CN109385447A - The purposes of insecticidal proteins - Google Patents

Abstract

The present invention relates to a kind of purposes of insecticidal proteins, comprising: at least contacts loxostege sticticalis pest with Cry2Ab albumen.The present invention can kill the Cry2Ab albumen of loxostege sticticalis by generation in plant to control loxostege sticticalis pest；Compared with cultural control method, chemical prevention and control method, physical control method and biological control method that the prior art uses; the present invention prevents and treats the protection of the plant progress time of infertility, whole plant the infringement of loxostege sticticalis pest; and pollution-free, noresidue; effect stability, thoroughly, simply, conveniently, it is economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, pass through the table in plant more particularly to a kind of Cry2Ab protein It reaches to control loxostege sticticalis and cause harm the purposes of plant.

Background technique

Loxostege sticticalis Loxostege sticticalis belongs to lepidoptera pyralidae cone volume open country snout moth's larva category, is distributed mainly on east North, northwest, one band of North China, i.e. Jilin, the Inner Mongol, Heilungkiang, Ningxia, Gansu, Qinghai, Hebei, Shanxi, Shaanxi, Jiangsu etc. save. Loxostege sticticalis be polyphagy major pest, can 35 section of feeding, more than 200 plants, predominantly beet, soybean, sunflower, potato, fiber crops The various crops such as class, vegetables, medicinal material；Cereal crop, forest etc. are done harm to by it when big generation.It sends out within loxostege sticticalis general 10 years or so Life is once broken out greatly, harm characteristics are as follows: and larva, which focuses mostly on to knot on branch, hides, and feeding mesophyll leaves epidermis and vein, Severe one is only left vein or is eaten up, and yield is seriously affected.

The cultivated soybean (Glycine max (L.) Merri) is a kind of conduct vegetable oil and the vegetable protein master of grown worldwide The Important Economic crop for wanting source is the important cereal crops of China.Soybean is one of the plant that loxostege sticticalis most likes feeding, every year Because loxostege sticticalis will cause different degrees of grain loss, less serious case's underproduction 1-2 at, severe one underproduction 3-4 at.In order to prevent and treat loxostege sticticalis, The main method that people generally use has cultural control, chemical prevention, physical control and biological control.

Cultural control is the comprehensive coordination management that entire farmland ecosystem is multifactor, regulation crop, pest, environment because Element creates the farmland ecological environment for being conducive to plant growth and being unfavorable for loxostege sticticalis generation.Such as to the serious field that causes harm Crop rotation is carried out, loxostege sticticalis is made to lose host；It can repeatedly pour water in autumn, winter or florescence pours water, kill larva；It can also be in grass Ground snout moth's larva concentrates hibernacle, takes the autumn to turn over, spring ploughing method, weighs Overwintering Larvae wounded by machinery killing and soil block, increases overwintering children The worm death rate；In the heavier field in farmland running to weeds, insect prevention ditch can be dug before larva causes harm migration, sprayed in ditch powder pesticide or One of mulch is found in centre, prevents larva from moving into field and spreads crop of causing harm；When ovum has been given birth to and has not been hatched largely, in conjunction with Tillage and weeding is gone out ovum, and the weeds removed are taken out of outside field to make compost or dig pit and are buried；The weeds of cleared field side field bund are wanted simultaneously, in order to avoid Larva moves into farmland harm；In the field that larva has hatched, weeding after first going and buy Chinese medicine is had to, is turned in order to avoid accelerating larva to crops It moves and aggravates harm.

Chemical prevention, that is, chemical control is to kill pest using chemical insecticide, is the important of loxostege sticticalis comprehensive treatment Component part, it have the characteristics that quickly, conveniently, easy and high economic benefit be especially in the case where the big generation of loxostege sticticalis Essential emergency measure.Chemical prevention and control method is mainly medicine liquid spray at present, is had between loxostege sticticalis larva 1-3 age preferably Control efficiency, as polypide is bigger, drug resistance is stronger, and effect of chemical control is poorer, it will be difficult to achieve the purpose that prevention and treatment.In age Phase, biggish larva concentrated the field of harm, can be in the field surrounding ditching or laxative band envelope when effect of chemical control is bad Lock, prevention and treatment diffusion harm.Simultaneously chemical prevention also have its limitation, as improper use frequently can lead to crops occur phytotoxicity, Pest develops drug resistance, and killing natural enemy, pollution environment, makes farmland ecosystem by destruction and pesticide residue to people, animal Safety the adverse consequences such as constitute a threat to.

The physical control mainly reaction according to pest to physical factors various in environmental condition, such as using various physical factors Light, electricity, color, temperature and humidity etc. and mechanical equipment trapped and killed, the methods of steriliation by irradiation carrys out pest control.Net when adult contains hair It flutters or light trap.Migrated using loxostege sticticalis, the habit for the light that becomes, setting high-pressure sodium lamp, frequency ventilating type insecticidal lamp etc. to its adult into Row trapping；But frequency ventilating type insecticidal lamp needs daily the dirt on cleaning high-voltage fence in time, otherwise will affect insecticidal effect；And And cannot turn on light in thundery sky, operationally there are also the danger that electric shock is hurted sb.'s feelings；Furthermore the disposably investment for installing lamp is larger.

Biological control is that pest population quantity is controlled using certain beneficial organisms or biological metabolic product, is reduced with reaching Or the purpose of pest is eliminated, such as loxostege sticticalis is prevented and treated with trichogramma or muscardine.Its main feature is that people, animal safety, environmental pollution It is few, certain pests can reach with the purpose controlled for a long time；But effect is often unstable, no matter and loxostege sticticalis occur weight be both needed to Same investment carries out.

In order to solve the limitation of cultural control, chemical prevention, physical control and biological control in practical applications, science Family find for the anti insect gene of encoding insecticidal proteins to be transferred in plant after study, can get some insect-resistant transgenic plants with Prevent and treat insect pest of the plant.

Cry2Ab insecticidal proteins are one of numerous insecticidal proteins, are the insoluble companions generated by bacillus thuringiensis Spore crystalline protein.Cry2Ab albumen uptakes into middle intestines by insect, and toxalbumin parent toxin is dissolved in the alkaline pH of insect midgut Under environment.The end albumen N- and C- is transformed into active fragment by basic protein enzymic digestion, by parent toxin；In active fragment and insect Receptor combines on intestinal epithelial cell membrane upper surface, is inserted into goldbeater's skin, causes cell membrane perforation symptom occur, destroys inside and outside cell membrane Osmotic pressure variation and pH balance etc., upset the digestion process of insect, eventually lead to its death.

The plant for being proved to turn Cry2Ab gene can resist the Lepidopteras such as corn borer, chilotraea infuscatellus (Lepidoptera) evil The infringement of worm controls loxostege sticticalis to plant about by the transgenic plant for generating expression Cry2Ab albumen however, there is no so far The report that object is caused harm.

Summary of the invention

The object of the present invention is to provide a kind of purposes of insecticidal proteins, provide express Cry2Ab albumen by generating for the first time Transgenic plant control loxostege sticticalis to the method for plant hazard, and effectively overcome prior art cultural control, chemical prevention, The technological deficiencies such as physical control and biological control.

To achieve the above object, the present invention provides a kind of methods for controlling loxostege sticticalis pest, including by loxostege sticticalis pest At least contacted with Cry2Ab albumen.

Further, the Cry2Ab albumen is present in the host cell at least generating the Cry2Ab albumen, described Loxostege sticticalis pest is at least contacted with the Cry2Ab albumen by the host cell of ingesting.

Further, the Cry2Ab albumen is present in the bacterium at least generating the Cry2Ab albumen or transgenosis is planted In object, the loxostege sticticalis pest is at least connect with the Cry2Ab albumen by the tissue of the ingest bacterium or genetically modified plants Touching, the loxostege sticticalis pest growth is suppressed and/or causes death after contact, to realize the control for endangering loxostege sticticalis plant System.

The tissue of the genetically modified plants is root, blade, stalk, fruit, tassel, female fringe, anther or filigree.

The plant is soybean, Chenopodium album, beet, sunflower, potato, crudefiber crop and corn.

The genetically modified plants may be at any breeding time.

The control for endangering plant to loxostege sticticalis does not change because of the change of planting site and/or implantation time.

The step of before the contact procedure, contains the plant for encoding the polynucleotides of the Cry2Ab albumen for plantation.

Preferably, the Cry2Ab albumen has amino acid sequence shown in SEQ ID NO:1.

It is highly preferred that the Cry2Ab albumen has nucleotide sequence shown in SEQ ID NO:2.

Based on the above technical solution, the plant can also include at least one different from encoding the Cry2Ab Second of nucleotide of the nucleotide of albumen.

Further, second of nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease suppression Preparation, agglutinin, alpha-amylase or peroxidase.

In the present invention, a kind of expression of the Cry2Ab albumen in genetically modified plants can be along with one or more Cry The expression of class insect-killing protein and/or Vip class insect-killing protein.This is more than that a kind of Pesticidal toxins are planted in same strain transgenosis Co-expressing in object can make plant include and express required gene to realize by genetic engineering.In addition, a kind of plant ( 1 parent) Cry2Ab protein can be expressed by genetic engineering procedure, second of plant (the 2nd parent) can pass through hereditary work Journey operation expression Cry class insect-killing protein and/or Vip class insect-killing protein.Table is obtained by the 1st parent and the 2nd parents Up to the progeny plants for all genes for introducing the 1st parent and the 2nd parent.

Preferably, second of nucleotide coding Vip3A albumen, Cry1A albumen or Cry1F albumen.

It is highly preferred that second of nucleotide coding has amino acid shown in SEQ ID NO:3 or SEQ ID NO:5 Sequence.Second of the nucleotide has nucleotide sequence shown in SEQ ID NO:4 or SEQ ID NO:6.

Selectively, second of the nucleotide is the dsRNA for inhibiting important gene in target insect pests.

To achieve the above object, the present invention also provides a kind of purposes of Cry2Ab protein control loxostege sticticalis pest.

The present invention also provides a kind of methods of plant for generating control loxostege sticticalis pest, including the gene to the plant The polynucleotide sequence of coding Cry2Ab albumen is introduced in group.

The present invention also provides a kind of methods of propagulum for generating control loxostege sticticalis pest, including will be by the side The first plant that method obtains hybridize with the second plant, and/or removes on the plant by the method acquisition and have fertility Tissue is cultivated, to generate the propagulum of the polynucleotide sequence containing coding Cry2Ab albumen.

The present invention also provides a kind of methods of the plant of culture control loxostege sticticalis pest, comprising:

At least one propagulum is planted, includes the more of coding Cry2Ab albumen in the genome of the propagulum Nucleotide sequence；

The propagulum is set to grow up to plant；

Keep the plant raw under conditions of artificial infection loxostege sticticalis pest and/or loxostege sticticalis pest naturally-occurring endanger Long, harvesting has the plant injury weakened compared with the plant of other polynucleotide sequences for not having coding Cry2Ab albumen And/or the plant with increased plant products.

Heretofore described " propagulum " includes but is not limited to plant tannins and plant vegetative propagule. The plant tannins include but is not limited to vegetable seeds；The plant vegetative propagule refers to the nutrition organs of plant Or certain particular tissues, new plant can be generated in vitro；The nutrition organs or certain particular tissues include but It is not limited to root, stem and leaf, such as: it include strawberry and sweet potato etc. by the plant of vegetative propagule of root；Using stem as vegetative propagule Plant include sugarcane and potato (stem tuber) etc.；It include aloe and begonia etc. by the plant of vegetative propagule of leaf.

Heretofore described " contact ", which refers to, touches, stops and/or ingests, and specially insect and/or pest touch, stop It stays and/or feeding plant, plant organ, plant tissue or plant cell, the plant, plant organ, plant tissue or plant Cell can also be the plant, plant organ, plant tissue or plant cell either its internal expression insecticidal proteins Surface is with insecticidal proteins and/or with the microorganism for generating insecticidal proteins.

