CN102786584B - Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein - Google Patents
Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein Download PDFInfo
- Publication number
- CN102786584B CN102786584B CN 201210273487 CN201210273487A CN102786584B CN 102786584 B CN102786584 B CN 102786584B CN 201210273487 CN201210273487 CN 201210273487 CN 201210273487 A CN201210273487 A CN 201210273487A CN 102786584 B CN102786584 B CN 102786584B
- Authority
- CN
- China
- Prior art keywords
- insect
- pic9
- protein
- nucleotide sequence
- killing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to insecticidal protein, a coding gene of the insecticidal protein and a purpose of the insecticidal protein. The insecticidal protein comprises (a) protein consisting of amino acid sequences shown by SEQ ID NO. 2 or 1st to 640th bits; or (b) protein which has the insecticidal activity and is derived from (a) through substituting, deleting or adding one or several amino acids from/into the amino acid sequences of (a); or (c) protein generated through expression of the nucleic acid molecule containing the 1st to 1920th bit nucleotide sequences of SEQ ID NO. 1; or (d) protein generated through expression of the nucleic acid molecule containing complementary sequences hybridized with the 1st to 1920th bit nucleotide sequences of SEQ ID NO. 1 under the strict conditions; or (e) protein generated through nucleic acid molecule expression with similar codes to the nucleotide sequences of (d). The insecticidal protein has high expression quantity and strong toxicity on insect pests.
Description
Technical field
The present invention relates to a kind of insect-killing protein, its encoding gene and purposes, particularly relate to a kind of PIC9 insect-killing protein, its encoding gene and purposes of transformation.
background technology
Insect pest of the plant is the principal element that causes crop loss, to the peasant, causes great financial loss, even has influence on the survival state of local population.In order to prevent and treat insect pest of the plant, people use phosphoramidite chemical sterilant and Biocidal preparation usually, but the two all has limitation in actual applications: chemical insecticide can bring the problem of environmental pollution, and causes the appearance of resistance insect; And the easily degraded in environment of Biocidal preparation needs repetitive administration on producing, greatly increased production cost.
In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientists is found the anti insect gene of encoding insecticidal proteins is proceeded in plant through research, can obtain some insect-resistant transgenic plants with the control insect pest of the plant.The PIC9 insecticidal proteins is a kind of in numerous insecticidal proteins, is the companion's spore crystalline protein produced by bacillus thuringiensis storehouse Stuckey subspecies (Bacillus thuringiensis subsp.kurstaki, B.t.k.), is insoluble crystallin.
PIC9 albumen is taken in and is entered middle intestines by insect, and the toxalbumin parent toxin is dissolved under the alkaline PH environment of insect midgut.Albumen N-and C-end, by the basic protein enzymic digestion, are transformed into active fragments by parent toxin; Receptors bind on active fragments and insect midgut epithelial cell membrane upper surface, the insertion goldbeater's skin, cause cytolemma the perforation focus to occur, destroys the inside and outside osmotic pressure variation of cytolemma and PH balance etc., upsets the digestive process of insect, finally causes its death.
The annual grain loss caused because of insect pest of the plant is huge, such as Pyrausta nubilalis (Hubern)., black cutworm, Heliothis zea or bollworm etc.Do not find at present the expression level of PIC9 insecticidal proteins in plant and the report of virulence.
summary of the invention
The purpose of this invention is to provide a kind of insect-killing protein, its encoding gene and purposes, described PIC9 insecticidal proteins (being especially corn) in plant has higher expression amount and virulence.
For achieving the above object, the invention provides a kind of insect-killing protein, comprising:
(a) protein that the 1-640 amino acids sequence as shown in SEQ ID NO:2 forms; Or
(b) protein that the aminoacid sequence as shown in SEQ ID NO:2 forms; Or
(c) at (a) or the aminoacid sequence (b) through replacement, lack or add one or several amino acid and have insecticidal activity by (a) or (b) derivative protein; Or
(d) protein that the expression of the nucleic acid molecule of the 1-1920 position nucleotide sequence by comprising SEQ ID NO:1 produces; Or
(e) protein that the expression of the nucleic acid molecule by comprising nucleotide sequence produces, described nucleotide sequence has under stringent condition the complementary sequence with the 1-1920 position nucleotide sequence hybridization of SEQ ID NO:1; Or
(f) protein that the expression of the nucleic acid molecule by comprising nucleotide sequence produces, described nucleotide sequence and nucleotide sequence isocoding (e).
Described stringent condition can be the Trisodium Citrate at 6 * SSC(), the 0.5%SDS(sodium lauryl sulphate) in solution, under 65 ℃, hybridization, then use 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.
For achieving the above object, the invention provides a kind of killing gene, comprising:
(a) nucleotide sequence of the protein that the 1-640 amino acids sequence of coding as shown in SEQ ID NO:2 forms; Or
(b) nucleotide sequence of the protein that the aminoacid sequence of coding as shown in SEQ ID NO:2 forms; Or
(c) nucleotide sequence of encoding amino acid sequence, described aminoacid sequence at (a) or the aminoacid sequence (b) through replacement, lack or add one or several amino acid and have insecticidal activity by (a) or (b) derivative protein; Or
(d) there is the nucleotide sequence shown in the 1-1920 position of SEQ ID NO:1; Or
(e) nucleotide sequence of the protein that there is insecticidal activity with the nucleotide sequence hybridization (d) limited and coding under stringent condition; Or
(f) with nucleotide sequence isocoding (e).
Described stringent condition can be the Trisodium Citrate at 6 * SSC(), the 0.5%SDS(sodium lauryl sulphate) in solution, under 65 ℃, hybridization, then use 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.
For achieving the above object, the present invention also provides a kind of expression cassette, is included in the described killing gene under the regulating and controlling sequence regulation and control of effective connection.
For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described killing gene or described expression cassette.
For achieving the above object, the present invention also provides a kind of transformed host biology that comprises described killing gene or described killing gene, comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.
Further, described plant is corn, soybean, cotton, paddy rice or wheat.
For achieving the above object, the present invention also provides a kind of method that produces insect-killing protein, comprising:
Obtain the cell of described transformed host biology;
Cultivate the cell of described transformed host biology under the condition that allows the generation insect-killing protein;
Reclaim described insect-killing protein.
For achieving the above object, the present invention also provides a kind of method for increasing insect target scope, comprising: described expression cassette is being expressed in plant together with at least one the second insect-killing protein of insect-killing protein that is different from described expression cassette coding.
Further, described the second insect-killing protein is Vip class insect-killing protein, proteinase inhibitor, lectin, α-amylase or peroxidase.
In the present invention, the expression of PIC9 insecticidal proteins in a kind of transgenic plant can be accompanied by the expression of one or more Vip class insect-killing proteins.Thisly surpass a kind of Pesticidal toxins co expression in same strain transgenic plant and can plant be comprised and express required gene and realize by genetic engineering.In addition, a kind of plant (the 1st parent) can be expressed the PIC9 insecticidal proteins by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed Vip class insect-killing protein by genetic engineering procedure.Hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent by the 1st parent and the 2nd parent.
