CN104886111B

CN104886111B - Purpose of insecticidal protein

Info

Publication number: CN104886111B
Application number: CN201510259396.6A
Authority: CN
Inventors: 张爱红; 杨旭
Original assignee: Beijing Dbn Biotech Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2015-05-20
Filing date: 2015-05-20
Publication date: 2017-01-18
Anticipated expiration: 2035-05-20
Also published as: WO2016184387A1; PH12017502083A1; CN104886111A

Abstract

The invention relates to a purpose of an insecticidal protein. A method for controlling an injurious insect of proceras venosatus comprises at least contacting the injurious insect of proceras venosatus with a Vip3A protein. The Vip3A protein, which can kill the proceras venosatus, is generated in a plant body to control the injurious insect of proceras venosatus. Compared with an agricultural control method, a chemical control method and a physical control method in the prior art, the insecticidal protein can protect a whole plant in the whole growth period against the injurious insect of proceras venosatus. The insecticidal protein is free of pollution and residue, is stable and thorough in effect, and is simple, convenient and economic.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, more particularly to a kind of vip3a protein is by table in plant Reach the purposes to control striped stem borer to cause harm plant.

Background technology

Striped stem borer chilo sacchariphagus belongs to Lepidoptera, Pyralidae.Also known as article sugarcane borer, it is commonly called as Chinese sorghum and infiltrate Worm.It is mainly distributed on the East Asia such as China, India, Indonesia and Malaysia, South Asia and the Indian Ocean Area.Domestic distributed pole Extensively, there is generation in northeast, North China, East China and south China major part area.Can cause harm the crops such as corn, Chinese sorghum, grain, fiber crops, sugarcane.? North Dry Grain area, the crops such as corn, Chinese sorghum and grain of mainly causing harm, and often occur with corn borer mixing, cause withered heart seedling；Simultaneously It is also the primary pest on southern sugarcane.

Corn is the important cereal crops of China, and with the reinforcement of Global Greenhouse Effect, temperature constantly rises within nearly 2 years, worm Evil species survey and quantity all increase.Striped stem borer is caused harm lobus cardiacus in the early stage with larva, and stage can eat into food stalk, leaf Sheath, hinders nutrient conveying, so that stalk is easily by the wind fractureed.Yield is had a strong impact on, ordinary loss is up to 10%-40%.In order to Preventing and treating striped stem borer, the main prevention and controls that people generally adopt have: cultural control, chemical prevention and physical control.

Cultural control be multifactorial for whole farmland ecosystem comprehensive coordination management, regulation and control crop, insect, environment because Element, creation one are conducive to plant growth to be unfavorable for the farmland ecological environment that striped stem borer occurs.Overwintering Larvae pupate with Before emergence, Chinese sorghum or maize straw are disposed, to reduce worm sources of surviving the winter.Stalk processes to adopt and pulverizes, burns, macerating The distinct methods such as fertile, the broken, mudding of hand hay cutter.Because cultural control must obey crop allocation and the requirement of volume increase, application has certain office Sex-limited it is impossible to as emergency measure, just seem when striped stem borer is broken out helpless.

Chemical prevention is pesticide control, is to kill insect using chemical insecticide, is the weight of the striped stem borer comprehensive regulation Want part, it has the characteristics that quick, convenient, easy and high economic benefit, the particularly situation of the big generation of striped stem borer Under, it is requisite emergency measure.Striped stem borer, as moth stem insect, holds extremely important, medication to its Control stage Best period is that ovum incubates the Sheng phase to before larva moth stem, it will be difficult to reach the mesh of preventing and treating after otherwise high instar larvae eats into stalk 's.Chemical prevention and control method is mainly medicine liquid spray and applies pesticide-clay mixture at present.But chemical prevention also has its limitation, such as improper use Frequently can lead to crops occurs poisoning, insect to develop immunity to drugs, and kills natural enemy, pollution environment, makes farmland ecosystem Suffer to destroy and residues of pesticides such as constitute a threat to the safety of people, animal at the adverse consequences.

The physical control mainly reaction to physical factors various in environmental condition according to insect, using various physical factors such as The methods such as light, electricity, color, humiture etc. and plant equipment carry out trapping and killing, steriliation by irradiation carry out pest control.Most widely used at present Be frequency ventilating type insecticidal lamp trapping, it utilize adult pest phototaxis, closely use up, at a distance use ripple, lure insect to lean on Closely, to the preventing and treating of striped stem borer adult, there is certain effect；But frequency ventilating type insecticidal lamp needs to clear up in time daily high-tension electricity Online dirt, otherwise can affect insecticidal effect；And can not turn on light in thundery sky, operationally also shock by electricity the danger hurted sb.'s feelings Danger；In addition the disposable input installing lamp is larger.

In order to solve cultural control, chemical prevention and physical control limitation in actual applications, scientists are passed through Research finds to proceed in plant by the anti insect gene of the encoding insecticidal proteins coming from bacillus thuringiensis, can obtain some and resist Worm genetically modified plants are to prevent and treat insect pest of the plant.Vip3a insecticidal proteins are one of numerous insecticidal proteins, are by wax-like gemma bar The specific protein that bacterium produces.

Vip3a albumen has poisoning effect by exciting the apoptosis of apoptosis type to sensitiveness insect. Vip3a albumen is hydrolyzed to 4 kinds of major protein products in insect gut, and wherein only a kind of protein hydrolysate (33kd) is The toxicity core texture of vip3a albumen.The midgut epithelial cell of vip3a protein combination sensitive insect, active cell is procedural dead Die, cause the dissolving of midgut epithelial cell to lead to insect death.Any illness is not produced to non-sensitive insect, is not result in middle intestines The apoptosis of epithelial cell and dissolving.

The plant being proved to turn vip3a gene can resist the squamas such as black cutworm, Spodopterafrugiperda, pink rice borer, Heliothis zea The infringement of wing mesh lepidoptera insect, however, there is no so far with regard to the transfer-gen plant by producing expression vip3a albumen To control the report to plant hazard for the striped stem borer.

Content of the invention

It is an object of the invention to provide a kind of purposes of insecticidal proteins, provide first by producing expression vip3a albumen Transfer-gen plant controlling the method to plant hazard for the striped stem borer, and effectively overcome prior art cultural control, chemistry anti- Control and the technological deficiencies such as physical control.

For achieving the above object, the invention provides a kind of method controlling striped stem borer insect, including by striped stem borer Insect is at least contacted with vip3a albumen.

Further, described vip3a albumen is present in the host cell at least producing described vip3a albumen, described height Fine strain of millet bar borer pest worm is at least contacted with described vip3a albumen by described host cell of ingesting.

Further, described vip3a albumen is present in the bacterium at least producing described vip3a albumen or genetically modified plants In, described striped stem borer insect by the tissue of ingest described bacterium or described genetically modified plants at least with described vip3a albumen Contact, described striped stem borer insect growth after contact is suppressed and/or leads to death, to realize endangering plant to striped stem borer Control.

In technique scheme, described genetically modified plants may be at any breeding time；The group of described genetically modified plants It is woven to root, blade, stalk, fruit, tassel, female fringe, bud, flower pesticide or filigree；The described control that striped stem borer is endangered with plant Do not change because of the change of plantation place and/or implantation time.

Described plant is derived from corn, sugarcane, Chinese sorghum, grain, fiber crops or the seed of Job's tears.

Step before described contact procedure is the plant containing the polynucleotides encoding described vip3a albumen for the plantation.

Preferably, the amino acid sequence of described vip3a albumen has seq id no:1, seq id no:3 or seq id Amino acid sequence shown in no:5.The nucleotide sequence of described vip3a albumen have seq id no:2, seq id no:4 or Nucleotide sequence shown in seq id no:6.

On the basis of technique scheme, described plant can also include at least one being different from and encode described vip3a The second nucleotides of the nucleotides of albumen.

Further, described second nucleotide coding cry class insect-killing protein, vip class insect-killing protein, protease suppression Preparation, agglutinin, AMS or peroxidase.

Preferably, described second nucleotide coding cry1ab albumen.

Further, the amino acid sequence of described cry1ab albumen has shown in seq id no:7 or seq id no:11 Amino acid sequence.

Further, described second nucleotides has the nucleotides shown in seq id no:8 or seq id no:12 Sequence.

Selectively, described second nucleotides is the dsrna of important gene in suppression target insect pests.

For achieving the above object, present invention also offers a kind of vip3a protein controls the purposes of striped stem borer insect.

For achieving the above object, present invention also offers a kind of method producing the plant controlling striped stem borer insect, wrap Include the polynucleotide sequence introducing coding vip3a albumen in the genome of described plant.

For achieving the above object, present invention also offers a kind of generation controls the side of the propagulum of striped stem borer insect Method, including the first plant that will be obtained by methods described and the second plant hybridization, and/or takes off the plant being obtained by methods described On there is the tissue of fertility cultivated, thus the plant producing the polynucleotide sequence containing coding vip3a albumen is numerous Grow body.