" control " and/or " prevention and treatment " of the present invention refer to that loxostege sticticalis pest at least contacts with Cry2Ab albumen, contact Loxostege sticticalis pest growth afterwards is suppressed and/or causes death.Further, loxostege sticticalis pest passes through feeding plant tissue at least It is contacted with Cry2Ab albumen, all or part of loxostege sticticalis pest growth is suppressed and/or causes death after contact.Inhibition refers to Sub- lethal, i.e., not yet lethal but certain effect that can cause growth and development, behavior, physiology, biochemistry and tissue etc. is such as grown Development is slow and/or stops.Meanwhile plant should be morphologically normal, and can cultivate under conventional approaches for product Consumption and/or generation.In addition, the plant of the control loxostege sticticalis pest of the polynucleotide sequence containing coding Cry2Ab albumen And/or propagulum, it is and non-under conditions of artificial infection loxostege sticticalis pest and/or loxostege sticticalis pest naturally-occurring endanger The WT lines of transgenosis, which are compared, has the plant injury weakened, the including but not limited to improved blade resistance of specific manifestation, And/or the kernel weight improved, and/or volume increase etc..Cry2Ab albumen is to " control " and/or " prevention and treatment " effect of loxostege sticticalis can With self-existent, specifically, any tissue of genetically modified plants (polynucleotide sequence containing coding Cry2Ab albumen) is same When and/or asynchronously, exist and/or generate, another substance of Cry2Ab albumen and/or controllable loxostege sticticalis pest, then The presence of the another kind substance neither influences Cry2Ab and acts on " control " and/or " prevention and treatment " of loxostege sticticalis, can not cause " control " and/or " prevention and treatment " effect is completely and/or part is realized by another substance, and with Cry2Ab albumen without It closes.Under normal conditions, in crop field, the process of loxostege sticticalis pest feeding plant tissue is of short duration and is difficult to observe with the naked eye, therefore, Under conditions of artificial infection loxostege sticticalis pest and/or loxostege sticticalis pest naturally-occurring endanger, as genetically modified plants (contain coding The polynucleotide sequence of Cry2Ab albumen) any tissue there is dead loxostege sticticalis pest, and/or stop on it growth by There is to the loxostege sticticalis pest of inhibition, and/or compared with non-transgenic WT lines the plant injury weakened, as realize Method and/or purposes of the invention at least contact by loxostege sticticalis pest with Cry2Ab albumen to realize and control loxostege sticticalis The method and/or purposes of pest.

RNA interference (RNA interference, RNAi) refer to it is being highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, homologous mRNA efficient selective degradation the phenomenon that.Therefore in the present invention RNAi technology specific depletion can be used or close the expression of specific gene in target insect pests, especially and targeted insect The relevant gene of pest growth and development.

The adult of loxostege sticticalis is filbert, the long 8-10mm of body, fore wing taupe, and outer rim has faint yellow striped, and wing center is nearby Edge has a deep yellow color spot, and leading edge has a light yellow stigma of unconspicuous triangle on the inside of apex angle, hind wing ecru, have two with it is outer The parallel ripple mark of edge.Ovum is oval, long 0.8-1.2mm, is that 3,5 or 7,8 string-like stick into imbricate pieces of an egg.Larva Totally 5 age, mature larva 16-25mm, 1 age light green, there are many dun pigment figures for body back；There are light color longitudinal bands on 3 age celadon, side, There is verruca on the whole body；5 ages were mostly grey black, and there are foresythia lines in two sides.The long 14-20mm of pupa, back, which is respectively saved, has 14 russet small Point, is arranged in two sides, and anal spine 8.

Loxostege sticticalis is distributed in the northern area of China, 1 year generation 2-4 generation, and adult power of circling in the air is weak, is fond of nectar, ovum, which dissipates, to be originated in Blade back master pulse two sides, normal 3-4 together, with most on the cauline leaf away from ground 2-8cm.Newly hatched larvae focuses mostly on and ties on branch Net is hidden, feeding mesophyll, and appetite increases severely after 3 ages, larvae underwent 5 instars.Loxostege sticticalis spun in soil with mature larva spin it is overwintering.More Winter larva gos up with temperature as sunshine increases in the next spring, starts to pupate, and generally enters emergence down toward early June in May and contains Phase.After adult eclosion, spot is moved to from wintering ground, after spot breeding 1-2 generation, then moves to wintering ground, oviposition breeding is arrived Mature larva buries overwintering.

In categorizing system, generally mainly according to morphological features such as the types of the nervuration of adult wing, linkage mode and feeler, Lepidoptera is divided into suborder, Superfamily, section etc..And Pyralidae is one of the section of most species in Lepidoptera, the whole world has found 10,000 Kind or more, only China's record just has thousands of.Most of Pyralidae insect is the pest of crops, most to be in the form of stem to eat into Evil, such as striped rice borer and corn borer.Although corn borer and loxostege sticticalis belong to lepidoptera pyralidae, in addition to existing in classification standard Then there is huge difference on other morphosis in similitude；(rose is belonged to as apple like the strawberry in plant Mesh rosaceae), they have colored both sexes, radiation symmetric, the features such as 5, petal, but its fruit and plant forms are thousand Poor ten thousand are not.But because of the less contact insect of people, especially less contact agricultural pests, for the less pass of difference on Morphology of entomology Note, and people is made to think that the form of insect is similar.And in fact, loxostege sticticalis is either from Larva Morpho. Logy or adult shape From the point of view of in state, all there is its unique feature.

Belonging to the insect of Pyralidae, not only there are larger differences in morphological feature, while on feeding habit, there is also Difference.Such as be all that the corn borer of Pyralidae is mainly caused harm corn gramineous, other broadleaf class crops of seldom causing harm.And meadow Snout moth's larva likes the plants such as feeding Chenopodium album, beet and soybean, just cause harm when occurring greatly cereal crop, forest etc..The difference of feeding habit, Also imply enzyme caused by internal digestive system and receptor protein difference.And the enzyme generated in alimentary canal is that Bt gene works Key point, the enzyme or receptor protein that can only combine with specific b t gene be possible to so that some Bt gene pairs The pest has insect resistant effect.More and more researches show that not equal with mesh, even equal insect not of the same race is to Bt of the same race The sensitive sex expression of albumen is different.Such as the striped rice borer Chilo suppressalis and Asia jade of Vip3Aa gene pairs Pyralidae Rice snout moth's larva Ostrinia furnacalis shows anti-insect activity, but Vip3Aa gene is for belonging to India of Pyralidae Paddy snout moth's larva Plodia interpunctella and European corn borer Ostrinia nubilalis are but without insect resistant effect.It is above-mentioned several Kind pest belongs to lepidoptera pyralidae, but Bt albumen of the same race shows different resistance effects to these types of Pyralidae pest. Especially European corn borer and Ostrinia furnacalis belong to and (belonging to mesh is equal) in the upper Pyralidae Ostrinia that even belongs to of classification, But its be to the reaction of Bt albumen of the same race it is completely different, more absolutely proved enzyme and receptor in Bt albumen and insect bodies Interaction mode be complicated and be difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and including nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotide form complete " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that polynucleotides and/or nucleotide of the invention can be placed in Under regulating and controlling sequence control in purpose host.

Well-known to those skilled in the art, DNA typically exists with double-stranded form.In this arrangement, chain with Another chain complementation, vice versa.Other complementary strands of DNA are produced since DNA is replicated in plant.In this way, packet of the present invention Include the use to polynucleotides exemplary in sequence table and its complementary strand." coding strand " that this field is often used refers to be chained with antisense The chain of conjunction.In order to express protein in vivo, a chain of DNA is transcribed into the complementary strand of a mRNA by typical case, it is as mould Plate translates protein.MRNA is actually to transcribe from " antisense " chain of DNA." ariyoshi " or " coding " chain has a series of passwords Son (codon is three nucleotide, and primary reading three can produce specific amino acids), can be used as open reading frame (ORF) and reads It reads to form target protein or peptide.The invention also includes the RNA for having suitable function with exemplary DNA.

Nucleic acid molecule of the present invention or its segment under strict conditions with Cry2Ab gene recombination of the present invention.It is any conventional Nucleic acid hybridization or amplification method may be used to identify the presence of Cry2Ab gene of the present invention.Nucleic acid molecules or its segment are certain In the case of can with other nucleic acid molecules carry out specific hybrid.In the present invention, if two nucleic acid molecules can be formed it is antiparallel Double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out specific hybrid to each other.If two nucleic acid point Son shows complete complementarity, then claiming one of nucleic acid molecules is another nucleic acid molecules " complement ".In the present invention, When each nucleotide and the corresponding nucleotide mutual added time of another nucleic acid molecules of a nucleic acid molecules, then claim the two cores Acid molecule shows " complete complementarity ".If two nucleic acid molecules can be with enough stability phase mutual crosses to make them It anneals and is bonded to each other under the conditions of at least conventional " low stringent ", then the two nucleic acid molecules are referred to as that " minimum level is mutual It mends ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses to make them in conventional " height It anneals and is bonded to each other under the conditions of strictly ", then claim the two nucleic acid molecules that there is " complementarity ".Deviateing from complete complementarity is It can permit, as long as this deviation not exclusively prevents two molecules from forming duplex structure.In order to enable a nucleic acid molecules As primer or probe, it is only necessary to it is adequately complementary to guarantee that it has in sequence so that in used specific solvent and Stable duplex structure can be formed under salinity.

In the present invention, substantially homologous sequence is one section of nucleic acid molecules, which can under high stringency Specific hybrid occurs with the complementary strand of another section of nucleic acid molecules to match.Promote the suitable stringent condition of DNA hybridization, example Such as, it is about handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC), then with 2.0 × SSC under the conditions of 50 DEG C Washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected from low tight About 2.0 × SSC of glazing bar part, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.In addition, the temperature in washing step Condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature condition and salt are dense Degree can all change, can also one of them remain unchanged and another variable changes.Preferably, of the present invention Stringent condition can in 6 × SSC, 0.5%SDS solution, at 65 DEG C with SEQ ID NO:2, SEQ ID NO:4 and SEQ ID Specific hybrid occurs for NO:6, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Therefore, have anti-insect activity and under strict conditions with SEQ ID NO:2 of the present invention, SEQ ID NO:4 and SEQ The sequence of ID NO:6 hybridization is included in the invention.These sequences and sequence of the present invention at least about 40%-50% are homologous, greatly About 60%, 65% or 70% are homologous, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or bigger sequence homology.

Heretofore described gene and protein not only includes specific exemplary sequence, further include save it is described specific (including compared with full length protein and/or end lacks for the part of the insecticidal activity feature of exemplary protein and/segment Lose), variant, mutant, the substituent protein of amino acid (have substitution), chimera and fusion protein." variant " or " become It is different " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity." equivalent protein " refers to There is the albumen of the bioactivity of identical or essentially identical anti-loxostege sticticalis pest with the albumen of claim.

The original DNA or egg that " segment " or " truncation " of heretofore described DNA molecular or protein sequence refers to A part of Bai Xulie (nucleotide or amino acid) or its artificial reconstructed form (such as the sequence for being suitble to plant expression), aforementioned sequence Variation may be present in the length of column, but length is enough to ensure that (coding) protein is insect toxins.

Gene variant can be constructed with modifier and readily using standard technique.For example, it is well known that manufacture point The technology of mutation.In another example U.S. Patent number 5605793, which describes to reassembly after random fracture using DNA, generates other molecules Multifarious method.The segment of commercialization endonuclease manufacture full-length gene can be used, and can be according to standardization program Use exonuclease.It is, for example, possible to use enzyme such as Bal31 or direct mutagenesis to cut off core from the end systems of these genes Thuja acid.A variety of restriction enzymes can also be used to obtain the gene of encoding active segment.Protease can be used to directly obtain The active fragment of these toxin.