For achieving the above object, the present invention also provides a kind of method that produces zoophobous, comprising: by described killing gene or described expression cassette or described recombinant vectors importing plant.
Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.
For achieving the above object; the present invention also provides a kind of method of the damage of avoiding being caused by insect pest for the protection of plant; comprise: by described killing gene or described expression cassette or described recombinant vectors importing plant, the plant after making to import produces enough protections, and it avoids the insect-killing protein of insect pest infringement amount.
Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.
For achieving the above object, the present invention also provides a kind of nucleotide sequence coded heterozygosis insect-killing protein by comprising described killing gene.
Further, described heterozygosis insect-killing protein is nucleotide sequence coded by as shown in SEQ ID NO:3.
For achieving the above object, the present invention also provides a kind of method of controlling insect pest, comprising: insect pest is contacted with the described insect-killing protein of amount of suppression or insect repressible protein matter or the described heterozygosis insect-killing protein of being encoded by described killing gene.
Preferably, described insect pest is the lepidopterous insects insect.
By described killing gene or described expression cassette or described recombinant vectors importing plant, in the present invention for foreign DNA is imported to vegetable cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-emission bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.
The genome of the plant described in the present invention, plant tissue or vegetable cell, refer to any genetic material in plant, plant tissue or vegetable cell, and comprise nucleus and plastid and Mitochondrial Genome Overview.
" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that for example is applicable to expression of plants) of the original DNA that relates to or protein sequence (Nucleotide or amino acid), can there be variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is insect toxins.
In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, i.e. and the folding and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and for example aminoterminal extends a methionine residues; Little connection peptides, for example an about 20-25 residue is long.
The conservative example replaced is the replacement occurred in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually those aminoacid replacement that do not change given activity are well-known in this area, and by, for example, N. Neurath and R. L. Hill are described in " Protein " of new york academic press (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.
For a person skilled in the art apparently, this replacement can occur outside the zone that molecular function is played an important role, and still produces active polypeptide.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino-acid residue, can be according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis identified (as referring to, Cunningham and Wells, 1989, Science 244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, detects the anti-insect activity of gained mutating molecule, thereby determines the amino-acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science 255:306-312; Smith etc., 1992, J. Mol. Biol 224:899-904; Wlodaver etc., 1992, FEBS Letters 309:59-64).
Therefore, the aminoacid sequence that has certain homology with the aminoacid sequence shown in sequence 2 is also included within the present invention.These sequences and sequence of the present invention be the 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologies.Be that the scope of sequence identity is distributed at least approximately 40%-50%, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.
Amplifying nucleic acid molecule of the present invention or its fragment are hybridized with killing gene of the present invention under stringent condition.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of killing gene of the present invention.Nucleic acid molecule or its fragment can be carried out specific hybrid with other nucleic acid molecule under a stable condition.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementarity completely, claim that one of them nucleic acid molecule is another nucleic acid molecule " complement ".In the present invention, when each Nucleotide and the corresponding Nucleotide of another nucleic acid molecule of a nucleic acid molecule are complementary, claim these two nucleic acid molecule to demonstrate " complete complementary "., if thereby two nucleic acid molecule can make with enough stability phase mutual crosses them under at least conventional " low strict " condition, anneal and be bonded to each other, claim these two nucleic acid molecule for " minimum level complementation ".Similarly, if thereby two nucleic acid molecule can make with enough stability phase mutual crosses them anneal under " highly strict " condition of routine and be bonded to each other, and claim these two nucleic acid molecule to there is " complementarity ".Depart from from complete complementary and can allow, depart from two molecules of incomplete prevention as long as this and form duplex structure.In order to make a nucleic acid molecule as primer or probe, only need to guarantee that it has sufficient complementarity on sequence, so that can form stable duplex structure under adopted specific solvent and salt concn.
In the present invention, the sequence of basic homology is one section nucleic acid molecule, this nucleic acid molecule under the height stringent condition can with the complementary strand generation specific hybrid of another section nucleic acid molecule be complementary.Promote the applicable stringent condition of DNA hybridization, for example, process by 6.0 * sodium chloride/sodium citrate (SSC) under 45 ℃ of conditions greatly, then under 50 ℃ of conditions, with 2.0 * SSC, wash, these conditions are known to those skilled in the art.For example, the salt concn in washing step can be selected from the approximately 2.0 * SSC, 50 ℃ of low stringent condition to the approximately 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can, from approximately 22 ℃ of the room temperatures of low stringent condition, be elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salt concn can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, under 65 ℃, with SEQ ID NO:1, specific hybrid occurs, and then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.
Therefore, there is anti-insect activity and comprise in the present invention with the sequence of sequence 1 hybridization of the present invention under stringent condition.These sequences and sequence of the present invention be the 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologies.Be that the scope of sequence identity is distributed at least approximately 40%-50%, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.
When the polypeptide of nucleic acid sequence encoding when polypeptide with reference to nucleic acid sequence encoding has identical aminoacid sequence, this nucleotide sequence with reference to nucleotide sequence, be " isocoding " of the present invention.
Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, and leader sequence, intron and other are operably connected to the adjusting sequence of described killing gene.
Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected encoding sequence is expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, the ubi promotor of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization of plant (can test and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be the wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, be significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the proteolytic enzyme suppressor gene of potato and tomato (pin I and pin II) and zein enzyme suppressor gene (MPI).
Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast(id), perhaps utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.
Described leader sequence including but not limited to, the picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); The Potyvirus group leader sequence, as the MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.
Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.
For monocotyledons application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledons application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.
Described terminator can be the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene the polyadenylation signal sequence, derive from proteinase inhibitor II (pin II) gene the polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.
" effectively connect " connection that means nucleotide sequence described in the present invention, described connection makes a sequence that the function needed concerning the sequence that is connected can be provided.Described " effectively connect " can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control in the present invention.When interested sequence encoding albumen and while going for the expression of this albumen " effectively connecting " mean: promotor is connected with described sequence, and connected mode makes the transcript obtained efficiently translate.If, when promotor is the expression of transcript fusion and the albumen of wanting the realization coding with being connected of encoding sequence, manufacture such connection, making the first translation initiation codon in the transcript obtained is the initiator codon of encoding sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting the realization coding with being connected of encoding sequence, manufacture such connection, make the first translation initiation codon and the promotor that contain in 5 ' non-translated sequence be connected, and mode of connection make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of genetic expression function is provided, promotor for example, 5 ' untranslated zone, intron, the encoding histone zone, 3 ' untranslated zone, poly-putative adenylylation site and/or transcription terminator), it (is the T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, the site-specific recombinase recognition site, the intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, sequence external or the interior assistance of body series of operations (is the polylinker sequence, the locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).