For achieving the above object, present invention also offers a kind of method of the plant of culture control striped stem borer insect, wrap Include:

Plant at least one propagulum, the genome of described propagulum includes encoding the many of vip3a albumen Nucleotide sequence；

Described propagulum is made to grow up to plant；

Make described plant under conditions of artificial infection striped stem borer insect and/or striped stem borer insect naturally-occurring endanger Growth, has, compared with the plant harvesting the polynucleotide sequence not having coding vip3a albumen with other, the plant injury weakening And/or there is the plant of the plant products of increase.

Heretofore described " propagulum " includes but is not limited to plant tannins and plant vegetative propagule. Described plant tannins include but is not limited to vegetable seeds；Described plant vegetative propagule refers to the nutrition organs of plant Or certain particular tissues, it can produce new plant in vitro；Described nutrition organs or certain particular tissues include but It is not limited to root, stem and leaf, for example: the plant with root as vegetative propagule includes strawberry and sweet potato etc.；With stem as vegetative propagule Plant include sugarcane and potato (stem tuber) etc.；Plant with leaf as vegetative propagule includes aloe and begonia etc..

Heretofore described " contact ", refers to insect and/or insect touching, stops and/or feeding plant, plant device Official, plant tissue or plant cell, described plant, plant organ, plant tissue or plant cell both can be that it is expressed in vivo Insecticidal proteins, can also be the surface of described plant, plant organ, plant tissue or plant cell have insecticidal proteins and/or There is the microorganism producing insecticidal proteins.

Term " control " of the present invention and/or " preventing and treating " refer to that striped stem borer insect is at least contacted with vip3a albumen, after contact The growth of striped stem borer insect is suppressed and/or leads to death.Further, striped stem borer insect by feeding plant organize to Contact with vip3a albumen less, all or part of striped stem borer insect growth after contact is suppressed and/or leads to death.Suppression Refer to sub- lethal, that is, not yet lethal but can cause grow, behavior, physiology, biochemistry and certain effect aspect such as organizing, such as Grow slow and/or stop.Meanwhile, plant should be morphologically normal, and can cultivate under conventional approaches for The consumption of product and/or generation.Additionally, the control striped stem borer insect of the polynucleotide sequence containing coding vip3a albumen Plant and/or propagulum, in the condition of artificial infection striped stem borer insect and/or striped stem borer insect naturally-occurring harm Under, there is compared with not genetically modified WT lines the plant injury weakening, concrete manifestation includes but is not limited to the stem improving The kernel weight of stalk resistance and/or raising and/or volume increase etc..Vip3a albumen " control " and/or " preventing and treating " to striped stem borer Effect is can be self-existent, not because other can " control " and/or the presence of the material of " preventing and treating " striped stem borer insect and subtract Weak and/or disappear.Specifically, genetically modified plants (containing coding vip3a albumen polynucleotide sequence) any tissue simultaneously And/or asynchronously, exist and/or produce, another kind of material of vip3a albumen and/or controllable striped stem borer insect, then institute The presence stating another kind of material neither affects " control " and/or " preventing and treating " effect to striped stem borer of vip3a albumen, nor leads Cause described " control " and/or " preventing and treating " effect completely and/or part is realized by described another kind material, and with vip3a albumen no Close.Under normal circumstances, in land for growing field crops, the process of striped stem borer insect feeding plant tissue is of short duration and is difficult to observe with the naked eye, because This, under conditions of artificial infection striped stem borer insect and/or striped stem borer insect naturally-occurring endanger, such as genetically modified plants There is dead striped stem borer insect and/or thereon in any tissue of (polynucleotide sequence containing coding vip3a albumen) Stop and grow the striped stem borer insect being suppressed and/or there is compared with not genetically modified WT lines the plant weakening Damage, as achieve the method for the present invention and/or purposes, that is, by striped stem borer insect at least contact with vip3a albumen with Realize controlling method and/or the purposes of striped stem borer insect.

In the present invention, a kind of expression in genetically modified plants for the vip3a albumen can be along with one or more cry classes Insect-killing protein and/or the expression of vip class insect-killing protein.This exceed a kind of Pesticidal toxins in same strain genetically modified plants Middle co expression can make plant comprise by genetic engineering and express required gene to realize.In addition, a kind of plant the (the 1st Parent) vip3a protein can be expressed by genetic engineering procedure, second plant (the 2nd parent) can pass through genetic engineering Operation expression cry class insect-killing protein and/or vip class insect-killing protein.Obtain expression by the 1st parent and the 2nd parents Introduce the progeny plants of all genes of the 1st parent and the 2nd parent.

Rna interference (rna interference, rnai) refers to being highly conserved during evolution, by double-strand rna (double-stranded rna, dsrna) induce, the phenomenon of the efficient selective degradation of homology mrna.Therefore in the present invention Can be using rnai technology specific depletion or the expression closing specific gene in target insect pests.

In categorizing system, the typically main morphological feature such as type of nervuration, linkage mode and feeler according to adult wing, Lepidoptera is divided into suborder, Superfamily, section etc., and Pyralidae is one of section of most species in Lepidoptera, the whole world has been found that 10,000 More than kind, only China's record just has thousand of.Most of Pyralidae insect is the insect of crops, and majority to eat into stem form is Evil, such as corn borer and striped rice borer.Although striped stem borer and corn borer, striped rice borer etc. belong to Lepidoptera Pyralidae, except dividing Similitude is existed on class standard, huge difference is then existed on other morphosis；Like the strawberry in plant and apple one Sample (belongs to the Rosales rose family), and they have colored both sexes, radiation symmetric, the feature such as 5, petal, but its fruit and plant Plant shape state but varies.No matter striped stem borer is from Larva Morpho. Logy or adult form, all there is its uniqueness Feature.As back ordinate, just have in peasant and spread " Chinese sorghum corn paddy, lineback 345 ", represent and belong to Pyralidae Striped stem borer, corn borer and chilotraea infuscatellus there is obvious difference in lineback quantity.And be exactly dorsal blood vessel under the ordinate of back, the back of the body Blood vessel is the important component part of insect causing circulatory, is filled with inside the hemolymph of the title of insect " blood ".Therefore body surface The difference of trickle lineback quantity seemed on form, embodiment be but dorsal blood vessel difference, be the difference in the insect circulatory system.

Not only there is larger difference in the insect belonging to Pyralidae together in morphological feature, simultaneously on feeding habit, there is also Difference.The yellow rice borer being for example all Pyralidae is only caused harm paddy rice, other gramineous crops of seldom causing harm.And striped stem borer there are no Report causes to cause harm to paddy rice, is more to southern sugarcane, the corn in the north, Chinese sorghum and millet cause to cause harm.Take food habit The difference of property, also imply that enzyme produced by internal digestive system is different with receptor protein.And the enzyme producing in alimentary canal is bt The key point that gene works, the enzyme that only can combine with specific bt gene or receptor protein, be possible to so that certain Individual this insect of bt gene pairs has insect resistant effect.Increasing research shows, with not equal, the even equal elder brother not of the same race of mesh Worm is different to the sensitive sex expression of bt albumen of the same race.The striped rice borer chilo of such as vip3a gene pairs Pyralidae Suppressalis, Ostrinia furnacalis ostrinia furnacalis show anti-insect activity, but for belonging to snout moth together The Indian meal moth plodia interpunctella of section and European corn borer ostrinia nubilalis does not but have pest-resistant effect Really.Above-mentioned four kinds of insects belong to Lepidoptera Pyralidae, but bt albumen of the same race shows different resisting to four kinds of Pyralidae insects Property effect.Especially European corn borer and Ostrinia furnacalis even to belong to Pyralidae Genus Ostinia in classification (equal with mesh Belong to together), but it is but distinct to the reaction of bt albumen of the same race, has more absolutely proved bt albumen and enzyme in insect body Interaction mode with acceptor is complicated and is difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and include nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotides form completely " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that can be placed in the polynucleotides of the present invention and/or nucleotides Under regulating and controlling sequence in purpose host controls.

Well-known to those skilled in the art, dna is typically existed with double chain form.In this arrangement, chain with Another chain complementation, vice versa.Because dna replicates the other complementary strands creating dna in plant.So, bag of the present invention Include the use of polynucleotides to example in sequence table and its complementary strand." coding strand " that this area often uses refers to chain with antisense The chain closing.For marking protein in vivo, a chain of dna is transcribed into the complementary strand of a mrna by typical case, and it is as mould Plate translates protein.Mrna actually transcribes from " antisense " chain of dna." having justice " or " coding " chain has a series of passwords Son (codon is three nucleotides, once reads three and can produce specific amino acids), it can be read as ORFs (orf) Read to form target protein or peptide.Present invention additionally comprises there is the rna of suitable function with the dna of example.