The present invention can derive equivalent protein from Bt isolate and/or DNA library and/or encode these equivalent proteins Gene.Insecticidal proteins of the invention are obtained there are many method.It is, for example, possible to use the desinsection eggs that the present invention discloses and claims White antibody is identified and isolated from other albumen from protein mixture.Particularly, antibody may be by albumen it is most constant and and its Caused by its most different protein part of Bt albumen.May then pass through immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or Western immunoblot method exclusively identifies the equivalent protein for having activity characteristic using these antibody.This field standard journey can be used Sequence readily prepares the antibody of albumen or equivalent protein disclosed in the present invention or the segment of this albuminoid.It then can be from micro- life The gene for encoding these albumen is obtained in object.

Due to the Feng Yuxing of genetic codon, a variety of different DNA sequence dnas can encode identical amino acid sequence.It generates These encode the alternative DNA sequence dna of identical or essentially identical albumen just in the technical level of those skilled in the art.This A little different DNA sequence dnas are included within the scope of the invention." substantially the same " sequence, which refers to, to be had amino acid substitution, lacks The sequence for losing, adding or being inserted into but do not influence substantially insecticidal activity also includes the segment for retaining insecticidal activity.

Replacing, missing or adding for amino acid sequence is the ordinary skill in the art in the present invention, preferably this amino acid Variation are as follows: small characteristic changing, i.e., the folding and/or active conserved amino acid for not significantly affecting albumen replace；Small missing, The missing of normally about 1-30 amino acid；Small amino or c-terminus extend, such as aminoterminal extends a methionine residues； Small link peptide, for example, about 20-25 residue are long.

The example of conservative substitution is the substitution occurred in following amino acid group: basic amino acid (such as arginine, lysine And histidine), it is acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, asparagine), hydrophobic Acidic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (such as glycine, alanine, serine, threonine and methionine).Do not change given activity usually Those amino acid substitutions are well-known in the art, and by for example, N.Neurath and R.L.Hill are 1979 It is described in " Protein " published by year new york academic publishing house (AcademicPress).The most common exchange has Ala/ Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and their opposite exchanges.

For a person skilled in the art it should be evident that this substitution can play an important role to molecular function Region except occur, and still generate active peptides.For by polypeptide of the invention, activity is required and therefore selects not Substituted amino acid residue can reflect according to methods known in the art, such as direct mutagenesis or alanine scanning mutagenesis Determine (such as referring to Cunningham and Wells, 1989, Science244:1081-1085).Latter technique is each in the molecule At a positively charged residue introduce mutation, detection gained mutating molecule anti-insect activity, so that it is determined that the molecular activity and It overstates the amino acid residue wanted.Substrate-enzyme interacting site can also be measured by the analysis of its three-dimensional structure, and this three Dimension structure can be measured by technologies such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as deVos, 1992, Science255:306-312；Smith etc., 1992, J.Mol.Biol224:899-904；Wlodaver etc., 1992, FEBSLetters309:59-64).

In the present invention, have with amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:3 or SEQ ID NO:5 Certain homology.These sequences are typically larger than 78%, preferably greater than 85% with sequence similarities of the present invention/phase same sex, more Preferably greater than 90%, even more preferably it is greater than 95%, and 99% can be greater than.It can also be according to the phase same sex particularly And/or similarity range defines preferred polynucleotides and protein of the invention.Such as have with the exemplary sequence of the present invention 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, the 98% or 99% phase same sex and/or similarity.

In the present invention, the genetically modified plants for generating the Cry2Ab albumen include but is not limited to that MON87751 transgenosis is big Beans event and/or vegetable material (as described in the CN105531376A) comprising MON87751 transgenic soybean event, MON89034 transgenic corn events and/or vegetable material comprising MON89034 transgenic corn events (such as exist Described in CN101495635B) or MON15985 transgenic cotton event and/or include MON15985 transgene cotton thing The vegetable material (as described in the CN101413028B) of part, may be implemented method and/or purposes of the invention, i.e., logical Loxostege sticticalis pest is crossed at least to contact with Cry2Ab albumen to realize the method and/or purposes that control loxostege sticticalis pest.This field skill Art personnel are understood, make the Cry2Ab albumen in above-mentioned transgenic event expressed in different plants be also able to achieve it is of the invention Method and/or purposes.More specifically, the Cry2Ab albumen is present in the genetically modified plants at least generating the Cry2Ab albumen In, the loxostege sticticalis pest is at least contacted with the Cry2Ab albumen by the tissue for the genetically modified plants that ingest, after contact The loxostege sticticalis pest growth is suppressed and/or causes death, to realize the control for endangering loxostege sticticalis plant.

Heretofore described regulating and controlling sequence include but is not limited to promoter, transit peptides, terminator, enhancer, leader sequence, Introne and other adjusting sequences for being operably connected to the Cry2Ab albumen.

The promoter is effable promoter in plant, and " the effable promoter in plant " refers to and ensure The promoter that coded sequence connected to it is expressed in plant cell.Effable promoter can be composing type in plant Promoter.The example for instructing the promoter of constitutive expression in plant includes but is not limited to, from cauliflower mosaic virus 35S promoter, arabidopsis Ubi10 promoter, corn Ubi promoter, promoter of rice GOS2 gene etc..Alternatively, plant In effable promoter can be organizing specific promoter, i.e., the promoter is in some tissues of plant such as in chlorenchyma The middle expression for instructing coded sequence is higher than its hetero-organization (can test and be measured by conventional RNA) of plant, such as PEP carboxylic Change enzyme promoters.Alternatively, effable promoter can be wound-induced promoter in plant.Wound-induced promoter or guidance When the promoter of the expression pattern of wound-induced refers to the wound caused by plant is subjected to machinery or is gnawed by insect, promoter tune The expression of coded sequence under control under the conditions of normal growth compared with being significantly increased.The example of wound-induced promoter includes but unlimited In the starting of protease suppressor (pin I and the pin II) and zein enzyme suppressor (MPI) of potato and tomato Son.

The transit peptides (also known as secretory signal sequence or targeting sequencing) are to instruct transgene product to specific organelle Or cellular compartment, for receptor protein, the transit peptides can be it is heterologous, for example, utilizing encoding chloroplast transit peptide Sequence targets chloroplaset, perhaps utilizes ' KDEL ' to retain sequence targeting endoplasmic reticulum or utilizes barley plants agglutinin gene CTPP targets vacuole.

The leader sequence is including but not limited to picornavirus leader sequence, such as EMCV leader sequence (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) leader sequence；Human immunity Globular protein heavy-chain binding protein matter (BiP)；The coat protein mRNA's of alfalfa mosaic virus does not translate leader sequence (AMV RNA4)；Tobacco mosaic virus (TMV) (TMV) leader sequence.

The enhancer is including but not limited to cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) increase Hadron, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), duck plantar Straw colour mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, the introne is including but not limited to corn hsp70 introne, corn are general Plain introne, Adh introne 1, crose synthase intron or rice Act1 introne.For dicotyledon application, institute Introne is stated including but not limited to CAT-1 introne, pKANNIBAL introne, PIV2 introne and " super ubiquitin " include Son.

The terminator can be the suitable polyadenylation signal sequence to work in plant, including but unlimited In from the Polyadenylation of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Signal sequence, derives from pea at the polyadenylation signal sequence for deriving from protease-inhibitor Ⅱ (pin II) gene The polyadenylation signal sequence of ssRUBISCO E9 gene and the poly for deriving from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " indicates the connection of nucleic acid sequence, described to be coupled so that a sequence can provide pair The function of being needed for linked sequence.Described in the present invention " effectively connection " can be by promoter and interested sequence phase Even, so that the transcription of the interested sequence is controlled and regulates and controls by the promoter.When interested sequential coding albumen and " effectively connection " indicates when going for the expression of the albumen: promoter is connected with the sequence, and connected mode to obtain Transcript efficient translation.If promoter and the connection of coded sequence are that transcript merges and wants to realize the albumen of coding Expression when, such connection is manufactured, so that the first translation initiation codon is the starting of coded sequence in obtained transcript Codon.Alternatively, if it is the table for the albumen that realization coding was merged and wanted in translation that promoter is with the connection of coded sequence Up to when, manufacture such connection so that the first translation initiation codon contained in 5 ' non-translated sequences is connected with promoter, And the relationship of the translation opening code-reading frame for the albumen that the translation product that connection type makes and coding are wanted is to meet reading Code frame.The nucleic acid sequence that " can effectively connect " includes but is not limited to: providing sequence (the i.e. gene expression of gene expression function Element, for example, promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), provide DNA transfer and/or integration function sequence (i.e. T-DNA border sequence, locus specificity recombinase Recognition site integrates enzyme recognition site), provide selectivity function sequence (i.e. antibiotic resistance markers, biosynthesis base Cause), provide can score marker function sequence, in vitro or in vivo assist series of operations sequence (i.e. polylinker sequence, site Specific recombination sites) and provide copy function sequence (the i.e. replication orgin, autonomously replicating sequence of bacterium, centromere sequence Column).

Heretofore described " desinsection " or " pest-resistant " refers to crop pests it is toxic, to realize " control " And/or " prevention and treatment " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to kill crop pests.More specifically, mesh Marking insect is loxostege sticticalis pest.

Cry2Ab albumen has toxicity to loxostege sticticalis pest in the present invention.Plant in the present invention, especially soybean, at it Contain exogenous DNA in genome, the exogenous DNA includes the nucleotide sequence of coding Cry2Ab albumen, and loxostege sticticalis pest passes through Feeding plant tissue is contacted with the albumen, and the growth of loxostege sticticalis pest is suppressed and/or causes death after contact.Inhibition refers to cause It is dead or sub- lethal.Meanwhile plant should be morphologically normal, and can cultivate under conventional approaches with the consumption for product And/or it generates.In addition, the plant can substantially eliminate needs (chemistry or the biological insecticides to chemistry or biological insecticides For the insecticide of the loxostege sticticalis pest targeted for Cry2Ab albumen).

In vegetable material the expression of insecticidal crystal protein (ICP) can by described a variety of methods in the art into Row detection, such as quantified by the mRNA of the coded insect-killing protein generated in application primer pair tissue, or directly The amount for the insect-killing protein that specific detection generates.

It can be using the insecticidal effect of ICP in different test measurement plants.Targeted insect is mainly meadow in the present invention Snout moth's larva.

In the present invention, the Cry2Ab albumen can have amino acid sequence shown in SEQ ID NO:1.In addition to comprising It also may include other elements, such as the protein of encoding selection markers outside the code area of Cry2Ab albumen.

In addition, the expression cassette comprising the nucleotide sequence for encoding Cry2Ab albumen of the present invention in plant can also at least A kind of protein of encoding herbicide resistance gene is expressed together, and the herbicide resistance gene includes but is not limited to glufosinate-ammonium Resistant gene (such as bar gene, pat gene), phenmedipham resistant gene (such as pmph gene), Glyphosate resistance gene (such as EPSPS Gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of herbicide Dalapon, to ammonia The resistant gene of the resistant gene or glutamine synthetase inhibitor (such as PPT) of nitrile, thus obtain both have high insecticidal activity, Again with the genetically modified plants of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, the gene of Cry2Ab albumen or expression cassette or recombination as described in will encode Vector introduction plant cell, conventional method for transformation include but is not limited to that Agrobacterium-medialed transformation, micro transmitting bombard, are straight It connects and DNA is taken in into the DNA importing that protoplast, electroporation or silicon whisker mediate.

The present invention provides a kind of purposes of insecticidal proteins, have the advantage that

1, internal cause prevents and treats.The prior art is mainly that the harm of loxostege sticticalis pest is controlled by external action, that is, external cause, such as Cultural control, chemical prevention, physical control and biological control；And the present invention is can to kill loxostege sticticalis by generating in plant Cry2Ab albumen control loxostege sticticalis pest, i.e., prevented and treated by internal cause.