It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is insect, such as, but not limited to, most of lepidoptera pest, as Pyrausta nubilalis (Hubern)., black cutworm, Heliothis zea, bollworm, rice-stem borer or pink rice borer etc.
" hybrid toxins " made Pesticidal toxins described in the present invention, it comprises amino acid region or fragment from a kind of toxin that derives from different toxin amino acid regions or fragment connection, include but not limited to, connect the PIC9 C-stub area that derives from SEQ ID NO:2 and the Cry1Ab N-stub area that derives from the 630th to 678 of SEQ ID NO:5, produced the hybrid toxins with aminoacid sequence described in SEQ ID NO:4.
In the present invention, described insect-killing protein has the PIC9 aminoacid sequence, as shown in SEQ ID NO:2 in sequence table.Described killing gene has the PIC9 nucleotide sequence, as shown in SEQ ID NO:1 in sequence table.Described killing gene is for plant, the DNA sequence dna that particularly corn transforms, except the coding region that comprises the protein nucleotide sequence coded by PIC9, also can comprise other elements, the coding region of the protein of the coding region of the transit peptides of for example encoding, codes selection mark or the protein of conferring herbicide resistance.
In the present invention, most of lepidoptera pests of PIC9 insecticidal proteins confrontation harm corn have toxicity.Plant in the present invention, particularly corn contain foreign DNA in its genome, and described foreign DNA comprises the PIC9 nucleotide sequence, by this albumen of expression inhibiting amount, protect it to avoid the threat of insect.Amount of suppression refers to lethal or semilethal dosage.Simultaneously, plant should be normal on form, and can under ordinary method, cultivate with the consumption for product and/or generation.In addition, but this plant basically eliminate to the needs (described chemistry or biotic pesticide are the sterilant for the insect of the protein institute target nucleotide sequence coded by PIC9) of chemistry or biotic pesticide.
The expression level of insecticidal crystal protein in vegetable material (ICP) can be detected by described several different methods in this area, for example by the application special primer, the mRNA to the coded insect-killing protein of organizing interior generation carries out quantitatively, or the direct amount of the insect-killing protein of specific detection generation.
Can apply the insecticidal effect of ICP in different test determination plants.In the present invention, targeted insect is mainly lepidoptera pest, is more specifically Ostrinia furnacalis, east armyworm, bollworm, rice-stem borer or pink rice borer etc.
In addition, the expression cassette that comprises killing gene of the present invention (PIC9 gene) sequence can also expressed with together with the protein of at least one herbicide resistance gene of encoding in plant, described herbicide resistance gene includes but not limited to, the glufosinates resistant gene is (as the bar gene, the pat gene), phenmedipham resistant gene (as the pmph gene), glyphosate resistance gene (as the EPSPS gene), bromoxynil (bromoxynil) resistant gene, the sulfonylurea resistant gene, resistant gene to weedicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (as PPT), both there is high insecticidal activity thereby obtain, the transgenic plant that there is again Herbicid resistant.
The invention provides a kind of insect-killing protein, its encoding gene and purposes, have the following advantages:
1, virulence is strong.The insecticidal toxicity of insect-killing protein PIC9 of the present invention is strong, especially for the lepidoptera pest of the corn of causing harm.
2, expression amount is high.Killing gene PIC9 of the present invention adopts the preference codon of corn, meets the characteristic of corn gene fully, makes killing gene of the present invention be particularly suitable for expressing in monocotyledons, corn especially, the high and good stability of its expression amount.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
The accompanying drawing explanation
The recombinant cloning vector DBN01-T that contains the PIC9 nucleotide sequence that Fig. 1 is insect-killing protein of the present invention, its encoding gene and purposes builds schema;
The recombinant expression vector DBN100091 that contains the PIC9 nucleotide sequence that Fig. 2 is insect-killing protein of the present invention, its encoding gene and purposes builds schema;
The recombinant expression vector DBN100091R that contains known array that Fig. 3 is insect-killing protein of the present invention, its encoding gene and purposes builds schema;
The pest-resistant design sketch of the transgenic corn plant inoculation Ostrinia furnacalis that Fig. 4 is insect-killing protein of the present invention, its encoding gene and purposes;
The pest-resistant design sketch of the transgenic corn plant inoculation east armyworm that Fig. 5 is insect-killing protein of the present invention, its encoding gene and purposes.
Embodiment
Further illustrate the technical scheme of insect-killing protein of the present invention, its encoding gene and purposes below by specific embodiment.
The acquisition of the first embodiment, PIC9 gene order and synthetic
1, obtain the PIC9 gene order
The aminoacid sequence of PIC9 insect-killing protein (650 amino acid), as shown in SEQ ID NO:2 in sequence table; Obtain the nucleotide sequence (1953 Nucleotide) of coding corresponding to the aminoacid sequence (650 amino acid) of described PIC9 insect-killing protein according to corn Preference codon, as shown in SEQ ID NO:1 in sequence table.The codon usage bias of corn can be with reference to http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi species=381124.
2, synthetic above-mentioned PIC9 nucleotide sequence
Described PIC9 nucleotide sequence (as shown in SEQ ID NO:1 in sequence table) is synthetic by Nanjing Jin Sirui biotechnology company; 5 ' end of synthetic described PIC9 nucleotide sequence (SEQ ID NO:1) also is connected with the AscI restriction enzyme site, and 3 ' end of described PIC9 nucleotide sequence (SEQ ID NO:1) also is connected with the SpeI restriction enzyme site.
Simultaneously, synthetic PIC9 substituted nucleosides acid sequence (as shown in SEQ ID NO:6 in sequence table), it is that in described PIC9 aminoacid sequence (as shown in SEQ ID NO:2 in sequence table), the 637th Asn replaces with Asp; 5 ' end of synthetic described PIC9 substituted nucleosides acid sequence (SEQ ID NO:6) also is connected with the AscI restriction enzyme site, and 3 ' end of described PIC9 substituted nucleosides acid sequence (SEQ ID NO:6) also is connected with the SpeI restriction enzyme site.
Simultaneously, synthetic PIC9 disappearance nucleotide sequence (as shown in SEQ ID NO:7 in sequence table), its amino acid that is disappearance 641-650 position in described PIC9 aminoacid sequence (as shown in SEQ ID NO:2 in sequence table); 5 ' end of synthetic described PIC9 disappearance nucleotide sequence (SEQ ID NO:7) also is connected with the AscI restriction enzyme site, and 3 ' end of described PIC9 disappearance nucleotide sequence (SEQ ID NO:7) also is connected with the SpeI restriction enzyme site.
Simultaneously, synthetic PIC9 adds nucleotide sequence (as shown in SEQ ID NO:8 in sequence table), and it is to add 5 amino acid Ser, Thr, Asn, Gln, Leu in described PIC9 aminoacid sequence (as shown in SEQ ID NO:2 in sequence table) after the 650th; 5 ' the end that synthetic described PIC9 adds nucleotide sequence (SEQ ID NO:8) also is connected with the AscI restriction enzyme site, and the 3 ' end that described PIC9 adds nucleotide sequence (SEQ ID NO:8) also is connected with the SpeI restriction enzyme site.