Nucleic acid molecule of the present invention or its fragment under strict conditions with vip3a gene recombination of the present invention.Any routine Nucleic acid hybridization or amplification method may be used to identify the presence of vip3a gene of the present invention.Nucleic acid molecules or its fragment are certain In the case of can carry out specific hybrid with other nucleic acid molecules.In the present invention, if two nucleic acid molecules can form antiparallel Double-strandednucleic acid structure it is possible to say that this two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid divide Son shows completely complementarity, then claim one of nucleic acid molecules to be another nucleic acid molecules " complement ".In the present invention, When each nucleotides of nucleic acid molecules is with the corresponding nucleotide complementary of another nucleic acid molecules, then claim this two cores Acid molecule shows " complete complementary ".If two nucleic acid molecules can with enough stability phase mutual crosses so that they Anneal under the conditions of at least conventional " low strict " and be bonded to each other, then this two nucleic acid molecules are called that " minimum level is mutual Mend ".Similarly, if two nucleic acid molecules can with enough stability phase mutual crosses so that they conventional " highly Anneal under the conditions of strictly " and be bonded to each other, then claim this two nucleic acid molecules to have " complementary ".Deviateing from complete complementary is Can allow, as long as this not exclusively two molecules of prevention that deviate form duplex structures.In order that nucleic acid molecules can As primer or probe it is only necessary to ensure that it has sufficient complementarity in sequence so that in the specific solvent being adopted and Stable duplex structure can be formed under salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules can under high stringency There is specific hybrid with the complementary strand of another section of nucleic acid molecules matching.Promote the suitable stringent condition of dna hybridization, example As processed with 6.0 × sodium chloride/sodium citrate (ssc) about under the conditions of 45 DEG C, then with 2.0 × ssc under the conditions of 50 DEG C Washing, these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from low tight About 2.0 × the ssc of glazing bar part, 50 DEG C arrive high stringency about 0.2 × ssc, 50 DEG C.Additionally, the temperature in washing step Condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature conditionss and salt are dense Degree can all change it is also possible to one of keep constant and another variable changes.Preferably, of the present invention Stringent condition can be in 6 × ssc, 0.5%sds solution, with seq id no:2, specific hybrid occurs, then at 65 DEG C Respectively wash film 1 time with 2 × ssc, 0.1%sds and 1 × ssc, 0.1%sds.

Therefore, have anti-insect activity and under strict conditions with seq id no:2 of the present invention, seq id no:4 or seq The sequence of id no:6 hybridization is included in the invention.These sequences and sequence of the present invention at least about 40%-50% homology, greatly About 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%th, 96%, 97%, 98%, 99% or bigger sequence homology.

Heretofore described gene and protein not only include specific exemplary sequence, also include saving described specific The part of insecticidal activity feature of the protein of example and/fragment are (including compared with full length protein and/or end lacks Lose), variant, mutant, the substituent protein of amino acid (have substitute), chimera and fusion protein.Described " variant " or " become Different " refer to encode same albumen or coding have insecticidal activity equivalent protein nucleotide sequence.Described " equivalent protein " refers to There is the albumen of the biologically active of identical or essentially identical anti-striped stem borer insect with the albumen of claim.

Original dna or egg that " fragment " or " truncating " of heretofore described dna molecule or protein sequence refers to A part of Bai Xulie (nucleotides or amino acid) or its artificial reconstructed form (being for example suitable for the sequence of plant expression), aforementioned sequence The length of row there may be change, but length is enough to ensure that (coding) protein is insect toxins.

Can be with modifier and easy structure gene variant using standard technique.For example, it is well known that manufacturing point The technology of mutation.Such as U.S. Patent number 5605793 is described to be reassemblied using dna after random fracture and produces other molecules again Multifarious method.The fragment of full-length gene can be manufactured using commercialization endonuclease, and can be according to standardization program Using exonuclease.It is, for example possible to use enzyme such as bal31 or direct mutagenesis excise core from the end system of these genes Thuja acid.The gene of encoding active fragment can also be obtained using multiple restriction enzymes.Can be directly obtained using protease The active fragment of these toxin.

The present invention can derive equivalent protein from b.t. separator and/or dna library and/or encode these equivalent protein Gene.Multiple methods are had to obtain the insecticidal proteins of the present invention.It is, for example possible to use the desinsection that the present invention discloses and claims The antibody of albumen is identified and isolated from other albumen from protein mixture.Especially, antibody be probably by albumen the most constant and with Other b.t. albumen protein part the most different causes.May then pass through immunoprecipitation, enzyme linked immunosorbent assay (ELISA) Or western immunoblot method exclusively identifies the equivalent protein of activity characteristic using these antibody (elisa).Ability can be used Domain standardization program readily prepares the antibody of the fragment of the albumen disclosed in the present invention or equivalent protein or this albuminoid.Then may be used To obtain the gene encoding these albumen from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different dna sequences can encode identical amino acid sequence.Produce The alternative dna sequence of the identical or essentially identical albumen of these codings is just in the technical merit of those skilled in the art.This Dna sequences different a bit is included within the scope of the invention.Described " substantially the same " sequence has referred to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, has lacked Lose, add or insert but substantially do not affect the sequence of insecticidal activity, also include retaining the fragment of insecticidal activity.

In the present invention, the replacement of amino acid sequence, disappearance or interpolation are the ordinary skill in the art, preferably this amino acid Change turns to: little characteristic changing, and the conserved amino acid of the folding and/or activity that do not significantly affect albumen replaces；Little disappearance, The disappearance of normally about 1-30 amino acid；Little amino or c-terminus extend, and for example aminoterminal extends methionine residues； Little connection peptide, e.g., from about 20-25 residue is long.

The example of conservative replacement is the replacement occurring in following Amino acid group: basic amino acid is (as arginine, lysine And histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid (as glutamine, asparagine), hydrophobic Acidic amino acid (as leucine, isoleucine and valine), ArAA (as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (as glycine, alanine, serine, threonine and methionine).Generally do not change given activity Those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors are it is well known that and by for example, n.neurath and r.l.hill is 1979 in the art It is described in " protein " that year new york academic publishing house (academic press) publishes.Modal exchange has Ala/ser, val/ile, asp/glu, thu/ser, ala/thr, ser/asn, ala/val, ser/gly, tyr/phe, ala/ Pro, lys/arg, asp/asn, leu/ile, leu/val, ala/glu and asp/gly, and their contrary exchanges.

For a person skilled in the art it should be evident that this replacement can play an important role to molecular function Region outside occur, and still produce active peptides.For the polypeptide by the present invention, its activity is necessary and therefore selects not Substituted amino acid residue, can be according to methods known in the art, and such as direct mutagenesis or alanine scanning mutagenesis are reflected Fixed (as referring to, cunningham and wells, 1989, science244:1081-1085).Latter technique is each in the molecule Introduce mutation at individual positively charged residue, detect the anti-insect activity of gained mutating molecule, so that it is determined that to this molecular activity Overstate the amino acid residue wanted.Substrate-enzyme interacting site can also be measured by the analysis of its three-dimensional structure, and this three Dimension structure can be measured by technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as de vos etc., 1992, Science 255:306-312；Smith etc., 1992, j.mol.biol 224:899-904；Wlodaver etc., 1992, febs Letters 309:59-64).

In the present invention, vip3a albumen includes but is not limited to seq id no:1, seq id no:3 or seq id no:5, There is the amino acid of certain homology with the amino acid sequence shown in seq id no:1, seq id no:3 or seq id no:5 Sequence is also included in the present invention.These sequences and sequence similarities/homogeny of the present invention are typically larger than 78%, preferably greatly In 85%, more preferably greater than 90%, even more preferably it is more than 95%, and 99% can be more than.Can also be according to more special The preferred polynucleotides of fixed homogeny and/or the similarity scope definition present invention and protein.For example with example of the present invention Sequence have 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%th, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity.

In the present invention, the genetically modified plants producing described vip3a albumen include but is not limited to cot102 transgene cotton Event and/or comprise the vegetable material (as described by cn1004395507c) of cot102 transgenic cotton event, cot202 Transgenic cotton event and/or comprise the vegetable material of cot202 transgenic cotton event (as described by cn1886513a ) or mir162 transgenic corn events and/or comprise mir162 transgenic cotton event vegetable material (as exist Described by cn101548011a), it all can realize the method for the present invention and/or purposes, that is, pass through striped stem borer insect extremely Few method and/or purposes contacting with vip3a albumen to realize controlling striped stem borer insect, more specifically, described vip3a albumen It is present in the genetically modified plants at least producing described vip3a albumen, described striped stem borer insect is by described transgenosis of ingesting The tissue of plant is at least contacted with described vip3a albumen, and described striped stem borer insect growth after contact is suppressed and/or leads to Death, to realize striped stem borer is endangered with the control of plant.

Heretofore described regulating and controlling sequence include but is not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, Introne and other are operably connected to the regulating sequence of described vip3a albumen.