2, pollution-free, noresidue.Although harm of the chemical prevention and control method that the prior art uses to control loxostege sticticalis pest Certain effect is played, but pollution, destruction and residual also are brought to people, animal and farmland ecosystem simultaneously；Use the present invention The method for controlling loxostege sticticalis pest, can eliminate above-mentioned adverse consequences.

3, the time of infertility prevents and treats.The method for the control loxostege sticticalis pest that the prior art uses all is interim, and this hair Bright is the protection that the time of infertility is carried out to plant, and genetically modified plants (Cry2Ab albumen) are from germination, growth, until blooming, tying Fruit can avoid the infringement by loxostege sticticalis.

4, whole plant is prevented and treated.The method for the control loxostege sticticalis pest that the prior art uses is locality mostly, such as blade face It sprays；And the present invention is protected to entire plant, such as the root, blade, stalk, fruit of genetically modified plants (Cry2Ab albumen) Reality, tassel, female fringe, anther or filigree etc. can all resist loxostege sticticalis infringement.

5, effect stability.The either cultural control method or physical control method that the prior art uses require to utilize Environmental condition prevents and treats pest, and variable factor is more；The present invention is to make Cry2Ab albumen carry out table in plant It reaches, effectively overcomes the unstable defect of environmental condition, and the control efficiency of genetically modified plants of the present invention (Cry2Ab albumen) It is also all stable and consistent in different location, different time, different genetic backgrounds.

6, simple, conveniently, it is economical.The disposably investment for the frequency ventilating type insecticidal lamp that the prior art uses is larger, and operates not When there are also the danger that electric shock is hurted sb.'s feelings；The present invention need to only plant the genetically modified plants that can express Cry2Ab albumen, without Other measures are used, to save a large amount of human and material resources and financial resources.

7, effect is thorough.The prior art use control loxostege sticticalis pest method, effect be it is halfway, only serve Mitigation effect；And genetically modified plants (Cry2Ab albumen) of the present invention can cause the mortality of loxostege sticticalis newly hatched larvae, and right Fraction survival larvae development progress causes greatly to inhibit, and genetically modified plants are generally only by slight damage.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Detailed description of the invention

Fig. 1 is the recombinant cloning vector DBN01-T containing Cry2Ab nucleotide sequence of the purposes of insecticidal proteins of the present invention Construct flow chart；

Fig. 2 is the soybean recombinant expression carrier containing Cry2Ab nucleotide sequence of the purposes of insecticidal proteins of the present invention DBN100033 constructs flow chart；

Fig. 3 is the corn recombinant expression carrier containing Cry2Ab nucleotide sequence of the purposes of insecticidal proteins of the present invention DBN100034 constructs flow chart.

Specific embodiment

The technical solution of the purposes of insecticidal proteins of the present invention is further illustrated below by specific embodiment.

The acquisition and synthesis of first embodiment, gene

1, nucleotide sequence is obtained

The amino acid sequence (634 amino acid) of Cry2Ab insect-killing protein, as shown in SEQ ID NO:1 in sequence table； Coding corresponds to the Cry2Ab nucleotide sequence (1905 nucleotide) of the amino acid sequence of the Cry2Ab insect-killing protein, such as In sequence table shown in SEQ ID NO:2.

The amino acid sequence (1178 amino acid) of Cry1Ac insect-killing protein, as shown in SEQ ID NO:3 in sequence table； Coding corresponds to the Cry1Ac nucleotide sequence (3537 nucleotide) of the amino acid sequence of the Cry1Ac insect-killing protein, such as In sequence table shown in SEQ ID NO:4.

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing protein, such as SEQ ID NO:5 institute in sequence table Show；Coding corresponds to Cry1A.105 nucleotide sequence (3534 of the amino acid sequence of the Cry1A.105 insect-killing protein Nucleotide), as shown in SEQ ID NO:6 in sequence table.

The amino acid sequence (789 amino acid) of Vip3A insect-killing protein, as shown in SEQ ID NO:7 in sequence table；It compiles Code corresponds to the Vip3A nucleotide sequence (2370 nucleotide) of the amino acid sequence of the Vip3A insect-killing protein, such as sequence In table shown in SEQ ID NO:8.

2, above-mentioned nucleotide sequence is synthesized

Synthesize the Cry2Ab nucleotide sequence (as shown in SEQ ID NO:2 in sequence table), the Cry1Ac nucleotide Sequence (as shown in SEQ ID NO:4 in sequence table), the Cry1A.105 nucleotide sequence (SEQ ID NO:6 in such as sequence table It is shown) and the Vip3A nucleotide sequence (as shown in SEQ ID NO:8 in sequence table).The Cry2Ab nucleotide of synthesis 5 ' ends of sequence (SEQ ID NO:2) are also connected with Nco I restriction enzyme site, the Cry2Ab nucleotide sequence (SEQ ID NO: 2) 3 ' ends are also connected with Spe I restriction enzyme site；5 ' ends of the Cry1Ac nucleotide sequence (SEQ ID NO:4) of synthesis are also It is connected with Sac I restriction enzyme site, 3 ' ends of the Cry1Ac nucleotide sequence (SEQ ID NO:4) are also connected with Kas I digestion Site；5 ' ends of the Cry1A.105 nucleotide sequence (SEQ ID NO:6) of synthesis are also connected with Nco I restriction enzyme site, institute 3 ' the ends for stating Cry1A.105 nucleotide sequence (SEQ ID NO:6) are also connected with Hind III digestion site；What is synthesized is described 5 ' ends of Vip3A nucleotide sequence (SEQ ID NO:8) are also connected with Asc I restriction enzyme site, the Vip3A nucleotide sequence 3 ' the ends of (SEQ ID NO:8) are also connected with BamH I restriction enzyme site.

Second embodiment, the building of recombinant expression carrier and recombinant expression carrier convert Agrobacterium

1, the recombinant cloning vector containing Cry2Ab gene is constructed

By the Cry2Ab nucleotide sequence of synthesis be connected into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600 on), operating procedure is carried out by Promega Products pGEM-T carrier specification, obtains recombinant cloning vector DBN01- T, (wherein, Amp indicates ampicillin resistance gene to building process as shown in Figure 1；F1 indicates that the duplication of bacteriophage f1 rises Point；LacZ is LacZ initiation codon；SP6 is SP6RNA polymerase promoter；T7 is t7 rna polymerase promoter；Cry2Ab For Cry2Ab nucleotide sequence (SEQ ID NO:2)；MCS is multiple cloning sites).

Then by recombinant cloning vector DBN01-T with heat shock method convert Escherichia coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), hot shock condition are as follows: 50 μ L Escherichia coli T1 competent cells, 10 μ L Plasmid DNA (weight Group cloning vector DBN01-T), 42 DEG C of water-bath 30s；37 DEG C of shaken cultivation 1h (shaking table shakes under 100rpm revolving speed), apply on surface There is the ammonia benzyl of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indoles-β-D- galactoside of the bromo- 4- of 5-) green (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L are used the LB plate of mycin (100mg/L) NaOH tune pH to growth on 7.5) overnight.Picking white colony, in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation. Its plasmid of alkalinity extraction: being centrifuged 1min under 12000rpm revolving speed for bacterium solution, removes supernatant, and precipitating thallus is pre-chilled with 100 μ L ice Solution I (25mM Tris-HCl, 10mM EDTA (ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) suspend；200 μ L are added The solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) newly prepared, pipe is overturned 4 times, and 3- on ice is set in mixing 5min；The ice-cold solution III of 150 μ L (3M potassium acetate, 5M acetic acid) is added, mixes well immediately, places 5-10min on ice；In It is centrifuged 5min under the conditions of 4 DEG C of temperature, revolving speed 12000rpm, 2 times of volume dehydrated alcohols are added in supernatant, room temperature is put after mixing Set 5min；It is centrifuged 5min under the conditions of 4 DEG C of temperature, revolving speed 12000rpm, abandons supernatant, precipitating is 70% with concentration (V/V) It is dried after ethanol washing；TE (10mM Tris-HCl, 1mM EDTA, pH8.0) of the 30 μ L containing RNase (20 μ g/ml) is added to dissolve Precipitating；The water-bath 30min at 37 DEG C of temperature digests RNA；It is saved backup in -20 DEG C of temperature.

The plasmid of extraction carries out sequence verification after EcoR V and Xho I digestion identification, to positive colony, the results showed that weight The Cry2Ab nucleotides sequence being inserted into group cloning vector DBN01-T is classified as nucleosides shown in SEQ ID NO:2 in sequence table Acid sequence, i.e. Cry2Ab nucleotide sequence are correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, the Cry1Ac nucleotide sequence of synthesis is connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein Cry1Ac is Cry1Ac nucleotide sequence (SEQ ID NO:4).Cry1Ac nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN02-T is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, by the Cry1A.105 nucleotide sequence of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN03-T, wherein Cry1A.105 is Cry1A.105 nucleotide Sequence (SEQ ID NO:6).Cry1A.105 nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN03-T It is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, the Vip3A nucleotide sequence of synthesis is connected into On cloning vector pGEM-T, recombinant cloning vector DBN04-T is obtained, wherein Vip3A is Vip3A nucleotide sequence (SEQ ID NO:8).Vip3A nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN04-T is correctly inserted into.

2, the soybean recombinant expression carrier containing Cry2Ab gene is constructed

Digestion recombinant cloning vector DBN01-T and expression vector DBNBC- is distinguished with restriction enzyme Nco I and Spe I 01 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the Cry2Ab nucleotide sequence fragment cut is inserted into It is art technology using conventional enzymatic cleavage methods carrier construction between Nco I and the Spe I site of expression vector DBNBC-01 Known to personnel, it is built into recombinant expression carrier DBN100033, building process (Kan: kanamycins base as shown in Figure 2 Cause；RB: right margin；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9)；Cry2Ab: Cry2Ab nucleotide sequence (SEQ ID NO:2)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene； Pr35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:11)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:12)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:13)；LB: left margin).