In addition, the nucleotide sequence (as shown in SEQ ID NO:3 in sequence table) of the synthetic PIC9-Ab heterozygosis insect-killing protein of optimizing, it is to reconnect the aminoacid sequence of one section Cry1Ab gene after described PIC9 aminoacid sequence (as shown in SEQ ID NO:2 in sequence table), and resulting PIC9-Ab aminoacid sequence is as shown in SEQ ID NO:4 in sequence table.The aminoacid sequence of described Cry1Ab gene is selected from Li, the 630th to 678 of the aminoacid sequences of the natural Cry1Ab25 gene that the sequence number that H. waits the people to register in 2011 is AEI71571.1, the aminoacid sequence of natural Cry1Ab25 gene is as shown in SEQ ID NO:5 in sequence table.5 ' end of synthetic described PIC9-Ab nucleotide sequence (SEQ ID NO:3) also is connected with the AscI restriction enzyme site, and 3 ' end of described PIC9-Ab nucleotide sequence (SEQ ID NO:3) also is connected with the SpeI restriction enzyme site.
The structure of the second embodiment, recombinant expression vector and recombinant expression vector transform Agrobacterium
1, build the recombinant cloning vector DBN01-T that contains the PIC9 nucleotide sequence
Synthetic PIC9 nucleotide sequence is connected into to cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp means ampicillin resistance gene as shown in Figure 1; F1 means the replication orgin of phage f1; LacZ is the LacZ initiator codon; SP6 is SP6 rna polymerase promoter; T7 is T7 RNA polymerase promoter; PIC9 is PIC9 nucleotide sequence (SEQ ID NO:1); MCS is multiple clone site).
Then recombinant cloning vector DBN01-T is transformed to intestinal bacteria T1 competent cell (Transgen, Beijing, China by the heat shock method; Cat. No:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under the 100rpm rotating speed, shaking table shakes), scribble the chloro-3-indoles-β of the bromo-4-of X-gal(5--D-galactoside on surface) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper grow overnight.The picking white colony, in LB liquid nutrient medium (NaCl 10g/L, penbritin 100mg/L, adjust pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under the 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for the precipitation thalline, 50mM glucose, pH8.0) suspend; The solution II (0.2M NaOH, 1% SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandon supernatant liquor, after the washing with alcohol that precipitation is 70% by mass concentration, dries; Add 30 μ l containing Rnase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; In 37 ℃ of lower water-bath 30min of temperature, digestion RNA; In temperature-20 ℃, save backup.
The plasmid extracted is after AscI and SpeI enzyme are cut evaluation, positive colony is carried out to sequence verification, result shows that the described PIC9 nucleotides sequence inserted in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:1 in sequence table as, and the PIC9 nucleotide sequence correctly inserts.
Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC9 substituted nucleosides acid sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, miPIC9 is PIC9 substituted nucleosides acid sequence (SEQ ID NO:6).Enzyme is cut with PIC9 substituted nucleosides acid sequence described in sequence verification recombinant cloning vector DBN02-T and is correctly inserted.
Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC9 disappearance nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN03-T, wherein, mdPIC9 is PIC9 disappearance nucleotide sequence (SEQ ID NO:7).Enzyme is cut with the disappearance of PIC9 described in sequence verification recombinant cloning vector DBN03-T nucleotide sequence and is correctly inserted.
Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC9 is added to nucleotide sequence to be connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN04-T, wherein, maPIC9 is that PIC9 adds nucleotide sequence (SEQ ID NO:8).Enzyme is cut with the interpolation of PIC9 described in sequence verification recombinant cloning vector DBN04-T nucleotide sequence and is correctly inserted.
Method according to above-mentioned structure recombinant cloning vector DBN01-T, synthetic described PIC9-Ab nucleotide sequence is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN05-T, wherein, the nucleotide sequence that PIC9-Ab is heterozygosis insect-killing protein PIC9-Ab (SEQ ID NO:3).Enzyme is cut with PIC9-Ab nucleotide sequence described in sequence verification recombinant cloning vector DBN05-T and is correctly inserted.
2, build the recombinant expression vector DBN100091 that contains the PIC9 nucleotide sequence
With restriction enzyme A scI and SpeI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the PIC9 nucleotide sequence fragment cut is inserted between the AscI and SpeI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, AscI in expression vector DBNBC-01 and SpeI restriction enzyme site are also to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100091, it builds flow process (Kan: kanamycin gene as shown in Figure 2, RB: right margin, Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:9), PIC9:PIC9 nucleotide sequence (SEQ ID NO:1), Nos: the terminator of rouge alkali synthetase (SEQ ID NO:10), PMI: Phophomannose isomerase gene (SEQ ID NO:11), LB: left margin).
Recombinant expression vector DBN100091 is transformed to intestinal bacteria T1 competent cell by the heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100091), 42 ℃ of water-baths 30 seconds; 37 ℃ of water-baths 1 hour (under the 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, the picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, adjust pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme A scI and SpeI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector DBN100091 between AscI and SpeI site classify sequence table as in nucleotide sequence, i.e. PIC9 nucleotide sequence shown in SEQ ID NO:1.
According to the method for above-mentioned structure recombinant expression vector DBN100091, AscI and SpeI enzyme are cut to the described PIC9 substituted nucleosides acid sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN02-T cuts, obtain recombinant expression vector DBN100091-i.Enzyme is cut and sequence verification recombinant expression vector DBN100091-i is described PIC9 substituted nucleosides acid sequence between AscI and SpeI site.
According to the method for above-mentioned structure recombinant expression vector DBN100091, AscI and SpeI enzyme are cut to the described PIC9 disappearance nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN03-T cuts, obtain recombinant expression vector DBN100091-d.Enzyme is cut and sequence verification recombinant expression vector DBN100091-d is described PIC9 disappearance nucleotide sequence between AscI and SpeI site.
According to the method for above-mentioned structure recombinant expression vector DBN100091, AscI and SpeI enzyme are cut to the described PIC9 interpolation nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN04-T cuts, obtain recombinant expression vector DBN100091-a.Enzyme is cut and sequence verification recombinant expression vector DBN100091-a is described PIC9 interpolation nucleotide sequence between AscI and SpeI site.
According to the method for above-mentioned structure recombinant expression vector DBN100091, AscI and SpeI enzyme are cut to the described PIC9-Ab nucleotide sequence insertion expression vector DBNBC-01 that recombinant cloning vector DBN05-T cuts, obtain recombinant expression vector DBN100091-h.Enzyme is cut and sequence verification recombinant expression vector DBN100091-h is described PIC9-Ab interpolation nucleotide sequence between AscI and SpeI site.