Described promoter is effable promoter in plant, and described " effable promoter in plant " refers to guarantee The promoter that connected coded sequence is expressed in plant cell.In plant, effable promoter can be composing type Promoter.The example instructing the promoter of constitutive expression in plant includes but is not limited to, from cauliflower mosaic virus 35s promoter, ubi promoter of maize, promoter of paddy rice gos2 gene etc..Alternatively, in plant, effable promoter can For tissue-specific promoter, that is, this promoter such as instructs the table of coded sequence in some tissues of plant in chlorenchyma Reach its hetero-organization (can be measured) that level is higher than plant, such as pep carboxylase promoter by conventional rna test.Alternatively, In plant, effable promoter can be wound-induced promoter.Wound-induced promoter or the expression pattern instructing wound-induced Promoter refer to when plant is stood machinery or gnaws, by insect, the wound causing, the table of the coded sequence under promoter regulation Reach and be significantly increased compared with the conditions of normal growth.The example of wound-induced promoter includes but is not limited to, potato and tomato Protease suppressor (pin and pin) and zein enzyme level gene (mpi) promoter.

Described transit peptides (also known as secretory signal sequence or targeting sequencing) are to instruct transgene product to arrive specific organelle Or cellular compartment, for receptor protein, described transit peptides can be heterologous, for example, using encoding chloroplast transit peptide Sequence targets chloroplaset, or retains sequence targeting endoplasmic reticulum using ' kdel ', or using barley plants agglutinin gene Ctpp targets vacuole.

Described targeting sequencing is including but not limited to little rna viral leader sequence, such as emcv targeting sequencing (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potato Virus Y group targeting sequencing, such as mdmv (Maize Dwarf Mosaic Virus) targeting sequencing；Human immunity Globular protein heavy-chain binding protein matter (bip)；The coat protein mrna of alfalfa mosaic virus does not translate targeting sequencing (amv rna4)；Tobacco mosaic virus (TMV) (tmv) targeting sequencing.

Described enhancer is including but not limited to cauliflower mosaic virus (camv) enhancer, figwort mosaic virus (fmv) increase Hadron, carnation weathering circovirus virus (cerv) enhancer, cassava vein mosaic virus (csvmv) enhancer, Mirabilis jalapa mosaic virus (mmv) enhancer, dama de noche tomato yellow leaf curl China virus (cmylcv) enhancer, Cotton leaf curl Multan virus (clcumv), the duck sole of the foot Straw colour mottle virus (coymv) and peanut chlorisis streak mosaic virus (pclsv) enhancer.

For monocotyledon application, described introne is including but not limited to corn hsp70 introne, corn are general Plain introne, adh introne 1, crose synthase intron or paddy rice act1 introne.For dicotyledon application, institute State introne including but not limited to cat-1 introne, pkannibal introne, piv2 introne and " super ubiquitin " include Son.

Described terminator can be the suitable polyadenylation signal sequence working in plant, including but do not limit In from the Polyadenylation of Agrobacterium (agrobacterium tumefaciens) rouge alkali synthetase (no) gene Burst, from protease inhibitors (pin) gene polyadenylation signal sequence, derive from pea The polyadenylation signal sequence of ssrubisco e9 gene and the poly from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " represents the connection of nucleotide sequence, and it is right that described connection makes a sequence can provide The function of needing for linked sequence.Described in the present invention " effectively connection " can be by promoter and sequence phase interested Even so that the transcription of this sequence interested is subject to this promoter to control and regulates and controls.When sequential coding albumen interested and Go for this albumen expression when " effectively connection " represent: promoter is connected with described sequence, and connected mode makes to obtain Transcript efficient translation.If promoter is that transcript merges and wants to realize the albumen of coding with the connection of coded sequence Expression when, manufacture such connection so that the first translation initiation codon is the initial of coded sequence in the transcript that obtains Codon.Alternatively, if promoter is that translation is merged and wanted to realize the table of the albumen of coding with the connection of coded sequence When reaching, manufacture such connection so that the first translation initiation codon containing in 5 ' non-translated sequences is connected with promoter, And it is to meet reading that connected mode makes the translation product obtaining with the relation of the translation opening code-reading frame encoding the albumen wanted Code frame.Can the nucleotide sequence of " effectively connection " include but is not limited to: sequence (the i.e. gene expression of gene expression function is provided Element, such as promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), provide dna transfer and/or integration function sequence (i.e. t-dna border sequence, locus specificity recombinase Recognition site, integrate enzyme recognition site), provide selectivity function sequence (i.e. antibiotic resistance markers, biosynthesis base Cause), the sequence of label function of can scoring, external or internal sequence (i.e. polylinker sequence, the site assisting series of operations are provided Specific recombination sites) and provide copy function sequence (the i.e. origin of replication of bacterium, autonomously replicating sequence, centromere sequence Row).

Heretofore described " desinsection " or " pest-resistant " refers to crop pests it is poisonous, thus realizing " control " And/or " preventing and treating " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to kill crop pests.More specifically, mesh Mark insect is striped stem borer insect.

In the present invention, vip3a albumen has toxicity to striped stem borer insect.Plant in the present invention, particularly corn, sweet Sugarcane and Chinese sorghum, contain exogenous dna in its genome, and described exogenous dna comprises to encode the nucleotide sequence of vip3a albumen, high Fine strain of millet bar borer pest worm is contacted with this albumen by feeding plant tissue, and striped stem borer insect growth after contact is suppressed and/or leads Lethal die.Suppression refers to lethal or sub- lethal.Meanwhile, plant should be morphologically normal, and can cultivate under conventional approaches Consumption for product and/or generation.Additionally, this plant can substantially eliminate to chemistry or biological insecticides needs (described The insecticide of the chemistry or biological insecticides striped stem borer insect by being targetted for vip3a albumen).

In vegetable material, the expression of insecticidal crystal protein (icp) can be entered by multiple methods described in the art Row detection, for example, carry out quantitation by applying special primer to the mrna of the coded insect-killing protein producing in tissue, or directly The amount of the insect-killing protein that specific detection produces.

Different tests can be applied to measure the insecticidal effect of icp in plant.In the present invention, targeted insect is mainly Chinese sorghum Bar snout moth's larva.

In the present invention, described vip3a albumen can have seq id no:1 in sequence table, seq id no:3 or seq id Amino acid sequence shown in no:5.In addition to comprising the code area of vip3a albumen, also can comprise other elements, such as coding choosing The protein of selecting property mark.

Additionally, comprise to encode the expression cassette of the nucleotide sequence of vip3a albumen of the present invention in plant can also with least A kind of protein of encoding herbicide resistance gene is expressed together, and described herbicide resistance gene includes but is not limited to, phosphine oxamate Resistant gene (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), Glyphosate resistance gene are (as epsps Gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, the resistant gene to herbicide Dalapon, to ammonia The resistant gene of nitrile or the resistant gene of glutamine synthetase inhibitor (as ppt), thus obtain both had high insecticidal activity, There are the genetically modified plants of Herbicid resistant again.

In the present invention, exogenous dna is imported plant, the gene of vip3a albumen or expression cassette or restructuring as described in by coding Vector introduction plant cell, conventional method for transformation includes but is not limited to, and Agrobacterium-medialed transformation, micro transmitting bombard, directly Meet the dna that dna is taken in protoplast, electroporation or silicon whisker mediation to import.

The invention provides a kind of purposes of insecticidal proteins, have the advantage that

1st, internal cause preventing and treating.It is the harm that external cause controls striped stem borer insect that prior art is mainly by external action, As cultural control, chemical prevention and physical control；And the present invention is can to kill striped stem borer by generation in plant body Vip3a albumen, to control striped stem borer insect, is prevented and treated by internal cause.

2nd, pollution-free, noresidue.Although the chemical prevention and control method that prior art uses is to the danger controlling striped stem borer insect Evil serves certain effect, but also people, animal and farmland ecosystem is brought with pollution simultaneously, destroys and remain；Using this The bright method controlling striped stem borer insect, can eliminate above-mentioned adverse consequences.

3rd, time of infertility preventing and treating.The method of the control striped stem borer insect that prior art uses is all interim, and this Invention is the protection that plant is carried out with the time of infertility, and genetically modified plants (vip3a albumen) are from germinateing, growth, until bloom, tie Really, can avoid being encroached on by striped stem borer.

4th, whole plant preventing and treating.The method of the control striped stem borer insect that prior art uses is locality mostly, such as leaf Face sprays；And the present invention is that whole plant is protected, the such as root of genetically modified plants (vip3a albumen), blade, stalk, really Reality, tassel, female fringe, bud, flower pesticide or filigree etc. all can resist striped stem borer infringement.

5th, effect stability.The frequency ventilating type insecticidal lamp that prior art uses not only needs to clear up the dirt of high-voltage fence daily in time Dirt, and can not use in thundery sky；The present invention is so that described vip3a albumen is expressed in plant body, efficiently against The defect that the effect of frequency ventilating type insecticidal lamp is affected by extraneous factor, and the preventing and treating of genetically modified plants of the present invention (vip3a albumen) Effect is also all stable and consistent in different location, different time, different genetic background.

6th, simple, convenient, economical.The disposable input of the frequency ventilating type insecticidal lamp that prior art uses is larger, and operates not When the danger hurted sb.'s feelings of also shocking by electricity；The present invention only need to plant the genetically modified plants that can express vip3a albumen, without Using other measures, thus saving a large amount of human and material resources and financial resources.