Recombinant expression carrier DBN100033 heat shock method is converted into Escherichia coli T1 competent cell, hot shock condition Are as follows: 50 μ L Escherichia coli T1 competent cells, 10 μ L Plasmid DNA (recombinant expression carrier DBN100033), 42 DEG C of water-bath 30s；37 DEG C shaken cultivation 1h (shaking table shakes under 100rpm revolving speed)；Then in the LB solid of kanamycins containing 50mg/L (Kanamycin) Plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH on 7.5) in temperature Cultivate 12h under the conditions of 37 DEG C of degree, picking white colony, LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkalinity extraction Its plasmid.It will be identified after restriction enzyme Nco I and Spe the I digestion of the plasmid of extraction, and positive colony be sequenced Identification, the results showed that nucleotides sequence of the recombinant expression carrier DBN100033 between Nco I and Spe I site is classified as in sequence table Nucleotide sequence shown in SEQ ID NO:2, i.e. Cry2Ab nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100033, by Sac I and Kas I, Nco I and Spe I points The Cry1Ac nucleotide sequence and Cry2Ab nucleotides sequence that other digestion recombinant cloning vector DBN01-T and DBN02-T are cut Column insertion expression vector DBNBC-01, obtains recombinant expression carrier DBN100175 (Kan: kanamycin gene；RB: right margin； PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9)；Cry2Ab:Cry2Ab nucleotides sequence It arranges (SEQ ID NO:2)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene；PrAtRbcS4: arabidopsis Ribulose 1,5- diphosphonic acid carboxylase small subunit gene promoters (SEQ ID NO:14)；Cry1Ac:Cry1Ac nucleotide sequence (SEQ ID NO:4)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene；Pr35S: cauliflower mosaic Malicious 35S promoter (SEQ ID NO:11)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:12)；T35S: cauliflower Mosaic virus 35 S terminator (SEQ ID NO:13)；LB: left margin).Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100175 contains for nucleotide sequence shown in SEQ ID NO:2 in sequence table and SEQ ID NO:4, That is Cry1Ac nucleotide sequence and Cry2Ab nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100033, by Nco I and Hind III, Nco I and Spe I digestion recombinant cloning vector DBN01-T and DBN03-T is cut respectively the Cry1A.105 nucleotide sequence and Cry2Ab core Nucleotide sequence is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100176 (Kan: kanamycin gene；RB: right Boundary；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:9)；Cry2Ab:Cry2Ab nucleosides Acid sequence (SEQ ID NO:2)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene；PrAtRbcS4: quasi- Southern mustard ribulose 1,5- diphosphonic acid carboxylase small subunit gene promoters (SEQ ID NO:14)；Cry1A.105:Cry1A.105 Nucleotide sequence (SEQ ID NO:6)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene；Pr35S: flower Cauliflower mosaic virus 35S promoter (SEQ ID NO:11)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:12)； T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:13)；LB: left margin).Digestion and sequence verification recombinant expression Nucleotide sequence in carrier DBN100176 contains for nucleotides sequence shown in SEQ ID NO:2 in sequence table and SEQ ID NO:6 Column, i.e. Cry1A.105 nucleotide sequence and Cry2Ab nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100033, Asc I and BamH I digestion recombinant clone is carried The Vip3A nucleotide sequence that body DBN04-T is cut is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100003.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100003 contains for SEQ in sequence table Nucleotide sequence shown in ID NO:8, i.e. Vip3A nucleotide sequence.The Vip3A nucleotide sequence can be separately connected described PrAtUbi10 promoter and tNos terminator.

3, the corn recombinant expression carrier containing Cry2Ab gene is constructed

Digestion recombinant cloning vector DBN01-T and expression vector DBNBC- is distinguished with restriction enzyme Nco I and Spe I 02 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the Cry2Ab nucleotide sequence fragment cut is inserted into It is art technology using conventional enzymatic cleavage methods carrier construction between Nco I and the Spe I site of expression vector DBNBC-02 Known to personnel, it is built into recombinant expression carrier DBN100034, building process (Kan: kanamycins base as shown in Figure 3 Cause；RB: right margin；PrUbi: maize ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15)；Cry2Ab:Cry2Ab Nucleotide sequence (SEQ ID NO:2)；TNos: the terminator (SEQ ID NO:10) of rouge alkali synthetase gene；PMI: phosphoric acid Mannose isomerase gene (SEQ ID NO:16) LB: left margin).

Recombinant expression carrier DBN100034 heat shock method is converted into Escherichia coli T1 competent cell, hot shock condition Are as follows: 50 μ L Escherichia coli T1 competent cells, 10 μ L Plasmid DNA (recombinant expression carrier DBN100034), 42 DEG C of water-bath 30s；37 DEG C shaken cultivation 1h (shaking table shakes under 100rpm revolving speed)；Then in the LB solid of kanamycins containing 50mg/L (Kanamycin) Plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH on 7.5) in temperature Cultivate 12h under the conditions of 37 DEG C of degree, picking white colony, LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkalinity extraction Its plasmid.It will be identified after restriction enzyme Nco I and Spe the I digestion of the plasmid of extraction, and positive colony be sequenced Identification, the results showed that nucleotides sequence of the recombinant expression carrier DBN100034 between Nco I and Spe I site is classified as in sequence table Nucleotide sequence shown in SEQ ID NO:2, i.e. Cry2Ab nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100034, by Nco I and Hind III, Nco I and Spe I digestion recombinant cloning vector DBN01-T and DBN03-T is cut respectively the Cry1A.105 nucleotide sequence and Cry2Ab core Nucleotide sequence is inserted into expression vector DBNBC-02, obtains recombinant expression carrier DBN100076.Digestion and sequence verification recombinant expression Nucleotide sequence in carrier DBN100076 contains for nucleotides sequence shown in SEQ ID NO:2 in sequence table and SEQ ID NO:6 Column, i.e. Cry1A.105 nucleotide sequence and Cry2Ab nucleotide sequence.The Cry1A.105 nucleotide sequence and described Cry2Ab nucleotide sequence can be separately connected the Ubi promoter and Nos terminator.

According to the method for above-mentioned building recombinant expression carrier DBN100034, Asc I and BamH I digestion recombinant clone is carried The Vip3A nucleotide sequence that body DBN04-T is cut is inserted into expression vector DBNBC-02, obtains recombinant expression carrier DBN100004.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100004 contains for SEQ in sequence table Nucleotide sequence shown in ID NO:8, i.e. Vip3A nucleotide sequence.The Vip3A nucleotide sequence can be separately connected described Ubi promoter and Nos terminator.

4, recombinant expression carrier converts Agrobacterium

To oneself constructed correct soybean recombinant expression carrier DBN100033, DBN100175, DBN100176 and DBN100003 and corn recombinant expression carrier DBN100034, DBN100076 and DBN100004 is transformed into agriculture bar with liquid nitrogen method In bacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015), conversion condition are as follows: 100 μ L Agrobacteriums LBA4404,3 μ L Plasmid DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；By the agriculture after conversion Bacillus LBA4404 is inoculated in LB test tube in 28 DEG C of temperature, revolving speed to cultivate 2h under the conditions of 200rpm, is applied to the benefit containing 50mg/L Good fortune is put down on the LB plate of the kanamycins of (Rifampicin) and 100mg/L until growing positive monoclonal, and picking monoclonal is trained Its plasmid is supported and extracts, with restriction enzyme to soybean recombinant expression carrier DBN100033, DBN100175, DBN100176 And digestion is carried out after DBN100003 and corn recombinant expression carrier DBN100034, DBN100076 and DBN100004 digestion and is tested Card, the results showed that soybean recombinant expression carrier DBN100033, DBN100175, DBN100176 and DBN100003 and corn weight Group expression vector DBN100034, DBN100076 and DBN100004 structure is completely correct.

The acquisition of 3rd embodiment, transgenic plant

1, Transgenic soybean plants are obtained

According to the Agrobacterium infestation method routinely used, by the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile culture and the Agrobacterium described in 4 in two embodiments co-cultures, by the soybean recombinant expression carrier of 2 buildings in second embodiment T-DNA (including the Cry2Ab nucleotide sequence, Cry1Ac core of DBN100033, DBN100175, DBN100176 and DBN100003 Nucleotide sequence, Cry1A.105 nucleotide sequence, Vip3A nucleotide sequence and pat gene) it is transferred in soybean genome, it obtains It obtained and is transferred to the soybean plant strain of Cry2Ab nucleotide sequence, the soybean plant strain that is transferred to Cry1Ac-Cry2Ab nucleotide sequence, be transferred to The soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence and the soybean plant strain for being transferred to Vip3A nucleotide sequence, while with open country Raw type soybean plant strain is as control.

For the transformation of soybean of mediated by agriculture bacillus, briefly, by mature soya seeds in soybean germination culture medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprouted, seed is inoculated on germination medium, By the following conditions culture: 25 ± 1 DEG C of temperature；Photoperiod (light dark) is 16/8h.It is taken after sprouting 4-6 days swollen at bud green cotyledonary node Big soybean aseptic seedling, cuts hypocotyl under cotyledonary node at 3-4mm, longitudinally slit cotyledon removes terminal bud, lateral bud and seminal root. Wound is carried out at cotyledonary node with the knife spine of scalpel, the cotyledonary node tissue crossed with agrobacterium suspension contact wound, middle peasant Cry2Ab nucleotide sequence can be transferred to cotyledonary node tissue (step 1: infecting step) that wound is crossed in this step by bacillus, Cotyledonary node tissue preferably immerses agrobacterium suspension (OD₆₆₀=0.5-0.8, infecting culture medium, (MS salt 2.15g/L, B5 tie up him Life, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2-morpholine ethane sulfonic acid (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) in start inoculation.Cotyledonary node tissue and Agrobacterium co-culture one period (3 days) (step 2: training altogether Support step).Preferably, cotyledonary node group is woven in infect step after in solid medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) on cultivate.It, can after the stage of co-cultivation herein To there is " recovery " step of a selectivity.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/ L, pH5.6) at least in the presence of it is a kind of oneself know and inhibit the antibiotic (cephalosporin) of Agrobacterium growth, do not add vegetable transformant Selective agent (step 3: recovering step).Preferably, the tissue block of cotyledon node regeneration is having antibiotic but the not solid of selective agent It is cultivated on culture medium, to eliminate Agrobacterium and provide convalescence for infected cell.Then, the tissue block of cotyledon node regeneration is containing choosing Select the transformed calli (step 4: selection step) cultivated on the culture medium of agent (glufosinate) and select to grow.Preferably, The tissue block of cotyledon node regeneration is in screening solid medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sugarcane for having selective agent Sugared 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, asparagus fern Propylhomoserin 100mg/L, glufosinate 6mg/L, pH5.6) on cultivate, cause conversion cell selective growth.Then, the cell of conversion It regenerates plant (step 5: regeneration step), it is preferable that the tissue of the cotyledon node regeneration grown on the culture medium containing selective agent Block is cultivated on solid medium (B5 differential medium and B5 root media) with aftergrowth.

It screens obtained resistant tissues block and is transferred to the B5 differential medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, Gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6) on, differentiation is cultivated at 25 DEG C.The seedling come is differentiated to turn Move on to the B5 root media (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole -3-butyric acid (IBA) 1mg/L), in culture of rootage, culture moves to hot-house culture to about 10cm high at 25 DEG C It is extremely solid.In the greenhouse, 16h is cultivated at 26 DEG C daily, cultivates 8h at 20 DEG C.

2, transgenic corn plant is obtained

According to the Agrobacterium infestation method routinely used, by the rataria and second of the corn variety of sterile culture comprehensive 31 (Z31) The co-cultivation of Agrobacterium described in 4 in embodiment, the corn recombinant expression carrier DBN100034 that in second embodiment 3 are constructed, T-DNA (including Cry2Ab nucleotide sequence, Cry1A.105 nucleotide sequence, the Vip3A core of DBN100076 and DBN100004 Nucleotide sequence and PMI gene) be transferred in maize chromosome group, obtain be transferred to Cry2Ab nucleotide sequence plant, It is transferred to the plant of Cry1A.105-Cry2Ab nucleotide sequence and is transferred to the plant of Vip3A nucleotide sequence；Simultaneously Using wild-type corn plant as control.

For the corn transformation of mediated by agriculture bacillus, briefly, immature rataria is separated from corn, is suspended with Agrobacterium Liquid contacts rataria, and wherein Cry2Ab nucleotide sequence can be transferred at least one cell (step of one of rataria by Agrobacterium 1: infecting step), in this step, rataria preferably immerses agrobacterium suspension (OD₆₆₀=0.4-0.6 infects culture medium (MS Salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, AS 40mg/L, 2,4 dichloro benzene Fluoroacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.One period (3 days) of rataria and Agrobacterium co-cultivation (step 2: Co-culture step).Preferably, rataria is after infecting step in solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, AS 100mg/L, 2,4-D 1mg/L, agar 8g/L, pH5.8) on cultivate.? After this co-cultivation stage, there can be " recovery " step of a selectivity.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-D 1mg/L, plant gel 3g/L, pH5.8) at least In the presence of it is a kind of oneself know and inhibit the antibiotic (cephalosporin) of Agrobacterium growth, do not add vegetable transformant selective agent (step 3: Recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium simultaneously Convalescence is provided for infected cell.Then, the rataria of inoculation is cultivated on the culture medium containing selective agent (mannose) and selects to give birth to The transformed calli (step 4: selection step) having.Preferably, rataria is in screening solid medium (the MS salt for having selective agent 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, mannose 12.5g/L, 2,4-D 1mg/L, plant gel 3g/ L, pH5.8) on cultivate, cause conversion cell selective growth.Then, at plant, (step 5: regeneration walks callus regeneration Suddenly), it is preferable that (MS differential medium and MS are raw in solid medium for the callus grown on the culture medium containing selective agent Root culture medium) on culture with aftergrowth.