3, build the recombinant expression vector DBN100091R(positive control that contains known array)
According to the method for the recombinant cloning vector DBN01-T that in second embodiment of the invention, 1 described structure contains the PIC9 nucleotide sequence, utilize known array (SEQ ID NO:12) to build the recombinant cloning vector DBN01R-T that contains known array.Positive colony is carried out to sequence verification, and result shows that the known array inserted in recombinant cloning vector DBN01R-T is the nucleotide sequence shown in SEQ ID NO:12 in sequence table, and known array correctly inserts.
Method according to the recombinant expression vector DBN100091 that in second embodiment of the invention, 2 described structures contain the PIC9 nucleotide sequence, utilize known array to build the recombinant expression vector DBN100091R that contains known array, it builds flow process (carrier framework: pCAMBIA2301(CAMBIA mechanism can provide) as shown in Figure 3; Kan: kanamycin gene; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:9); MR: known array (SEQ ID NO:12); Nos: the terminator of rouge alkali synthetase (SEQ ID NO:10); PMI: Phophomannose isomerase gene (SEQ ID NO:11); LB: left margin).Positive colony is carried out to sequence verification, and result shows that the known array inserted in recombinant expression vector DBN100091R is the nucleotide sequence shown in SEQ ID NO:12 in sequence table, and known array correctly inserts.
4, recombinant expression vector transforms Agrobacterium
To oneself through building correct recombinant expression vector DBN100091, DBN100091-i, DBN100091-d, DBN100091-a, DBN100091-h and DBN100091R(known array) be transformed into Agrobacterium LBA4404 (Invitrgen by the liquid nitrogen method, Chicago, USA, Cat.No:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in the LB test tube in 28 ℃ of temperature, rotating speed is to cultivate 2 hours under the 200rpm condition, be applied to containing on the LB flat board of the kantlex (Kanamycin) of the Rifampin (Rifampicin) of 50mg/L and 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to the picking mono-clonal, carry out enzyme after cutting with restriction enzyme EcoRI and BglII enzyme and cut checking, result shows recombinant expression vector DBN100091, DBN100091-i, DBN100091-d, DBN100091-a, DBN100091-h and DBN100091R(known array) structure is entirely true.
The 3rd embodiment, proceed to acquisition and the checking of the milpa of PIC9 nucleotide sequence
1, obtain the milpa that proceeds to the PIC9 nucleotide sequence
The Agrobacterium infestation method adopted according to routine, combine 31(Z31 by the corn variety of sterile culture) rataria and the second embodiment in 4 described Agrobacteriums cultivate altogether, with the recombinant expression vector DBN100091 by 2 and 3 structures in the second embodiment, DBN100091-i, DBN100091-d, DBN100091-a, DBN100091-h and DBN100091R(known array) in T-DNA(comprise the promoter sequence of corn Ubiquitin gene, the PIC9 nucleotide sequence, PIC9 substituted nucleosides acid sequence, PIC9 lacks nucleotide sequence, PIC9 adds nucleotide sequence, the PIC9-Ab nucleotide sequence, known array, PMI gene and Nos terminator sequence) be transferred in the maize chromosome group, obtained the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the milpa and the milpa (positive control) that proceeds to known array of PIC9-Ab nucleotide sequence, using the wild-type milpa as negative contrast simultaneously.
For agriculture bacillus mediated corn, transform, briefly, separate immature rataria from corn, contact rataria with agrobacterium suspension, wherein Agrobacterium can be passed to the PIC9 nucleotide sequence at least one cell (step 1: infect step) of one of rataria, and described promotor operationally is connected with the PIC9 nucleotide sequence.In this step, rataria preferably immerses agrobacterium suspension (OD
660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, optionally " recovery " step can be arranged.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses the Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent microbiotic being arranged but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the rataria of inoculation is containing on the substratum of selective agent (seminose) transformed calli (step 4: select step) of cultivating and selecting growing.Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) the upper cultivation, cause the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.
The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation under 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, be cultured to about 10cm under 25 ℃ high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day under 28 ℃, then cultivate 8 hours under 20 ℃.
2, proceed to the milpa of PIC9 nucleotide sequence with the TaqMan checking
Get respectively the milpa, the milpa that proceeds to PIC9 substituted nucleosides acid sequence that proceed to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, the about 100mg of blade of milpa that proceeds to milpa that PIC9 adds nucleotide sequence, proceed to the milpa of PIC9-Ab nucleotide sequence and proceed to known array as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, detect the copy number of PIC9 gene by the Taqman fluorescence probe quantitative PCR method.Using the wild-type milpa as negative contrast, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.
The concrete grammar that detects the PIC9 gene copy number is as follows:
Step 11, get the milpa, the milpa that proceeds to PIC9 substituted nucleosides acid sequence that proceed to the PIC9 nucleotide sequence respectively, proceed to PIC9 disappearance nucleotide sequence milpa, proceed to each 100mg of blade that PIC9 adds milpa, the milpa that proceeds to the PIC9-Ab nucleotide sequence, the milpa that proceeds to known array and the wild-type milpa of nucleotide sequence, be ground into homogenate with liquid nitrogen respectively in mortar, each sample is got 3 repetitions;
The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, with NanoDrop 2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;
Step 14, adjust above-mentioned sample genomic dna concentration to the same concentration value, the scope of described concentration value is 80-100ng/ μ l;
Step 15, adopt the Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying the known copy number as standard substance, using the sample of wild-type milpa as negative contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Following primer and probe are used for detecting PIC9 nucleotide sequence, PIC9 substituted nucleosides acid sequence, PIC9 disappearance nucleotide sequence, PIC9 interpolation nucleotide sequence and PIC9-Ab nucleotide sequence:
Primer 1(CF1): ATCGTGAACAACCAGAACCAGTG is as shown in SEQ ID NO:13 in sequence table;
Primer 2 (CR1): CTCCAGGATCTCGATCTCCG is as shown in SEQ ID NO:14 in sequence table;
Probe 1(CP1): CGTGCCGTACAACTGCCTGAACAACC is as shown in SEQ ID NO:15 in sequence table;
Following primer and probe are used for detecting known array:
Primer 3(CF2): CGACTATGCTGTTCGCTGGTAC is as shown in SEQ ID NO:16 in sequence table;
Primer 4(CR2): GTTGTACCTGACCCAATCACGAG is as shown in SEQ ID NO:17 in sequence table;
Probe 2(CP2): CGGTCCCCAAACACGTTCGAGTCC is as shown in SEQ ID NO:18 in sequence table;
The PCR reaction system is:
Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l 1 * TE damping fluids, and, at 4 ℃, be housed in the amber test tube.
The PCR reaction conditions is:
Utilize SDS2. 3 softwares (Applied Biosystems) analytical data.
Experimental result shows, the PIC9 nucleotide sequence, PIC9 substituted nucleosides acid sequence, PIC9 lacks nucleotide sequence, PIC9 adds nucleotide sequence, all oneself is incorporated in the genome of detected milpa for PIC9-Ab nucleotide sequence and known array, and proceed to the milpa of PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, the milpa that proceeds to the PIC9-Ab nucleotide sequence has all obtained with the milpa that proceeds to known array the transgenic corn plant that contains single copy PIC9 gene and known array.
