to claim 5 insect-killing protein, is characterized in that, described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

7. the method that produces according to claim 6 insect-killing protein, is characterized in that, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

8. the method for increasing insect target scope, it is characterized in that, comprising: together with the second desinsection Nucleotide of the insect-killing protein that the insect-killing protein of expression cassette coding described in insect-killing protein described in claim 1 or claim 3 is encoded with expression cassette described in insect-killing protein or claim 3 described at least one is different from claim 1 in plant, express.

9. according to claim 8 for increasing the method for insect target scope, it is characterized in that described the second desinsection Nucleotide can encode Cry class insect-killing protein, Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.

10. according to claim 8 for increasing the method for insect target scope, it is characterized in that, described the second desinsection Nucleotide is the dsRNA that suppresses important gene in targeted insect insect.

11. 1 kinds produce the method for zoophobous, it is characterized in that, comprising: recombinant vectors described in expression cassette described in killing gene described in claim 2 or claim 3 or claim 4 is imported to plant.

12. according to the method that produces zoophobous described in claim 11, it is characterized in that, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

The method of 13. 1 kinds of damages of avoiding being caused by insect pest for the protection of plant; it is characterized in that; comprise: recombinant vectors described in expression cassette described in killing gene described in claim 2 or claim 3 or claim 4 is imported to plant, make the plant generation after importing enough protect it to avoid the insect-killing protein of insect pest infringement amount.

14. according to the method for the damage of avoiding being caused by insect pest for the protection of plant described in claim 13, it is characterized in that, described plant is corn, soybean, cotton, paddy rice, wheat, Chinese sorghum, herbage or sugarcane.

Control the method for insect pest for 15. 1 kinds, it is characterized in that, comprising: make described in the claim 1 of insect pest and amount of suppression insect-killing protein or contacted by the insect repressible protein matter of killing gene coding described in claim 2.

16. according to the method for controlling insect pest described in claim 15, it is characterized in that, described insect pest is lepidopterous insects insect.

Images