It screens obtained resistant calli and is transferred to the MS differential medium (MS salt 4.3g/L, MS vitamin, cheese Plain 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, plant gel 3g/L, pH5.8) on, at 25 DEG C Culture differentiation.It differentiates the seedling come and is transferred to the MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, plant gel 3g/L, pH5.8) on, it cultivates at 25 DEG C to about 10cm Height moves to hot-house culture to solid.In the greenhouse, 16h is cultivated at 28 DEG C daily, cultivates 8h at 20 DEG C.

Fourth embodiment verifies transgenic plant with TaqMan

The soybean plant strain for being transferred to Cry2Ab nucleotide sequence is taken respectively, is transferred to the big of Cry1Ac-Cry2Ab nucleotide sequence Beans plant, the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence and the soybean for being transferred to Vip3A nucleotide sequence are planted Respectively about 100mg extracts its genomic DNA with the DNeasy Plant Maxi Kit of Qiagen, passes through the blade of strain as sample Taqman fluorescence probe quantitative PCR method detects the copy number of pat gene to determine the copy number of Cry2Ab gene.Simultaneously with open country Raw type soybean plant strain is tested and analyzed according to the method described above as control.Experiment sets 3 repetitions, is averaged.

Detecting pat gene copy number, the specific method is as follows:

Step 11 takes the soybean plant strain for being transferred to Cry2Ab nucleotide sequence respectively, is transferred to Cry1Ac-Cry2Ab nucleotides sequence The soybean plant strain of column, is transferred to the big of Vip3A nucleotide sequence at the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence Each 100mg of the blade of beans plant and Wild-type soy plant, is ground into homogenate with liquid nitrogen in mortar respectively, and each sample takes 3 It repeats；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μL；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification The sample of shellfish number is as standard items, and using the sample of Wild-type soy plant as control, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively:

Following primer and probe is used to detect pat gene:

Primer 1:gagggtgttgtggctggtattg is as shown in SEQ ID NO:17 in sequence table；

Primer 2: tctcaactgtccaatcgtaagcg is as shown in SEQ ID NO:18 in sequence table；

Probe 1:cttacgctgggccctggaaggctag is as shown in SEQ ID NO:19 in sequence table；

PCR reaction system are as follows:

50 × the primer/probe mixture includes each 45 μ L of every kind of primer, 50 μ of probe of 100 μM of concentration of 1mM concentration L and 860 μ L 1 × TE buffers, and at 4 DEG C, it is housed in amber tube.

PCR reaction condition are as follows:

Data are analyzed using SDS2.3 software (Applied Biosystems).

The experimental results showed that Cry2Ab nucleotide sequence, Cry1Ac-Cry2Ab nucleotide sequence, Cry1A.105- Oneself is integrated into the genome of soybean plant strain detected for Cry2Ab nucleotide sequence and Vip3A nucleotide sequence, and It is transferred to the soybean plant strain of Cry2Ab nucleotide sequence, the soybean plant strain for being transferred to Cry1Ac-Cry2Ab nucleotide sequence, is transferred to The soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence and the soybean plant strain for being transferred to Vip3A nucleotide sequence obtain list The Transgenic soybean plants of copy.

According to the above-mentioned method with TaqMan verifying Transgenic soybean plants, transgenic corn plant is tested and analyzed (PMI gene).The experimental results showed that Cry2Ab nucleotide sequence, Cry1A.105-Cry2Ab nucleotide sequence and Vip3A nucleosides Oneself is integrated into the genome of plant detected acid sequence respectively, and is transferred to the jade of Cry2Ab nucleotide sequence Rice plant, the corn for being transferred to the plant of Cry1A.105-Cry2Ab nucleotide sequence and being transferred to Vip3A nucleotide sequence are planted The transgenic plant that strain is singly copied.

The insect resistant effect detection of 5th embodiment, Transgenic soybean plants

By the soybean plant strain for being transferred to Cry2Ab nucleotide sequence, be transferred to Cry1Ac-Cry2Ab nucleotide sequence soybean plant Strain, the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence, the soybean plant strain for being transferred to Vip3A nucleotide sequence, open country It gives birth to type soybean plant strain and is accredited as non-transgenic soybean plant strain through Taqman and insect resistant effect detection is carried out to loxostege sticticalis.

The soybean plant strain for being transferred to Cry2Ab nucleotide sequence is taken respectively, is transferred to the big of Cry1Ac-Cry2Ab nucleotide sequence Beans plant, the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence, the soybean plant for being transferred to Vip3A nucleotide sequence Strain, Wild-type soy plant and the fresh blade that non-transgenic soybean plant strain (tri-leaf period) is accredited as through Taqman, use are sterile Water is rinsed well and is blotted the water on blade with gauze, and soybean leaves are then removed vein, at the same be cut into about 2cm × The strip of 3.5cm, take 1 cut after strip blade be put on the moisturizing filter paper of round plastic culture dish bottom, Mei Gepei Support and put 10 loxostege sticticalis (newly hatched larvae) in ware and cover afterwards, 25-28 DEG C of temperature, relative humidity 70%-80%, the photoperiod (light/ After secretly) being placed 3 days under conditions of 16:8, according to three Xiang Zhibiao of loxostege sticticalis larvae development progress, the death rate and blade injury rate, obtain It obtains resistance total score (full marks 300 divide): the resistance total score=100 × death rate+[100 × death rate+90 × (just incubate borer population/it is total to connect worm Number)+60 × (just incubate-negative control borer population/and connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- leaf Piece damage ratio).Totally 3 transformation event strains (S1, S2, S3) of Cry2Ab nucleotide sequence are transferred to, Cry1Ac-Cry2Ab is transferred to Totally 3 transformation event strains (S4, S5, S6) of nucleotide sequence, are transferred to totally 3 of Cry1A.105-Cry2Ab nucleotide sequence Transformation event strain (S7, S8, S9) is transferred to totally 3 transformation event strains (S10, S11, S12) of Vip3A nucleotide sequence, warp Taqman is accredited as non-transgenic (NGM1) totally 1 strain, (CK1) of wild type totally 1 strain；3 plants are selected from each strain It is tested, every plant is repeated 1 times.The results are shown in Table 1.

Table 1, Transgenic soybean plants are inoculated with the pest-resistant experimental result of loxostege sticticalis

Table 1 the result shows that: be transferred to the soybean plant strain of Cry2Ab nucleotide sequence, be transferred to Cry1Ac-Cry2Ab nucleotide The soybean plant strain of sequence and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence, which have loxostege sticticalis, preferably to kill Worm effect, the average mortality of loxostege sticticalis are largely 100%, and resistance total score is divided also close to full marks 300；And it is transferred to Vip3A Although the soybean plant strain of nucleotide sequence has insecticidal activity to loxostege sticticalis, lethality is only 20% hereinafter, through Taqman Non-transgenic soybean plant strain and Wild-type soy plant pair loxostege sticticalis are accredited as without lethal or inhibiting effect, resistance total score one As 80 or so.

Compared with Wild-type soy plant, it is transferred to the soybean plant strain of Cry2Ab nucleotide sequence, is transferred to Cry1Ac-Cry2Ab The soybean plant strain of nucleotide sequence and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence can cause loxostege sticticalis The mortality of newly hatched larvae, and fraction survival larvae development progress is caused greatly to inhibit, larva is still located substantially after 3 days In just incubate state or between just incubate-negative control state between, the pest of this suppressed development will be unable under field conditions (factors) Existence.And be transferred to the soybean plant strain of Cry2Ab nucleotide sequence, be transferred to Cry1Ac-Cry2Ab nucleotide sequence soybean plant strain and The soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence is transferred to generally only by slight damage, blade injury rate exists 10% or less；And although being transferred to the soybean plant strain of Vip3A nucleotide sequence has insecticidal activity to loxostege sticticalis, control efficiency is not If Cry2Ab albumen is obvious, most of larva can survive, and it is obvious to the damage of blade.

Thus it proves to be transferred to the soybean plant strain of Cry2Ab nucleotide sequence, be transferred to Cry1Ac-Cry2Ab nucleotide sequence Soybean plant strain and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence show the activity of highly resistance loxostege sticticalis, this Activity is enough the growth to loxostege sticticalis and generates ill effect to make it be controlled in field.

The insect resistant effect detection of sixth embodiment, transgenic corn plant

By the plant for being transferred to Cry2Ab nucleotide sequence, it is transferred to the corn of Cry1A.105-Cry2Ab nucleotide sequence Plant, the plant for being transferred to Vip3A nucleotide sequence, wild-type corn plant and non-transgenic jade is accredited as through Taqman Rice plant pair loxostege sticticalis carries out insect resistant effect detection.

The plant for being transferred to Cry2Ab nucleotide sequence is taken respectively, is transferred to Cry1A.105-Cry2Ab nucleotide sequence Plant, the plant for being transferred to Vip3A nucleotide sequence, wild-type corn plant and non-transgenic is accredited as through Taqman Plant (V3-V4 phase) fresh blade (lobus cardiacus), it is clean with aseptic water washing and blotted the water on blade with gauze, Then maize leaf is removed into vein, while being cut into the strip of about 1cm × 4cm, take 1 cut after strip blade be put into circle On the moisturizing filter paper of shape plastic culture dish bottom, 1 loxostege sticticalis (third-instar larvae) is put in each culture dish and is covered afterwards, in temperature 25-28 DEG C, relative humidity 70%-80%, place 3 days under conditions of photoperiod (light dark) 16:8 after, sent out according to loxostege sticticalis larva Three Xiang Zhibiao of progress, the death rate and blade injury rate is educated, is obtained resistance total score (full marks 300 divide): resistance total score=100 × death Rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- blade injury rate).It is transferred to totally 3 conversions of Cry2Ab nucleotide sequence Event strain (S13, S14, S15), be transferred to Cry1A.105-Cry2Ab nucleotide sequence totally 3 transformation event strains (S16, S17, S18), totally 3 transformation event strains (S19, S20, S21) of Vip3A nucleotide sequence are transferred to, are accredited as through Taqman non- (NGM2) of transgenosis totally 1 strain, (CK2) of wild type totally 1 strain；3 plants are selected to be tested from each strain, every plant weight It is 1 time multiple.The results are shown in Table 2.

Table 2, transgenic corn plant are inoculated with the pest-resistant experimental result of loxostege sticticalis

Table 2 the result shows that: be transferred to Cry2Ab nucleotide sequence plant and be transferred to Cry1A.105-Cry2Ab core The plant of nucleotide sequence has preferable insecticidal effect to loxostege sticticalis, and the average mortality of loxostege sticticalis is most of 60% More than, resistance total score is also at 200 points or more；Although and the plant for being transferred to Vip3A nucleotide sequence has loxostege sticticalis There is insecticidal activity, but lethality is only 10% hereinafter, being accredited as non-transgenic plant and wild type jade through Taqman Rice plant pair loxostege sticticalis is without lethal or inhibiting effect, and resistance total score is generally 50 or so.

Meanwhile compared with wild-type corn plant, it is transferred to the plant of Cry2Ab nucleotide sequence and is transferred to The plant of Cry1A.105-Cry2Ab nucleotide sequence can cause the mortality of loxostege sticticalis third-instar larvae, and to small portion Survival larvae development progress is divided to cause greatly to inhibit, the pest of this suppressed development can not deposit in the natural environment of field It is living.And it is transferred to the plant of Cry2Ab nucleotide sequence and is transferred to the plant of Cry1A.105-Cry2Ab nucleotide sequence The damage being subject to significantly is lighter than adjoining tree；Although and being transferred to the plant of Vip3A nucleotide sequence and having to loxostege sticticalis and kill Worm activity, but control efficiency is obvious not as good as Cry2Ab albumen, and most of larva can survive, and it is obvious to the damage of blade.