The insect-killing protein of the 4th embodiment, transgenic corn plant detects
1, the content detection of the insect-killing protein of transgenic corn plant (PIC9 albumen)
The solution related in this experiment is as follows:
Extraction damping fluid: 8g/L NaCl, 0.2g/L KH
2pO
4, 2.9g/L Na
2hPO
412H
2o, 0.2g/L KCl, 5.5ml/L polysorbas20 (Tween-20), pH 7.4;
Lavation buffer solution PBST:8g/L NaCl, 0.2g/L KH
2pO
4, 2.9g/L Na
2hPO
412H
2o, 0.2g/L KCl, 0.5ml/L polysorbas20 (Tween-20), pH 7.4;
Stop buffer: 1M HCl.
Get respectively 3mg and proceed to the milpa of PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the fresh blade of the milpa of PIC9-Ab nucleotide sequence and the milpa (positive control) that proceeds to known array as sample, add the described extraction damping fluid of 800 μ l after liquid nitrogen grinding, centrifugal 10min under the rotating speed of 4000rpm, get 40 times of described extraction damping fluid dilutions for supernatant liquor, the supernatant liquor of getting after 80 μ l dilute detects for ELISA.In view of the 651st to 699 of the aminoacid sequences of described PIC9-Ab come from Cry1Ab, and (the 300th to 500) also have higher consistence with Cry1Ab at the Domain of described PIC9 aminoacid sequence II place, make the antibody of Cry1Ab can be used for detecting described PIC9 and described PIC9-Ab insect-killing protein.Use the ELISA(enzyme-linked immunosorbent assay) test kit (ENVIRLOGIX company, the Cry1Ab/Cry1Ac test kit) insect-killing protein in sample (PIC9 albumen) is measured to the ratio that accounts for fresh weight and detect analysis, concrete grammar is with reference to its product description.
Using wild-type milpa and be accredited as not genetically modified milpa as negative contrast through quantitative fluorescent PCR simultaneously, detect according to the method described above analysis.Proceed to the totally 10 strain transformation events (being event) of PIC9 nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 substituted nucleosides acid sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 disappearance nucleotide sequence, proceed to the totally 10 strain transformation events (being event) that PIC9 adds nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9-Ab nucleotide sequence, proceed to the totally 5 strain transformation events (being event) of known array, be accredited as not genetically modified (NGM) totally 3 strains through quantitative fluorescent PCR, (CK) of wild-type totally 3 strains, every strain repeats 3 times.
The experimental result of the insect-killing protein of transgenic corn plant (PIC9 albumen) content is as shown in table 1.Record respectively the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the milpa of PIC9-Ab nucleotide sequence, proceed to the milpa of known array, wild-type milpa and be accredited as through quantitative fluorescent PCR the ratio (ng/g) that insecticidal proteins (PIC9 albumen) average expression amount in the fresh blade of not genetically modified milpa accounts for fresh weight and be respectively 5408.52, 5300.82, 4965.27, 5373.85, 5430.44, 2600.72, 0 and 0.
The PIC9 protein expression flow measurement average result of table 1, transgenic corn plant
The above results shows, proceeding to the ratio (ng/g) that insecticidal proteins average expression amount in the milpa of known array accounts for fresh weight is 2600.72, and proceed to the ratio (ng/g) that insecticidal proteins average expression amount in the milpa of PIC9 nucleotide sequence accounts for fresh weight, be 5408.52, for the former 2 times, this result shows that insect-killing protein of the present invention has stability preferably in corn, and codon optimized PIC9 nucleotide sequence has increased the expression amount of PIC9 albumen in corn significantly according to the preference of corn.Simultaneously, the PIC9-Ab albumen proceeded in the milpa of PIC9-Ab nucleotide sequence also has higher expression amount.In addition, with comparing of the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, the expression amount that proceeds to the milpa of PIC9 disappearance nucleotide sequence and proceed to PIC9 albumen in the milpa that PIC9 adds nucleotide sequence without significant difference.
2, the pest-resistant effect detection of transgenic corn plant
By proceed to the PIC9 nucleotide sequence milpa, proceed to PIC9 substituted nucleosides acid sequence milpa, proceed to PIC9 disappearance nucleotide sequence milpa, proceed to PIC9 and add milpa, the milpa that proceeds to the PIC9-Ab nucleotide sequence, the milpa that proceeds to known array, the wild-type milpa of nucleotide sequence and be accredited as not genetically modified milpa through quantitative fluorescent PCR and respectively Ostrinia furnacalis, bollworm and east armyworm are carried out to pest-resistant effect detection.
(1) Ostrinia furnacalis: get respectively the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the milpa of PIC9-Ab nucleotide sequence, proceed to the milpa of known array, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm * 2cm simultaneously, getting 1 strip blade after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the Ostrinia furnacalis (newly hatched larvae) that 10 tribal chief's works are raised in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 70%-80%, place after 3-5 days and add up the larva death condition under the condition of photoperiod (light/dark) 16:8, calculate the average mortality of each continent, sample Central Asia Pyrausta nubilalis (Hubern)..Proceed to the totally 10 strain transformation events (being event) of PIC9 nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 substituted nucleosides acid sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 disappearance nucleotide sequence, proceed to the totally 10 strain transformation events (being event) that PIC9 adds nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9-Ab nucleotide sequence, proceed to the totally 5 strain transformation events (being event) of known array, be accredited as not genetically modified (NGM) totally 3 strains through quantitative fluorescent PCR, (CK) of wild-type totally 3 strains, every strain repeats 3 times.Result is as shown in table 2 and Fig. 4.
The pest-resistant experimental result of table 2, transgenic corn plant inoculation Ostrinia furnacalis
Result shows: proceed to the PIC9 nucleotide sequence milpa, proceed to the milpa of PIC9-Ab nucleotide sequence and proceed in the milpa of known array and all can choose the plant that Ostrinia furnacalis is there is to certain resistance, but the examination worm mortality ratio that proceeds to the milpa of PIC9 nucleotide sequence and proceed to the milpa of PIC9-Ab nucleotide sequence is significantly higher than the milpa that proceeds to known array.Proceed to the examination worm mortality ratio of the milpa of PIC9 nucleotide sequence and the milpa that proceeds to the PIC9-Ab nucleotide sequence all more than 90%; And the examination worm mortality ratio of milpa that proceeds to known array is in 70% left and right.