7th, effect is thorough.The method of the control striped stem borer insect that prior art uses, its effect is halfway, only rises To mitigation effect；And genetically modified plants (vip3a albumen) of the present invention can cause the mortality of striped stem borer newly hatched larvae, and A small amount of survival larvae development progress is caused greatly to suppress, after 3 days, larva, substantially still in just incubating state, is all significantly to send out Educate bad, and stop developing, cannot survive in the natural environment of field, and genetically modified plants are generally only slightly damaged Wound.

Below by drawings and Examples, technical scheme is described in further detail.

Brief description

Fig. 1 is the recombinant cloning vector dbn01-t structure containing vip3a nucleotide sequence of the purposes of insecticidal proteins of the present invention Build flow chart；

Fig. 2 is the recombinant expression carrier dbn100002 containing vip3a nucleotide sequence of the purposes of insecticidal proteins of the present invention Build flow chart；

Fig. 3 is the blade injury figure of the transgenic corn plant inoculation striped stem borer of the purposes of insecticidal proteins of the present invention.

Specific embodiment

Further illustrate the technical scheme of the purposes of insecticidal proteins of the present invention below by specific embodiment.

First embodiment, the acquisition of gene and synthesis

1st, obtain nucleotide sequence

The amino acid sequence (789 amino acid) of vip3a-01 insect-killing protein, as seq id no:1 institute in sequence table Show；Coding is corresponding to vip3a-01 nucleotide sequence (2370 cores of the amino acid sequence of described vip3a-01 insect-killing protein Thuja acid), as shown in seq id no:2 in sequence table.The amino acid sequence (789 amino acid) of vip3a-02 insect-killing protein, As shown in seq id no:3 in sequence table；Coding is corresponding to the amino acid sequence of described vip3a-02 insect-killing protein Vip3a-02 nucleotide sequence (2370 nucleotides), as shown in seq id no:4 in sequence table.

The amino acid sequence (615 amino acid) of cry1ab insect-killing protein, as shown in seq id no:7 in sequence table； Coding corresponds to the cry1ab nucleotide sequence (1848 nucleotides) of the amino acid sequence of described cry1ab insect-killing protein, such as In sequence table shown in seq id no:8.

Seq id no in the amino acid sequence (1436 amino acid) of cry1ab+vip3a insect-killing protein, such as sequence table: Shown in 9；Coding is corresponding to the cry1ab+vip3a nucleotides sequence of the amino acid sequence of described cry1ab+vip3a insect-killing protein Row (4311 nucleotides), as shown in seq id no:10 in sequence table；The amino acid sequence of wherein vip3a insect-killing protein (788 amino acid), as shown in seq id no:5 in sequence table；Coding is corresponding to the amino acid of described vip3a insect-killing protein The vip3a nucleotide sequence (2364 nucleotides) of sequence, as shown in seq id no:6 in sequence table；The effective fragment of cry1ab Amino acid sequence (648 amino acid), as shown in seq id no:11 in sequence table；Coding is effective corresponding to described cry1ab Seq id in the nucleotide sequence (1944 nucleotides) of the effective fragment of cry1ab of the amino acid sequence of fragment, such as sequence table Shown in no:12.

2nd, synthesize above-mentioned nucleotide sequence

Described vip3a-01 nucleotide sequence (as shown in seq id no:2 in sequence table), described vip3a-02 nucleotides Sequence (as shown in seq id no:4 in sequence table), described cry1ab nucleotide sequence (seq id no:8 institute in as sequence table Show) and described cry1ab+vip3a nucleotide sequence (as shown in seq id no:10 in sequence table) by Nanjing Jin Sirui biology section Skill Co., Ltd synthesizes；5 ' ends of the described vip3a-01 nucleotide sequence (seq id no:2) of synthesis are also associated with scai enzyme Enzyme site, 3 ' ends of described vip3a-01 nucleotide sequence (seq id no:2) are also associated with spei restriction enzyme site；The institute of synthesis 5 ' the ends stating vip3a-02 nucleotide sequence (seq id no:4) are also associated with scai restriction enzyme site, described vip3a-02 nucleosides 3 ' ends of acid sequence (seq id no:4) are also associated with spei restriction enzyme site；The described cry1ab+vip3a nucleotides sequence of synthesis 5 ' ends of row (seq id no:10) are also associated with spei restriction enzyme site, described cry1ab+vip3a nucleotide sequence (seq id No:10 3 ' ends) are also associated with kasi restriction enzyme site.The 5 ' of the described cry1ab nucleotide sequence (seq id no:8) of synthesis End is also associated with ncoi restriction enzyme site, and 3 ' ends of described cry1ab nucleotide sequence (seq id no:8) are also associated with bamhi enzyme Enzyme site.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier conversion Agrobacterium

1st, build the recombinant cloning vector containing vip3a gene

By the vip3a-01 nucleotide sequence of synthesis be connected into cloning vector pgem-t (promega, madison, usa, cat: A3600, on), operating procedure is carried out by promega Products pgem-t carrier specification, obtains recombinant cloning vector dbn01- T, it builds flow process, and (wherein, amp represents ampicillin resistance gene as shown in Figure 1；F1 represents that the duplication of bacteriophage f1 rises Point；Lacz is lacz initiation codon；Sp6 is sp6rna polymerase promoter；T7 is t7rna polymerase promoter；vip3a- 01 is vip3a-01 nucleotide sequence (seq id no:2)；Mcs is MCS).

Then by recombinant cloning vector dbn01-t with heat shock method conversion Escherichia coli t1 competent cell (transgen, Beijing, china, cat:cd501), its hot shock condition is: 50 μ l Escherichia coli t1 competent cells, 10 μ l plasmid dnas (weight Group cloning vector dbn01-t), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speed), in table Face scribbles the ammonia of iptg (isopropylthio-beta-d-galactopyranoside glycosides) and x-gal (the bromo- 4- of 5- chloro- 3- indoles-beta-d-galactopyranoside glycosides) Lb flat board (tryptone 10g/l, yeast extract 5g/l, nacl 10g/l, the agar 15g/ of parasiticin (100 mg/litre) L, adjusts ph to 7.5 with naoh) upper growth is overnight.Picking white colony, in lb fluid nutrient medium, (tryptone 10g/l, yeast carries Take thing 5g/l, nacl 10g/l, ampicillin 100mg/l, adjust ph to 7.5 with naoh) in cultivate under the conditions of 37 DEG C of temperature Overnight.Its plasmid of alkalinity extraction: bacterium solution is centrifuged 1min under 12000rpm rotating speed, removes supernatant, precipitate thalline 100 μ l ice The solutions i (25mm tris-hcl, 10mm edta (ethylenediamine tetra-acetic acid), 50mm glucose, ph8.0) of precooling suspends；Add New solutions i i (0.2m naoh, 1%sds (lauryl sodium sulfate)) prepared of 200 μ l, pipe is overturned 4 times, mixing, puts ice Upper 3-5min；Add ice-cold solutions i ii of 150 μ l (3m potassium acetate, 5m acetic acid), fully mix immediately, place 5- on ice 10min；It is centrifuged 5min under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, in supernatant, adds 2 times of volume absolute ethyl alcohols, mix Room temperature places 5min afterwards；It is centrifuged 5min under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, abandon supernatant, precipitation concentration (v/v) Dry after ethanol washing for 70%；Add 30 μ l contain rnase (20 μ g/ml) te (10mm tris-hcl, 1mm edta, Ph8.0) dissolution precipitation；Water-bath 30min at 37 DEG C of temperature, digests rna；In temperature, -20 DEG C save backup.

The plasmid extracting, after ahdi and xhoi digestion identification, carries out sequence verification to positive colony, and result shows to recombinate In cloning vector dbn01-t, the described vip3a-01 nucleotides sequence of insertion is classified as the nucleosides shown in seq id no:2 in sequence table Acid sequence, that is, vip3a-01 nucleotide sequence be correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector dbn01-t, by the described vip3a-02 nucleotide sequence of synthesis It is connected on cloning vector pgem-t, obtains recombinant cloning vector dbn02-t, wherein, vip3a-02 is vip3a-02 nucleotides sequence Row (seq id no:4).Described in digestion and sequence verification recombinant cloning vector dbn02-t, vip3a-02 nucleotide sequence is correct Insertion.

According to the method for above-mentioned structure recombinant cloning vector dbn01-t, the described cry1ab nucleotide sequence of synthesis is connected Enter on cloning vector pgem-t, obtain recombinant cloning vector dbn03-t, wherein, cry1ab is cry1ab nucleotide sequence (seq id no:8).Described in digestion and sequence verification recombinant cloning vector dbn03-t, cry1ab nucleotide sequence is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector dbn01-t, by the described cry1ab+vip3a nucleotides of synthesis Sequence is connected on cloning vector pgem-t, obtains recombinant cloning vector dbn04-t, and wherein, cry1ab+vip3a is cry1ab+ Vip3a nucleotide sequence (seq id no:10).Cry1ab+ described in digestion and sequence verification recombinant cloning vector dbn04-t Vip3a nucleotide sequence is correctly inserted into.