Thus it proves to be transferred to the plant of Cry2Ab nucleotide sequence and is transferred to Cry1A.105-Cry2Ab nucleotides sequence The plant of column shows the activity of highly resistance loxostege sticticalis, this activity be enough the growth to loxostege sticticalis generate ill effect to It is controlled it in field.

Above-mentioned experimental result also shows: being transferred to the soybean plant strain of Cry2Ab nucleotide sequence, is transferred to Cry1Ac-Cry2Ab core The soybean plant strain of nucleotide sequence and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence；It is transferred to Cry2Ab nucleotide The plant of sequence and the plant for being transferred to Cry1A.105-Cry2Ab nucleotide sequence are aobvious to control/prevention and treatment of loxostege sticticalis It is so that can produce Cry2Ab albumen because of plant itself, it is well known to those skilled in the art, according to Cry2Ab albumen to grass The toxic action of ground snout moth's larva, the plant that Cry2Ab albumen is transferred in the present invention, which can also generate, at least one is different from Cry2Ab albumen Second of insect-killing protein, such as Vip albuminoid or Cry albuminoid.

In conclusion the purposes of insecticidal proteins of the present invention can kill the Cry2Ab egg of loxostege sticticalis by generating in plant It is white to control loxostege sticticalis pest；Cultural control method, chemical prevention and control method, physical control method and the life used with the prior art Object control method is compared, and the present invention prevents and treats the protection of the plant progress time of infertility, whole plant the infringement of loxostege sticticalis pest, and Pollution-free, noresidue, effect stability, thoroughly, simply, conveniently, it is economical.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Sequence table

<110>Beijing Da Bei Nong Bioisystech Co., Ltd

<120>purposes of insecticidal proteins

<130> DBNBC136

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 634

<212> PRT

<213>artificial sequence-Cry2Ab amino acid sequence (Artificial Sequence)

<400> 1

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 2

<211> 1905

<212> DNA

<213>artificial sequence-Cry2Ab nucleotide sequence (Artificial Sequence)

<400> 2

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 3

<211> 1178

<212> PRT

<213>artificial sequence-Cry1Ac amino acid sequence (Artificial Sequence)

<400> 3

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn

625 630 635 640

Val Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser

675 680 685

Asn Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser

690 695 700

Thr Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn

785 790 795 800

Arg Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys

805 810 815

Arg Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp

820 825 830

Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val

835 840 845

Ile Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu

850 855 860

Glu Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val

865 870 875 880

Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp

885 890 895

Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu

900 905 910

Phe Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala

915 920 925

Met Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr

930 935 940

Leu Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu

945 950 955 960

Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg

965 970 975

Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn

980 985 990

Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val

995 1000 1005

Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val

1010 1015 1020

Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly

1025 1030 1035 1040

Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp

1045 1050 1055

Glu Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn

1060 1065 1070

Thr Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly

1075 1080 1085

Ala Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro

1090 1095 1100

Ala Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg

1105 1110 1115 1120

Arg Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro

1125 1130 1135

Leu Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr

1140 1145 1150

Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val

1155 1160 1165

Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 4

<211> 3537

<212> DNA

<213>artificial sequence-Cry1Ac nucleotide sequence (Artificial Sequence)

<400> 4

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct cttggataca tcgtagtgct 1380

gagttcaaca acatcatcgc atccgatagt attactcaaa tccctgcagt gaagggaaac 1440

tttctcttca acggttctgt catttcagga ccaggattca ctggtggaga cctcgttaga 1500

ctcaacagca gtggaaataa cattcagaat agagggtata ttgaagttcc aattcacttc 1560

ccatccacat ctaccagata tagagttcgt gtgaggtatg cttctgtgac ccctattcac 1620

ctcaacgtta attggggtaa ttcatccatc ttctccaata cagttccagc tacagctacc 1680

tccttggata atctccaatc cagcgatttc ggttactttg aaagtgccaa tgcttttaca 1740

tcttcactcg gtaacatcgt gggtgttaga aactttagtg ggactgcagg agtgattatc 1800

gacagattcg agttcattcc agttactgca acactcgagg ctgagtacaa ccttgagaga 1860

gcccagaagg ctgtgaacgc cctctttacc tccaccaatc agcttggctt gaaaactaac 1920

gttactgact atcacattga ccaagtgtcc aacttggtca cctaccttag cgatgagttc 1980

tgcctcgacg agaagcgtga actctccgag aaagttaaac acgccaagcg tctcagcgac 2040

gagaggaatc tcttgcaaga ctccaacttc aaagacatca acaggcagcc agaacgtggt 2100

tggggtggaa gcaccgggat caccatccaa ggaggcgacg atgtgttcaa ggagaactac 2160

gtcaccctct ccggaacttt cgacgagtgc taccctacct acttgtacca gaagatcgat 2220

gagtccaaac tcaaagcctt caccaggtat caacttagag gctacatcga agacagccaa 2280

gaccttgaaa tctactcgat caggtacaat gccaagcacg agaccgtgaa tgtcccaggt 2340

actggttccc tctggccact ttctgcccaa tctcccattg ggaagtgtgg agagcctaac 2400

agatgcgctc cacaccttga gtggaatcct gacttggact gctcctgcag ggatggcgag 2460

aagtgtgccc accattctca tcacttctcc ttggacatcg atgtgggatg tactgacctg 2520

aatgaggacc tcggagtctg ggtcatcttc aagatcaaga cccaagacgg acacgcaaga 2580

cttggcaacc ttgagtttct cgaagagaaa ccattggtcg gtgaagctct cgctcgtgtg 2640

aagagagcag agaagaagtg gagggacaaa cgtgagaaac tcgaatggga aactaacatc 2700

gtttacaagg aggccaaaga gtccgtggat gctttgttcg tgaactccca atatgatcag 2760

ttgcaagccg acaccaacat cgccatgatc cacgccgcag acaaacgtgt gcacagcatt 2820

cgtgaggctt acttgcctga gttgtccgtg atccctggtg tgaacgctgc catcttcgag 2880

gaacttgagg gacgtatctt taccgcattc tccttgtacg atgccagaaa cgtcatcaag 2940

aacggtgact tcaacaatgg cctcagctgc tggaatgtga aaggtcatgt ggacgtggag 3000

gaacagaaca atcagcgttc cgtcctggtt gtgcctgagt gggaagctga agtgtcccaa 3060

gaggttagag tctgtccagg tagaggctac attctccgtg tgaccgctta caaggaggga 3120

tacggtgagg gttgcgtgac catccacgag atcgagaaca acaccgacga gcttaagttc 3180

tccaactgcg tcgaggaaga aatctatccc aacaacaccg ttacttgcaa cgactacact 3240

gtgaatcagg aagagtacgg aggtgcctac actagccgta acagaggtta caacgaagct 3300

ccttccgttc ctgctgacta tgcctccgtg tacgaggaga aatcctacac agatggcaga 3360

cgtgagaacc cttgcgagtt caacagaggt tacagggact acacaccact tccagttggc 3420

tatgttacca aggagcttga gtactttcct gagaccgaca aagtgtggat cgagatcggt 3480

gaaaccgagg gaaccttcat cgtggacagc gtggagcttc tcttgatgga ggaataa 3537

<210> 5

<211> 1177

<212> PRT

<213>artificial sequence-Cry1A.105 amino acid sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Leu Val Lys Ala His

465 470 475 480

Thr Leu Gln Ser Gly Thr Thr Val Val Arg Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Gly Gly Pro Phe Ala Tyr Thr Ile

500 505 510

Val Asn Ile Asn Gly Gln Leu Pro Gln Arg Tyr Arg Ala Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Arg Ile Tyr Val Thr Val Ala Gly Glu

530 535 540

Arg Ile Phe Ala Gly Gln Phe Asn Lys Thr Met Asp Thr Gly Asp Pro

545 550 555 560

Leu Thr Phe Gln Ser Phe Ser Tyr Ala Thr Ile Asn Thr Ala Phe Thr

565 570 575

Phe Pro Met Ser Gln Ser Ser Phe Thr Val Gly Ala Asp Thr Phe Ser

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Phe Glu Leu Ile Pro Val Thr

595 600 605

Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser Asn

675 680 685

Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser Thr

690 695 700

Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn Arg

785 790 795 800

Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg

805 810 815

Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile

820 825 830

Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile

835 840 845

Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu

850 855 860

Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys

865 870 875 880

Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu

885 890 895

Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe

900 905 910

Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala Met

915 920 925

Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu

930 935 940

Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu

945 950 955 960

Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn

965 970 975

Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val

980 985 990

Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val Leu

995 1000 1005

Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys

1010 1015 1020

Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr

1025 1030 1035 1040

Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu

1045 1050 1055

Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn Thr

1060 1065 1070

Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly Ala

1075 1080 1085

Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro Ala

1090 1095 1100

Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg Arg

1105 1110 1115 1120

Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro Leu

1125 1130 1135

Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp

1140 1145 1150

Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp

1155 1160 1165

Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 6

<211> 3534

<212> DNA

<213>artificial sequence-Cry1A.105 nucleotide sequence (Artificial Sequence)

<400> 6

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cttggataca ccgtagtgct 1380

gagttcaaca acatcattgc atccgacagc attactcaaa tacccttggt gaaagcacat 1440

acacttcagt caggtactac tgttgtcaga ggtccagggt ttacaggagg agacattctt 1500

cgtcgcacaa gtggaggacc ctttgcttac actattgtta acatcaatgg ccaattgccc 1560

caaaggtatc gtgcaagaat ccgctatgcc tctactacaa atctcaggat ctacgtgact 1620

gttgcaggtg aaaggatctt tgctggtcag ttcaacaaga ctatggatac cggtgaccct 1680

ttgacattcc aatcttttag ctacgcaact atcaacacag cttttacatt cccaatgagc 1740

cagagtagct tcacagtagg tgctgacact ttcagctcag ggaatgaagt ttacatcgac 1800

aggtttgaat tgattccagt tactgcaacc ctcgaggctg agtacaacct tgagagagcc 1860

cagaaggctg tgaacgccct ctttacctcc accaatcagc ttggcttgaa aactaacgtt 1920

actgactatc acattgacca agtgtccaac ttggtcacct accttagcga tgagttctgc 1980

ctcgacgaga agcgtgaact ctccgagaaa gttaaacacg ccaagcgtct cagcgacgag 2040

aggaatctct tgcaagactc caacttcaaa gacatcaaca ggcagccaga acgtggttgg 2100

ggtggaagca ccgggatcac catccaagga ggcgacgatg tgttcaagga gaactacgtc 2160

accctctccg gaactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaaactca aagccttcac caggtatcaa cttagaggct acatcgaaga cagccaagac 2280

cttgaaatct actcgatcag gtacaatgcc aagcacgaga ccgtgaatgt cccaggtact 2340

ggttccctct ggccactttc tgcccaatct cccattggga agtgtggaga gcctaacaga 2400

tgcgctccac accttgagtg gaatcctgac ttggactgct cctgcaggga tggcgagaag 2460

tgtgcccacc attctcatca cttctccttg gacatcgatg tgggatgtac tgacctgaat 2520

gaggacctcg gagtctgggt catcttcaag atcaagaccc aagacggaca cgcaagactt 2580

ggcaaccttg agtttctcga agagaaacca ttggtcggtg aagctctcgc tcgtgtgaag 2640

agagcagaga agaagtggag ggacaaacgt gagaaactcg aatgggaaac taacatcgtt 2700

tacaaggagg ccaaagagtc cgtggatgct ttgttcgtga actcccaata tgatcagttg 2760

caagccgaca ccaacatcgc catgatccac gccgcagaca aacgtgtgca cagcattcgt 2820

gaggcttact tgcctgagtt gtccgtgatc cctggtgtga acgctgccat cttcgaggaa 2880

cttgagggac gtatctttac cgcattctcc ttgtacgatg ccagaaacgt catcaagaac 2940

ggtgacttca acaatggcct cagctgctgg aatgtgaaag gtcatgtgga cgtggaggaa 3000

cagaacaatc agcgttccgt cctggttgtg cctgagtggg aagctgaagt gtcccaagag 3060

gttagagtct gtccaggtag aggctacatt ctccgtgtga ccgcttacaa ggagggatac 3120

ggtgagggtt gcgtgaccat ccacgagatc gagaacaaca ccgacgagct taagttctcc 3180

aactgcgtcg aggaagaaat ctatcccaac aacaccgtta cttgcaacga ctacactgtg 3240

aatcaggaag agtacggagg tgcctacact agccgtaaca gaggttacaa cgaagctcct 3300

tccgttcctg ctgactatgc ctccgtgtac gaggagaaat cctacacaga tggcagacgt 3360

gagaaccctt gcgagttcaa cagaggttac agggactaca caccacttcc agttggctat 3420

gttaccaagg agcttgagta ctttcctgag accgacaaag tgtggatcga gatcggtgaa 3480

accgagggaa ccttcatcgt ggacagcgtg gagcttctct tgatggagga ataa 3534

<210> 7

<211> 789

<212> PRT

<213>artificial sequence-Vip3A amino acid sequence (Artificial Sequence)