(2) bollworm: get respectively the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the milpa of PIC9-Ab nucleotide sequence, proceed to the milpa of known array, the wild-type milpa and through quantitative fluorescent PCR be accredited as not genetically modified milpa the tender filigree of children, then 20-30 root filigree is put on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the bollworm (newly hatched larvae) that 10 tribal chief's works are raised in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 80%-90%, place after 3-5 days and add up the larva death condition under the condition of photoperiod (light/dark) 14:10, carry out the calculating of resistance total points according to larvae development progress and two indexs of mortality ratio: total points=100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum).Proceed to the totally 10 strain transformation events (being event) of PIC9 nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 substituted nucleosides acid sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 disappearance nucleotide sequence, proceed to the totally 10 strain transformation events (being event) that PIC9 adds nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9-Ab nucleotide sequence, proceed to the totally 5 strain transformation events (being event) of known array, be accredited as not genetically modified (NGM) totally 3 strains through quantitative fluorescent PCR, (CK) of wild-type totally 3 strains, every strain repeats 3 times.Result is as shown in table 3.
Result shows, proceed to the PIC9 nucleotide sequence milpa, proceed to the milpa of PIC9-Ab nucleotide sequence and proceed in the milpa of known array and all can choose the plant that bollworm is there is to certain resistance, but the giving birth to of milpa that proceeds to the milpa of PIC9 nucleotide sequence and proceed to the PIC9-Ab nucleotide sequence surveyed total points and is significantly higher than the milpa that proceeds to known array.Proceed to giving birth to of the milpa of PIC9 nucleotide sequence and the milpa that proceeds to the PIC9-Ab nucleotide sequence and survey total points all about 75 minutes; And the giving birth to of milpa that proceeds to known array surveyed total points generally about 40 minutes.Although this result also illustrates the milpa that proceeds to the PIC9 nucleotide sequence and the milpa that proceeds to the PIC9-Ab nucleotide sequence and can not cause the mortality of newly hatched larvae, but but the larvae development progress is caused to very big inhibition, after 3-5 days, larva is substantially still in just incubating state or between just incubate-negative control state.
The pest-resistant experimental result of table 3, transgenic corn plant inoculation bollworm
(3) east armyworm: get respectively the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, proceed to the milpa of PIC9 disappearance nucleotide sequence, proceed to the milpa that PIC9 adds nucleotide sequence, proceed to the milpa of PIC9-Ab nucleotide sequence, proceed to the milpa of known array, wild-type milpa and be accredited as the fresh blade of not genetically modified milpa through quantitative fluorescent PCR, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed to vein, be cut into the strip of about 1cm * 2cm simultaneously, getting 3 strip blades after cutting puts on the filter paper of round plastic culture dish bottom, described filter paper is wetting with distilled water, put the east armyworm (newly hatched larvae) that 10 tribal chief's works are raised in each culture dish, after worm examination culture dish is added a cover, at temperature 26-28 ℃, relative humidity 80%-90%, under the condition of photoperiod (light/dark) 14:10, place after 3-5 days, according to east armyworm larvae development progress, three indexs of mortality ratio and blade injury rate, obtain the resistance total points: total points=100 * mortality ratio+90 * (just incubate borer population/connect worm sum)+60 * (just incubate-negative control borer population/connect worm sum)+10 * (negative control borer population/connect worm sum)+100 * (1-blade injury rate).Proceed to the totally 10 strain transformation events (being event) of PIC9 nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 substituted nucleosides acid sequence, proceed to the totally 10 strain transformation events (being event) of PIC9 disappearance nucleotide sequence, proceed to the totally 10 strain transformation events (being event) that PIC9 adds nucleotide sequence, proceed to the totally 10 strain transformation events (being event) of PIC9-Ab nucleotide sequence, proceed to the totally 5 strain transformation events (being event) of known array, be accredited as not genetically modified (NGM) totally 3 strains through quantitative fluorescent PCR, (CK) of wild-type totally 3 strains, every strain repeats 3 times.Result is as shown in table 4 and Fig. 5.
The pest-resistant experimental result of table 4, transgenic corn plant inoculation east armyworm
Result shows, proceed to the PIC9 nucleotide sequence milpa, proceed to the milpa of PIC9-Ab nucleotide sequence and proceed in the milpa of known array and all can choose the plant that the east armyworm is there is to certain resistance, but the giving birth to of milpa that proceeds to the milpa of PIC9 nucleotide sequence and proceed to the PIC9-Ab nucleotide sequence surveyed total points and is significantly higher than the milpa that proceeds to known array.Proceed to giving birth to of the milpa of PIC9 nucleotide sequence and the milpa that proceeds to the PIC9-Ab nucleotide sequence and survey total points all more than 150 minutes; And the giving birth to of milpa that proceeds to known array surveyed total points about 90 minutes.Although this result also illustrates the milpa that proceeds to the PIC9 nucleotide sequence and the milpa that proceeds to the PIC9-Ab nucleotide sequence and can not cause the mortality of newly hatched larvae, but but the larvae development progress is caused to very big inhibition, after 3-5 days, larva is substantially still in just incubating state or between just incubate-negative control state, and its blade injury rate is below 30%.
The milpa that proves thus the PIC9 nucleotide sequence that proceeds to optimization has higher insect resistance capacity with the milpa that proceeds to the PIC9-Ab nucleotide sequence, the milpa of expressing the milpa that proceeds to the PIC9 nucleotide sequence that the PIC9 protein level is high and proceeding to the PIC9-Ab nucleotide sequence all has higher virulence, and therefore according to the preference of corn, codon optimized PIC9 nucleotide sequence and PIC9-Ab nucleotide sequence have increased the virulence that PIC9 albumen and PIC9-Ab albumen are expressed in corn significantly.In addition, with comparing of the milpa that proceeds to the PIC9 nucleotide sequence, proceed to the milpa of PIC9 substituted nucleosides acid sequence, the virulence that proceeds to the milpa of PIC9 disappearance nucleotide sequence and proceed to PIC9 albumen in the milpa that PIC9 adds nucleotide sequence without significant difference.
In sum, killing gene of the present invention adopts the preference codon of corn, the characteristic that meets corn gene fully, make killing gene of the present invention be particularly suitable for expressing in monocotyledons, especially corn, not only expression amount is high and good stability for PIC9 insecticidal proteins of the present invention, and strong to the virulence of insect pest, especially the lepidopterous insects insect.
It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although with reference to preferred embodiment, the present invention is had been described in detail, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not break away from the spirit and scope of technical solution of the present invention.
Claims (16)
1. an insect-killing protein, is characterized in that, as:
(a) protein that the 1-640 amino acids sequence shown in SEQ ID NO:2 forms; Or
(b) protein that the aminoacid sequence shown in SEQ ID NO:2 forms; Or
(c) the nucleotide sequence coded protein shown in SEQ ID NO:6; Or
(d) the nucleotide sequence coded protein shown in SEQ ID NO:8.
2. a killing gene, is characterized in that, as the nucleotide sequence of insect-killing protein as described in coding claim 1.
3. killing gene according to claim 2, is characterized in that, described killing gene is the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:6, SEQ ID NO:7 or SEQ ID NO:8.
4. an expression cassette, is characterized in that, is included in the described killing gene of claim 2 or 3 under the regulating and controlling sequence regulation and control of effective connection.
5. a recombinant vectors that comprises claim 2 or 3 described killing genes.