2nd, build the recombinant expression carrier containing vip3a gene

With restriction enzyme scai and spei digestion recombinant cloning vector dbn01-t and expression vector dbnbc-01 respectively (carrier framework: pcambia2301 (cambia mechanism can provide)), the vip3a-01 cutting nucleotide sequence fragment is inserted into Between scai the and spei site of expression vector dbnbc-01, it is people in the art using conventional enzymatic cleavage methods carrier construction Known to member, it is built into recombinant expression carrier dbn100002, it builds flow process (kan: kanamycin gene as shown in Figure 2； Rb: right margin；Ubi: corn ubiquitin (ubiquitin) gene promoter (seq id no:13)；Vip3a-01:vip3a-01 core Nucleotide sequence (seq id no:2)；The terminator (seq id no:14) of no: rouge alkali synthetase gene；Hpt: hygromycin phosphorus Sour transferase gene (seq id no:15)；Lb: left margin).

Recombinant expression carrier dbn100002 is converted Escherichia coli t1 competent cell, its hot shock condition with heat shock method For 50 μ l Escherichia coli t1 competent cells, 10 μ l plasmid dnas (recombinant expression carrier dbn100002), 42 DEG C of water-baths 30 seconds； 37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speed)；Then in the lb of kanamycins containing 50mg/l (kanamycin) On solid plate (tryptone 10g/l, yeast extract 5g/l, nacl 10g/l, agar 15g/l adjust ph to 7.5 with naoh) Cultivate 12 hours under the conditions of 37 DEG C of temperature, picking white colony, in lb fluid nutrient medium, (tryptone 10g/l, yeast extracts Thing 5g/l, nacl 10g/l, kanamycins 50mg/l, adjust ph to 7.5 with naoh) under the conditions of 37 DEG C of temperature overnight incubation. Its plasmid of alkalinity extraction.By the plasmid extracting with identifying after restriction enzyme scai and spei digestion, and positive colony is entered Row sequencing identification, result shows that nucleotides sequence between scai and spei site for the recombinant expression carrier dbn100002 is classified as sequence Nucleotide sequence, i.e. vip3a-01 nucleotide sequence shown in seq id no:2 in table.

According to the method for above-mentioned structure recombinant expression carrier dbn100002, by scai and spei, ncoi and bamhi digestion The described vip3a-01 nucleotide sequence that recombinant cloning vector dbn01-t and dbn03-t cuts and cry1ab nucleotide sequence are inserted Enter expression vector dbnbc-01, obtain recombinant expression carrier dbn100003.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in dbn100003 contains seq id no:2 and nucleotide sequence shown in seq id no:8 in promising sequence table, I.e. vip3a-01 nucleotide sequence and cry1ab nucleotide sequence, described vip3a-01 nucleotide sequence and described cry1ab nucleosides Acid sequence can connect described ubi promoter and no terminator.

According to the method for above-mentioned structure recombinant expression carrier dbn100002, by scai and spei digestion recombinant cloning vector The described vip3a-02 nucleotide sequence insertion expression vector dbnbc-01 that dbn02-t cuts, obtains recombinant expression carrier dbn100740.Nucleotide sequence in digestion and sequence verification recombinant expression carrier dbn100740 contains seq in promising sequence table Nucleotide sequence shown in id no:4, i.e. vip3a-02 nucleotide sequence, described vip3a-02 nucleotide sequence can connect described Ubi promoter and no terminator.

According to the method for above-mentioned structure recombinant expression carrier dbn100002, by spei and kasi digestion recombinant cloning vector The described cry1ab+vip3a nucleotide sequence insertion expression vector dbnbc-01 that dbn04-t cuts, obtains recombinant expression carrier dbn100736.Nucleotide sequence in digestion and sequence verification recombinant expression carrier dbn100736 contains seq in promising sequence table Nucleotide sequence shown in id no:10, i.e. cry1ab+vip3a nucleotide sequence, described cry1ab+vip3a nucleotide sequence can To connect described ubi promoter and no terminator.

3rd, recombinant expression carrier conversion Agrobacterium

To oneself constructed correct recombinant expression carrier dbn100002 and dbn100003, dbn100740 and dbn100736 It is transformed in Agrobacterium lba4404 (invitrgen, chicago, usa, cat:18313-015) with liquid nitrogen method, its conversion condition For: 100 μ l Agrobacterium lba4404,3 μ l plasmid dna (recombinant expression carrier)；It is placed in 10 minutes in liquid nitrogen, 37 DEG C of tepidariums 10 Minute；Agrobacterium lba4404 after conversion is inoculated in lb test tube under the conditions of 28 DEG C of temperature, rotating speed are for 200rpm, cultivate 2 Hour, it is applied on rifampin (rifampicin) containing 50mg/l and the lb flat board of kanamycins (kanamycin) of 100mg/l Until growing positive monoclonal, picking Colony Culture simultaneously extracts its plasmid, with restriction enzyme styi and aatii to restructuring Carry out digestion verification, result shows after expression vector dbn100002 and dbn100003, dbn100740 and dbn100736 digestion Recombinant expression carrier dbn100002 and dbn100003, dbn100740 and dbn100736 structure are completely correct.

3rd embodiment, the acquisition of transfer-gen plant

1st, obtain transgenic corn plant

According to the conventional Agrobacterium infestation method adopting, by the callus of comprehensive for the corn variety of sterile culture 31 (z31) with In second embodiment, the Agrobacterium described in 3 co-cultures, by the recombinant expression carrier dbn100002 of 2 structures in second embodiment With in dbn100003, dbn100740 and dbn100736 t-dna (include corn ubiquitin gene promoter sequence, Vip3a-01 nucleotide sequence, vip3a-02 nucleotide sequence, cry1ab+vip3a nucleotide sequence, cry1ab nucleotides sequence Row, hpt gene and no terminator sequence) it is transferred in maize chromosome group, obtain and proceed to vip3a-01 nucleotide sequence Milpa, the milpa of vip3a-02 nucleotide sequence, proceed to the milpa of vip3a-01-cry1ab nucleotide sequence With the milpa proceeding to cry1ab+vip3a nucleotide sequence；Simultaneously using wild-type corn plant as comparison.

For agriculture bacillus mediated corn transformation, briefly, separate immature rataria from corn, suspended with Agrobacterium Liquid contacts rataria, and wherein Agrobacterium can be by vip3a-01 nucleotide sequence, vip3a-02 nucleotide sequence, vip3a-01- Cry1ab nucleotide sequence and cry1ab+vip3a nucleotide sequence are transferred at least one cell (step 1: invade of one of rataria Dye step), in this step, rataria preferably immerses agrobacterium suspension (od₆₆₀=0.4-0.6, infects culture medium (ms salt 4.3g/l, ms vitamin, casein 300mg/l, sucrose 68.5g/l, glucose 36g/l, acetosyringone (as) 40mg/l, 2, 4- dichlorphenoxyacetic acid (2,4-d) 1mg/l, ph5.3)) in start inoculation.Rataria co-cultures one period (3 with Agrobacterium My god) (step 2: co-culture step).Preferably, after infecting step, in solid medium, (ms salt 4.3g/l, ms tie up him to rataria Life, casein 300mg/l, sucrose 20g/l, glucose 10g/l, acetosyringone (as) 100mg/l, 2,4 dichlorophenoxyacetic acid (2,4-d) 1mg/l, agar 8g/l, ph5.8) upper culture.After the here co-cultivation stage, can there is one selective " recovery " Step.In " recovery " step, recovery media (ms salt 4.3g/l, ms vitamin, casein 300mg/l, sucrose 30g/l, 2, 4- dichlorphenoxyacetic acid (2,4-d) 1mg/l, plant gel 3g/l, ph5.8) at least exist a kind of oneself know suppression Agrobacterium life Long antibiotic (cephalosporin), the selective agent (step 3: recovering step) without vegetable transformant.Preferably, rataria is having Antibiotic but do not have to cultivate on the solid medium of selective agent, to eliminate Agrobacterium and to provide convalescence for infected cell.Then, Transformed calli (the step 4: choosing that the rataria of inoculation is cultivated on the culture medium containing selective agent (hygromycin) and growth selection Select step).Preferably, rataria is having the screening solid medium of selective agent (ms salt 4.3g/l, ms vitamin, casein 300mg/l, sucrose 30g/l, hygromycin 50mg/l, 2,4- dichlorphenoxyacetic acid (2,4-d) 1mg/l, plant gel 3g/l, Ph5.8) the upper cell selective growth cultivated, lead to conversion.Then, callus regeneration becomes plant (step 5: regeneration step Suddenly) it is preferable that the callus of growth is in solid medium (ms differential medium and ms life on the culture medium containing selective agent Root culture medium) above cultivate with aftergrowth.