<400> 7

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 8

<211> 2370

<212> DNA

<213>artificial sequence-Vip3A nucleotide sequence (Artificial Sequence)

<400> 8

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 9

<211> 1322

<212> DNA

<213>arabidopsis (Arabidopsis thaliana)

<400> 9

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 10

<211> 530

<212> DNA

<213>terminator (Agrobacterium tumefaciens)

<400> 10

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 11

<211> 529

<212> DNA

<213>promoter (Cauliflower mosaic virus)

<400> 11

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 12

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 12

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 13

<211> 195

<212> DNA

<213>terminator (Cauliflower mosaic virus)

<400> 13

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 14

<211> 1744

<212> DNA

<213>arabidopsis thaliana promoter is sub (Arabidopsis thaliana)

<400> 14

aattcaaatt tattatgtgt tttttttccg tggtcgagat tgtgtattat tctttagtta 60

ttacaagact tttagctaaa atttgaaaga atttacttta agaaaatctt aacatctgag 120

ataatttcag caatagatta tatttttcat tactctagca gtatttttgc agatcaatcg 180

caacatatat ggttgttaga aaaaatgcac tatatatata tatattattt tttcaattaa 240

aagtgcatga tatataatat atatatatat atatatgtgt gtgtgtatat ggtcaaagaa 300

attcttatac aaatatacac gaacacatat atttgacaaa atcaaagtat tacactaaac 360

aatgagttgg tgcatggcca aaacaaatat gtagattaaa aattccagcc tccaaaaaaa 420

aatccaagtg ttgtaaagca ttatatatat atagtagatc ccaaattttt gtacaattcc 480

acactgatcg aatttttaaa gttgaatatc tgacgtagga tttttttaat gtcttacctg 540

accatttact aataacattc atacgttttc atttgaaata tcctctataa ttatattgaa 600

tttggcacat aataagaaac ctaattggtg atttatttta ctagtaaatt tctggtgatg 660

ggctttctac tagaaagctc tcggaaaatc ttggaccaaa tccatattcc atgacttcga 720

ttgttaaccc tattagtttt cacaaacata ctatcaatat cattgcaacg gaaaaggtac 780

aagtaaaaca ttcaatccga tagggaagtg atgtaggagg ttgggaagac aggcccagaa 840

agagatttat ctgacttgtt ttgtgtatag ttttcaatgt tcataaagga agatggagac 900

ttgagaagtt ttttttggac tttgtttagc tttgttgggc gttttttttt ttgatcaata 960

actttgttgg gcttatgatt tgtaatattt tcgtggactc tttagtttat ttagacgtgc 1020

taactttgtt gggcttatga cttgttgtaa catattgtaa cagatgactt gatgtgcgac 1080

taatctttac acattaaaca tagttctgtt ttttgaaagt tcttattttc atttttattt 1140

gaatgttata tatttttcta tatttataat tctagtaaaa ggcaaatttt gcttttaaat 1200

gaaaaaaata tatattccac agtttcacct aatcttatgc atttagcagt acaaattcaa 1260

aaatttccca tttttattca tgaatcatac cattatatat taactaaatc caaggtaaaa 1320

aaaaggtatg aaagctctat agtaagtaaa atataaattc cccataagga aagggccaag 1380

tccaccaggc aagtaaaatg agcaagcacc actccaccat cacacaattt cactcataga 1440

taacgataag attcatggaa ttatcttcca cgtggcatta ttccagcggt tcaagccgat 1500

aagggtctca acacctctcc ttaggccttt gtggccgtta ccaagtaaaa ttaacctcac 1560

acatatccac actcaaaatc caacggtgta gatcctagtc cacttgaatc tcatgtatcc 1620

tagaccctcc gatcactcca aagcttgttc tcattgttgt tatcattata tatagatgac 1680

caaagcacta gaccaaacct cagtcacaca aagagtaaag aagaacaatg gcttcctcta 1740

tgct 1744

<210> 15

<211> 1992

<212> DNA

<213>promoter (Zea mays)

<400> 15

ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60

agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120

tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180

tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240

gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300

ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360

gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420

agcctctaaa ttaagaaaac taaaactcta ttttagtttt tttatttaat aatttagata 480

taaaatagaa taaaataaag tgactaaaaa ttaaacaaat accctttaag aaattaaaaa 540

aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600

cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660

cggcacggca tctctgtcgc tgcctctgga cccctctcga gagttccgct ccaccgttgg 720

acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780

ggcaggcggc ctcctcctcc tctcacggca cggcagctac gggggattcc tttcccaccg 840

ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc acaccctctt 900

tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc ccaaatccac 960

ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc ctctctacct 1020

tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080

tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140

tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200

atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260

gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320

tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380

agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440

gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500

ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560

gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620

aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680

catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740

ttgatgtggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800

ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860

gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920

atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980

ttacttctgc ag 1992

<210> 16

<211> 1176

<212> DNA

<213> Escherichia coli

<400> 16

atgcaaaaac tcattaactc agtgcaaaac tatgcctggg gcagcaaaac ggcgttgact 60

gaactttatg gtatggaaaa tccgtccagc cagccgatgg ccgagctgtg gatgggcgca 120

catccgaaaa gcagttcacg agtgcagaat gccgccggag atatcgtttc actgcgtgat 180

gtgattgaga gtgataaatc gactctgctc ggagaggccg ttgccaaacg ctttggcgaa 240

ctgcctttcc tgttcaaagt attatgcgca gcacagccac tctccattca ggttcatcca 300

aacaaacaca attctgaaat cggttttgcc aaagaaaatg ccgcaggtat cccgatggat 360

gccgccgagc gtaactataa agatcctaac cacaagccgg agctggtttt tgcgctgacg 420

cctttccttg cgatgaacgc gtttcgtgaa ttttccgaga ttgtctccct actccagccg 480

gtcgcaggtg cacatccggc gattgctcac tttttacaac agcctgatgc cgaacgttta 540

agcgaactgt tcgccagcct gttgaatatg cagggtgaag aaaaatcccg cgcgctggcg 600

attttaaaat cggccctcga tagccagcag ggtgaaccgt ggcaaacgat tcgtttaatt 660

tctgaatttt acccggaaga cagcggtctg ttctccccgc tattgctgaa tgtggtgaaa 720

ttgaaccctg gcgaagcgat gttcctgttc gctgaaacac cgcacgctta cctgcaaggc 780

gtggcgctgg aagtgatggc aaactccgat aacgtgctgc gtgcgggtct gacgcctaaa 840

tacattgata ttccggaact ggttgccaat gtgaaattcg aagccaaacc ggctaaccag 900

ttgttgaccc agccggtgaa acaaggtgca gaactggact tcccgattcc agtggatgat 960

tttgccttct cgctgcatga ccttagtgat aaagaaacca ccattagcca gcagagtgcc 1020

gccattttgt tctgcgtcga aggcgatgca acgttgtgga aaggttctca gcagttacag 1080

cttaaaccgg gtgaatcagc gtttattgcc gccaacgaat caccggtgac tgtcaaaggc 1140

cacggccgtt tagcgcgtgt ttacaacaag ctgtaa 1176

<210> 17

<211> 22

<212> DNA

<213>artificial sequence-primer 1 (Artificial Sequence)

<400> 17

gagggtgttg tggctggtat tg 22

<210> 18

<211> 23

<212> DNA

<213>artificial sequence-primer 2 (Artificial Sequence)

<400> 18

tctcaactgt ccaatcgtaa gcg 23

<210> 19

<211> 25

<212> DNA

<213>artificial sequence-probe 1 (Artificial Sequence)

<400> 19

cttacgctgg gccctggaag gctag 25

Claims (14)

1. a kind of method for controlling loxostege sticticalis pest, which is characterized in that including at least connecing loxostege sticticalis pest with Cry2Ab albumen Touching.

2. the method for control loxostege sticticalis pest according to claim 1, which is characterized in that the Cry2Ab albumen is present in In the host cell at least generating the Cry2Ab albumen, the loxostege sticticalis pest by ingest the host cell at least with institute State the contact of Cry2Ab albumen.

3. the method for control loxostege sticticalis pest according to claim 2, which is characterized in that the Cry2Ab albumen is present in In the bacterium or genetically modified plants at least generating the Cry2Ab albumen, the loxostege sticticalis pest by ingest the bacterium or turn The tissue of gene plant is at least contacted with the Cry2Ab albumen, after contact loxostege sticticalis pest growth be suppressed and/or Lead to death, to realize the control that plant is endangered loxostege sticticalis.

4. the method for control loxostege sticticalis pest according to claim 3, which is characterized in that the tissue of the genetically modified plants For root, blade, stalk, fruit, tassel, female fringe, anther or filigree.

5. the method for control loxostege sticticalis pest according to claim 3 or 4, which is characterized in that the plant is soybean, ash Dish, beet, sunflower, potato, crudefiber crop and corn.

6. the method for control loxostege sticticalis pest according to any one of claims 1 to 5, which is characterized in that the Cry2Ab Albumen has amino acid sequence shown in SEQ ID NO:1.

7. the method for control loxostege sticticalis pest according to claim 6, which is characterized in that the Cry2Ab albumen has Nucleotide sequence shown in SEQ ID NO:2.

8. according to the method for the described in any item control loxostege sticticalis pests of claim 3 to 7, which is characterized in that the plant is also Second of the nucleotide including at least one nucleotide for being different from encoding the Cry2Ab albumen.

9. the method for control loxostege sticticalis pest according to claim 8, which is characterized in that second of nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.

10. the method for control loxostege sticticalis pest according to claim 9, which is characterized in that second of the nucleotide is compiled Code Vip3A albumen, Cry1A albumen or Cry1F albumen.

11. the method for control loxostege sticticalis pest according to claim 10, which is characterized in that second of the nucleotide is compiled Code has amino acid sequence shown in SEQ ID NO:3 or SEQ ID NO:5.

12. the method for control loxostege sticticalis pest according to claim 11, which is characterized in that second of the nucleotide tool There is nucleotide sequence shown in SEQ ID NO:4 or SEQ ID NO:6.

13. the method for control loxostege sticticalis pest according to claim 8, which is characterized in that second of the nucleotide is Inhibit the dsRNA of important gene in target insect pests.

14. a kind of purposes of Cry2Ab protein control loxostege sticticalis pest.