6. a method that produces insect-killing protein, is characterized in that, comprising:
The cell of the transformed host biology that acquisition comprises claim 2 or 3 described killing genes;
Cultivate the cell of described transformed host biology under the condition that allows the generation insect-killing protein;
Reclaim described insect-killing protein.
7. produce according to claim 6 the method for insect-killing protein, it is characterized in that, described transformed host biology comprises plant, animal, bacterium, yeast, nematode or algae.
8. produce according to claim 7 the method for insect-killing protein, it is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.
9. the method for increasing insect target scope, is characterized in that, comprising: the described expression cassette of claim 4 is being expressed in plant together with at least one the second insect-killing protein of insect-killing protein that is different from the described expression cassette of claim 4 coding.
10. according to claim 9 for increasing the method for insect target scope, it is characterized in that, described the second insect-killing protein is Vip class insect-killing protein, lectin, α-amylase or peroxidase.
11. a method that produces zoophobous, is characterized in that, comprising: the described killing gene of claim 2 or 3 is imported to plant.
12. the method according to the described generation zoophobous of claim 11, is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.
13. the method for a damage of avoiding being caused by insect pest for the protection of plant; it is characterized in that; comprise: the described killing gene of claim 2 or 3 is imported to plant, and the plant after making to import produces enough protections, and it avoids the insect-killing protein of insect pest infringement amount.
14. the method according to the described damage of avoiding being caused by insect pest for the protection of plant of claim 13, is characterized in that, described plant is corn, soybean, cotton, paddy rice or wheat.
15. a method of controlling insect pest, is characterized in that, comprising: make insect pest and the described insect-killing protein of the claim 1 of amount of suppression or contacted by the insect repressible protein matter of the described killing gene coding of claim 2 or 3.
16. the method according to the described control insect pest of claim 15, is characterized in that, described insect pest is the lepidopterous insects insect.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210273487 CN102786584B (en) | 2012-08-02 | 2012-08-02 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210273487 CN102786584B (en) | 2012-08-02 | 2012-08-02 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102786584A CN102786584A (en) | 2012-11-21 |
| CN102786584B true CN102786584B (en) | 2013-12-18 |
Family
ID=47152188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210273487 Active CN102786584B (en) | 2012-08-02 | 2012-08-02 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102786584B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102786584B (en) * | 2012-08-02 | 2013-12-18 | 北京大北农科技集团股份有限公司 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
| CN102796183B (en) | 2012-08-02 | 2013-12-18 | 北京大北农科技集团股份有限公司 | Insecticidal protein, and coding gene and purposes thereof |
| CN103718896B (en) * | 2013-11-18 | 2016-02-10 | 北京大北农科技集团股份有限公司 | The method of Control pests |
| CN104255771B (en) * | 2014-08-27 | 2016-06-08 | 北京大北农科技集团股份有限公司 | The purposes of insecticidal proteins |
| CN106146628B (en) * | 2015-03-27 | 2019-07-09 | 中国农业科学院棉花研究所 | A kind of artificial synthesized insect resistance protein and its relevant biological material and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1031396A (en) * | 1987-06-26 | 1989-03-01 | 纳幕尔杜邦公司 | The new D N fragment of toxin-encoding in the bacillus thuringiensis subsp israelensis |
| CN1480533A (en) * | 2002-09-04 | 2004-03-10 | 华中农业大学 | Reforming composite insecticidal crystalline gene Cry2A of bacillus thuringiensis |
| CN1849397A (en) * | 2003-07-07 | 2006-10-18 | 孟山都技术有限公司 | Insecticidal proteins secreted from bacillus thuringiensis and uses therefor |
| CN102786584A (en) * | 2012-08-02 | 2012-11-21 | 北京大北农科技集团股份有限公司 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
-
2012
- 2012-08-02 CN CN 201210273487 patent/CN102786584B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1031396A (en) * | 1987-06-26 | 1989-03-01 | 纳幕尔杜邦公司 | The new D N fragment of toxin-encoding in the bacillus thuringiensis subsp israelensis |
| CN1480533A (en) * | 2002-09-04 | 2004-03-10 | 华中农业大学 | Reforming composite insecticidal crystalline gene Cry2A of bacillus thuringiensis |
| CN1849397A (en) * | 2003-07-07 | 2006-10-18 | 孟山都技术有限公司 | Insecticidal proteins secreted from bacillus thuringiensis and uses therefor |
| CN102786584A (en) * | 2012-08-02 | 2012-11-21 | 北京大北农科技集团股份有限公司 | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102786584A (en) | 2012-11-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| RU2593961C2 (en) | COMBINED APPLICATION OF PROTEINS CRY1Ca AND CRY1Fa TO CONTROL RESISTANCE OF INSECTS | |
| CN103509808B (en) | Insecticidal gene and applications thereof | |
| CN103718896B (en) | The method of Control pests | |
| CN102972426B (en) | Pest control method | |
| CN102786584B (en) | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein | |
| CN104824010A (en) | Application of insecticidal protein | |
| CN104621172A (en) | Application of insecticidal protein | |
| TW201604282A (en) | Vegetative insecticidal proteins useful for control of insect pests | |
| CN102786585B (en) | Insecticidal protein, coding gene of insecticidal protein and purpose of insecticidal protein | |
| CN103757049B (en) | Control structure body and the method thereof of insect | |
| CN102796183B (en) | Insecticidal protein, and coding gene and purposes thereof | |
| CN103739683B (en) | Insecticidal protein, and encoding gene and use thereof | |
| CN102533793B (en) | Insecticide gene and application thereof | |
| CN102796182B (en) | Insecticidal protein, as well as coding gene and application thereof | |
| CN104621171A (en) | Use of insecticidal protein | |
| CN104920425A (en) | Application of insecticidal protein | |
| CN109804832A (en) | The purposes of insecticidal proteins | |
| CN103145814B (en) | Insecticidal protein, and coding gene and use thereof | |
| CN103725704B (en) | The construct of Control pests and method thereof | |
| CN102993281B (en) | Insecticidal protein and coding gene and application thereof | |
| CN102993280B (en) | Insecticidal protein and coding gene and application thereof | |
| CN103725696B (en) | Killing gene and uses thereof | |
| CN109486852A (en) | The purposes of insecticidal proteins | |
| CN109234307A (en) | The purposes of insecticidal proteins | |
| CN109385447A (en) | The purposes of insecticidal proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee after: Beijing Dabeinong Technology Group Co., Ltd. Patentee after: BEIJING DBN BIOTECH CO., LTD. Address before: 100080 Zhongguancun street, Beijing, No. 14, layer 27, Patentee before: Beijing Dabeinong Technology Group Co., Ltd. Patentee before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200812 Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49 Patentee after: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Address before: 100080, 14, Zhongguancun Avenue, 27, Beijing, Haidian District Co-patentee before: BEIJING DABEINONG BIOTECHNOLOGY Co.,Ltd. Patentee before: BEIJING DABEINONG TECHNOLOGY GROUP Co.,Ltd. |