Screen the resistant calli obtaining and transfer to described ms differential medium (ms salt 4.3g/l, ms vitamin, cheese Plain 300mg/l, sucrose 30g/l, 6-benzyladenine 2mg/l, hygromycin 50mg/l, plant gel 3g/l, ph5.8) on, 25 DEG C Lower culture differentiation.Differentiation seedling out transfers to described ms root media (ms salt 2.15g/l, ms vitamin, casein 300mg/l, sucrose 30g/l, indole-3-acetic acid 1mg/l, plant gel 3g/l, ph5.8) on, cultivate at 25 DEG C to about 10cm Height, moves to hot-house culture extremely solid.In greenhouse, cultivate 16 hours at 28 DEG C daily, cultivate 8 hours at 20 DEG C.

2nd, obtain Transgenic Sorghum plant

Chinese sorghum with reference to molecular biology and genetic engineering issn 2053-5767 turns Change method.Collect the seed of sorghum variety apki, and rinsed for several times with clear water；It is soaked in 5 minutes in tween-20 immersion fluid；It Suspended with distilled water afterwards and clean, and be dried in fume hood；The surface of the seed 70% (v/v) ethanol disinfection 30 seconds, and then uses 0.1 (w/v) %hgcl2 sterilizes 6 minutes；Cleaned 5-6 time with distilled water again；Seed is laid on containing ms basis solid medium (ph5.8) in culture dish, by culture dish be placed in temperature be 24 ± 2 DEG C, relative humidity be 70%, the photoperiod (light dark) be In between the culture of 12:12；After 3-5 days, germination, take stem apex explant to be soaked in 30 minutes in Agrobacterium；Take out after soaking Explant be placed on sterilized filter paper；Co-culture 72 hours under dark condition；Callus is with containing 500mg/l cephalo The sterile water wash of mycin 3-5 time；Callus after cleaning is transferred on inducing culture and cultivates 7 days；Transfer to sieve Select 2-3 week on culture medium, repeat to screen 3 times；Kanamycin-resistant callus tissue is transferred on regeneration culture medium；Regenerate blade etc., by seedling Move on root media, transplant after under growth root to greenhouse.Culture medium prescription is with reference to molecular biology and Genetic engineering issn 2053-5767, wherein selective agent, according to used by transgene carrier in the present invention, is changed For hygromycin.Thereby is achieved and proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to vip3a-02 nucleotide sequence Sorghum plant, proceed to the sorghum plant of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a nucleotide sequence Sorghum plant；Simultaneously using wild type sorghum plant as comparison.

3rd, obtain transgenic sugarcane plant

Page 22 to page 24 of the bright academic dissertation of 2012 grades of master Lee of method for transformation Primary Reference Guangxi University.Take sugarcane top Newborn stipes, removes the sugarcane tip and leaf sheath, leaves stem apex growth cone and lobus cardiacus stem section.On superclean bench, with 75% (v/v) wine Smart cotton balls carries out cleaning disinfection to surface, carefully peels off lobus cardiacus outer layer with sterilized tweezers, takes the lobus cardiacus of middle 5 7cm length Section, the thin slice of crosscutting one-tenth thickness about 3mm is inoculated on inducing culture, under the conditions of 26 DEG C of temperature, dark culturing 20 days.Select life The all right callus of length transfers to preculture 4 days in new ms culture medium, is used further to conversion test；During conversion, super In net workbench, callus to be infected is pressed from both sides out with sterilized tweezers, be placed on and stand 2 hours above clean filter paper, extremely Surface is completely dried, and slightly shrinks；The sugarcane callus being dried are put into infect in liquid and soaks 30 minutes, be placed on shaking table simultaneously Upper slow shake；Callus is pulled out and transfers on clean filter paper, dry up completely in superclean bench, until callus Tissue surface drying, no moisture film.Callus lines are cut into the fritter of 0.6*0.6cm, transfer to afterwards containing 100 μm of ol/l second In the mr solid medium of acyl syringone (as), 23 DEG C of light culture of temperature 3 days；Callus after infecting is pressed from both sides out, is placed in filter Dry up on superclean bench on paper, after material surface is dry and comfortable, transfer material into containing 500mg/l cephalosporin and tide In the differential medium of mycin screening；Change a subculture every 2 weeks, period rejects contaminated callus, works as children Seedling be about 3cm high when, transfer to root induction in the root media containing hygromycin selection agent.Thereby is achieved and proceed to The sugarcane plant of vip3a-01 nucleotide sequence, proceed to the sugarcane plant of vip3a-02 nucleotide sequence, proceed to vip3a-01- The sugarcane plant of cry1ab nucleotide sequence and the sugarcane plant proceeding to cry1ab+vip3a nucleotide sequence；Simultaneously with wild type Sugarcane plant is as comparison.

Fourth embodiment, verify transfer-gen plant with taqman

Take the milpa proceeding to vip3a-01 nucleotide sequence, the corn plant proceeding to vip3a-02 nucleotide sequence respectively Strain, proceed to the milpa of vip3a-01-cry1ab nucleotide sequence and the corn proceeding to cry1ab+vip3a nucleotide sequence The blade of plant about 100mg, as sample, extracts its genome dna with the dneasy plant maxi kit of qiagen, passes through Taqman fluorescence probe quantitative pcr method detects the copy number of vip3a gene and cry1ab gene.Planted with wild-type corn simultaneously Strain, as comparison, is tested and analyzed according to the method described above.Experiment sets 3 repetitions, averages.

The concrete grammar of detection vip3a gene and cry1ab gene copy number is as follows:

Step 11, take respectively and proceed to the milpa of vip3a-01 nucleotide sequence, proceed to vip3a-02 nucleotide sequence Milpa, proceed to the milpa of vip3a-01-cry1ab nucleotide sequence, proceed to cry1ab+vip3a nucleotide sequence Milpa and wild-type corn plant each 100mg of blade, be ground into homogenate with liquid nitrogen in mortar respectively, each sample takes 3 repetitions；

Step 12, using qiagen dneasy plant mini kit extract above-mentioned sample genome dna, specifically Method is with reference to its product description；

Step 13, measure the genome dna concentration of above-mentioned sample with nanodrop 2000 (thermo scientific)；

, to same concentration value, the scope of described concentration value is 80- for step 14, the genome dna concentration of the above-mentioned sample of adjustment 100ng/μl；

Step 15, using taqman fluorescence probe quantitative pcr method identify sample copy number, with through identification known to copy As standard items, using the sample of wild-type corn plant as comparison, 3, each sample repeats the sample of shellfish number, takes it average Value；Fluorescent quantitation pcr primer and probe sequence are respectively:

Following primer and probe are used for detecting the nucleotide sequence of vip3a-01 and vip3a-02:

Primer 1:attctcgaaatctcccctagcg is as shown in seq id no:16 in sequence table；

Primer 2: gctgccagtggatgtccag is as shown in seq id no:17 in sequence table；

Probe 1:ctcctgagccccgagctgattaacacc is as shown in seq id no:18 in sequence table；

Following primer and probe are used for detecting cry1ab nucleotide sequence:

Primer 3:tgcgtattcaattcaacgacatg is as shown in seq id no:19 in sequence table；

Primer 4:cttggtagttctggactgcgaac is as shown in seq id no:20 in sequence table；

Probe 2:cagcgccttgaccacagctatccc is as shown in seq id no:21 in sequence table；

Following primer and probe are used for detecting cry1ab+vip3a nucleotide sequence:

Primer 5:ccgagcttcatcgactacttcaac is as shown in seq id no:22 in sequence table；

Primer 6:ctcgtccagggtcaggtcg is as shown in seq id no:23 in sequence table；

Probe 3:ccaccggcatcaaggacatcatgaac is as shown in seq id no:24 in sequence table；

Pcr reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of every kind of primer, probe 50 μ of 100 μm of concentration of 1mm concentration L and 860 μ l 1 × te buffer solutions, and at 4 DEG C, be housed in amber tube.

Pcr reaction condition is:

Using sds2.3 software (applied biosystems) analyze data.

Test result indicate that, vip3a-01 nucleotide sequence, vip3a-02 nucleotide sequence, vip3a-01-cry1ab core All oneself is incorporated in the genome of detected milpa for nucleotide sequence and cry1ab+vip3a nucleotide sequence, Er Qiezhuan Enter the milpa of vip3a-01 nucleotide sequence, proceed to the milpa of vip3a-02 nucleotide sequence, proceed to vip3a-01- The milpa of cry1ab nucleotide sequence all obtains with the milpa proceeding to cry1ab+vip3a nucleotide sequence and singly copies The transgenic corn plant of shellfish.

According to the above-mentioned method verifying transgenic corn plant with taqman, to Transgenic Sorghum plant, transgenic sugarcane Plant is tested and analyzed.Test result indicate that, vip3a-01 nucleotide sequence, vip3a-02 nucleotide sequence, vip3a-01- All oneself is incorporated into detected sorghum plant and sugarcane respectively for cry1ab nucleotide sequence and cry1ab+vip3a nucleotide sequence In the genome of plant, and proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to vip3a-02 nucleotide sequence Sorghum plant, proceed to the sorghum plant of vip3a-01-cry1ab nucleotide sequence, proceed to cry1ab+vip3a nucleotide sequence Sorghum plant, proceed to vip3a-01 nucleotide sequence sugarcane plant, proceed to vip3a-02 nucleotide sequence sugarcane plant, The sugarcane plant proceeding to vip3a-01-cry1ab nucleotide sequence and the sugarcane plant proceeding to cry1ab+vip3a nucleotide sequence All obtain the transfer-gen plant of single copy.

5th embodiment, the insect resistant effect detection of transfer-gen plant

By the milpa proceeding to vip3a-01 nucleotide sequence, the milpa proceeding to vip3a-02 nucleotide sequence, The milpa proceeding to vip3a-01-cry1ab nucleotide sequence and the corn proceeding to cry1ab+vip3a nucleotide sequence are planted Strain；Proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to the sorghum plant of vip3a-02 nucleotide sequence, proceed to The sorghum plant of vip3a-01-cry1ab nucleotide sequence and the sorghum plant proceeding to cry1ab+vip3a-01 nucleotide sequence； The sugarcane plant proceeding to vip3a-01 nucleotide sequence, the sugarcane plant proceeding to vip3a-02 nucleotide sequence, proceed to vip3a- The sugarcane plant of 01-cry1ab nucleotide sequence and the sugarcane plant proceeding to cry1ab+vip3a nucleotide sequence；Wild accordingly Raw type milpa, sorghum plant and sugarcane plant, and it is accredited as not genetically modified milpa, sorghum plant through taqman Carry out insect resistant effect detection with sugarcane plant pair striped stem borer.

1st, the insect resistant effect detection of transgenic corn plant

Take the milpa proceeding to vip3a-01 nucleotide sequence, the corn plant proceeding to vip3a-02 nucleotide sequence respectively Strain, proceed to vip3a-01-cry1ab nucleotide sequence milpa, proceed to cry1ab+vip3a nucleotide sequence corn plant Strain, wild-type corn plant and the fresh blade being accredited as not genetically modified milpa (expansion tender leaf) through taqman, with no Bacterium water is rinsed well and is blotted the water on blade with gauze, then maize leaf is cut into the strip of about 1cm × 2cm, takes 1 Strip blade after piece is cut is put on the moisturizing filter paper of round plastic culture dish bottom, puts 10 head height fine strain of millet bars in each culture dish Snout moth's larva (newly hatched larvae), after worm examination culture dish is added a cover, in temperature 22-26 DEG C, relative humidity 70%-80%, photoperiod (light dark) 0: After placing 3 days under conditions of 24, according to striped stem borer larvae development progress, the death rate and three indexs of blade injury rate, obtain Resistance total score (300 points of full marks): the resistance total score=100 × death rate+[100 × death rate+90 × (just incubate borer population/connect worm total Number)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- leaf Piece damage ratio).Proceed to totally 3 transformation event strains (s1, s2 and s3) of vip3a-01 nucleotide sequence, proceed to vip3a-02 core Totally 3 transformation event strains (s4, s5 and s6) of nucleotide sequence, proceed to totally 3 turns of vip3a-01-cry1ab nucleotide sequence Change event strain (s7, s8 and s9), proceed to cry1ab+vip3a nucleotide sequence totally 3 transformation event strains (s10, s11 and S12), it is accredited as not genetically modified (ngm1) totally 1 strain, (ck1) totally 1 strain of wild type through taqman；From each strain System selects 3 plants to be tested, and every plant is repeated 6 times.Result is as shown in table 1 and Fig. 3.

Table 1, transgenic corn plant inoculate the pest-resistant experimental result of striped stem borer

The result of table 1 shows: proceeds to the milpa of vip3a-01 nucleotide sequence, proceeds to vip3a-02 nucleotide sequence Milpa, proceed to the milpa of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a nucleotides sequence The milpa of row is respectively provided with preferable insecticidal effect to striped stem borer, and the average mortality of striped stem borer is substantially all 70% More than, part even up to 100%, also substantially all at 270 points about, part is even up to 299 points to its resistance total score；And warp Taqman is accredited as the resistance total score of not genetically modified milpa and wild-type corn plant typically at 20 points about.

The result of Fig. 3 shows: compared with wild-type corn plant, proceed to vip3a-01 nucleotide sequence milpa, The milpa proceeding to vip3a-02 nucleotide sequence, the milpa proceeding to vip3a-01-cry1ab nucleotide sequence and turn The milpa entering cry1ab+vip3a nucleotide sequence can cause the mortality of striped stem borer newly hatched larvae, and to a small amount of Survival larvae development progress causes greatly to suppress, and hypoevolutism shows extremely weak vitality simultaneously；And proceed to vip3a-01 The milpa of nucleotide sequence, proceed to the milpa of vip3a-02 nucleotide sequence, proceed to vip3a-01-cry1ab nucleosides The milpa of acid sequence is generally only subject to slight damage, quilt with the milpa proceeding to cry1ab+vip3a nucleotide sequence Take food area very little, its blade injury rate is all below 10%.

Thus prove proceed to the milpa of vip3a-01 nucleotide sequence, proceed to the corn of vip3a-02 nucleotide sequence Plant, the milpa proceeding to vip3a-01-cry1ab nucleotide sequence and the jade proceeding to cry1ab+vip3a nucleotide sequence Rice plant all shows the activity of high anti-striped stem borer, this activity enough to ill effect is produced to the growth of striped stem borer thus It is made to be controlled in field.Simultaneously the brill moth by controlling striped stem borer cause harm it is also possible to reduces disease on corn Raw, greatly improve yield and the quality of corn.

2nd, the insect resistant effect detection of transgenic sugarcane plant

Take the sugarcane plant proceeding to vip3a-01 nucleotide sequence, the sugarcane planting proceeding to vip3a-02 nucleotide sequence respectively Strain, proceed to the sugarcane plant of vip3a-01-cry1ab nucleotide sequence, proceed to the sugarcane planting of cry1ab+vip3a nucleotide sequence Strain, wild type sugarcane plant and the fresh blade being accredited as not genetically modified sugarcane plant (expansion tender leaf) through taqman, with no Bacterium water is rinsed well and is blotted the water on blade with gauze, then Sugarcane Leaves is cut into the strip of about 1cm × 2cm, takes 1 Strip blade after piece is cut is put on the moisturizing filter paper of round plastic culture dish bottom, puts 10 head height fine strain of millet bars in each culture dish Snout moth's larva (newly hatched larvae), after worm examination culture dish is added a cover, in temperature 22-26 DEG C, relative humidity 70%-80%, photoperiod (light dark) 0: After placing 3 days under conditions of 24, according to striped stem borer larvae development progress, the death rate and three indexs of blade injury rate, obtain Resistance total score (300 points of full marks): the resistance total score=100 × death rate+[100 × death rate+90 × (just incubate borer population/connect worm total Number)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- leaf Piece damage ratio).Proceed to totally 3 transformation event strains (s13, s14 and s15) of vip3a-01 nucleotide sequence, proceed to vip3a- Totally 3 transformation event strains (s16, s17 and s18) of 02 nucleotide sequence, proceed to vip3a-01-cry1ab nucleotide sequence Totally 3 transformation event strains (s19, s20 and s21), proceed to totally 3 transformation event strains of cry1ab+vip3a nucleotide sequence (s22, s23 and s24), is accredited as not genetically modified (ngm2) totally 1 strain, (ck2) totally 1 strain of wild type through taqman System；3 plants are selected to be tested from each strain, every plant is repeated 6 times.Result is as shown in table 2.

Table 2, transgenic sugarcane plant inoculate the pest-resistant experimental result of striped stem borer

The result of table 2 shows: proceeds to the sugarcane plant of vip3a-01 nucleotide sequence, proceeds to vip3a-02 nucleotide sequence Sugarcane plant, proceed to the sugarcane plant of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a nucleotides sequence The sugarcane plant pair striped stem borer of row is respectively provided with preferable insecticidal effect, and the average mortality of striped stem borer is substantially all 70% More than, part even up to 100%, also substantially all more than 250 points, part is even up to 299 points to its resistance total score；And warp Taqman is accredited as the resistance total score of not genetically modified sugarcane plant and wild type sugarcane plant typically at 50 points about.

Compared with wild type sugarcane plant, proceed to the sugarcane plant of vip3a-01 nucleotide sequence, proceed to vip3a-02 core The sugarcane plant of nucleotide sequence, proceed to the sugarcane plant of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a The sugarcane plant of nucleotide sequence can cause the mortality of striped stem borer newly hatched larvae, and a small amount of survival larvae development is entered Degree causes significantly to suppress, and growth retardation shows weaker vitality simultaneously, and proceeds to vip3a-01 nucleotide sequence Sugarcane plant, proceed to the sugarcane plant of vip3a-02 nucleotide sequence, proceed to the sweet of vip3a-01-cry1ab nucleotide sequence Sugarcane plant is generally only subject to slight damage with the sugarcane plant proceeding to cry1ab+vip3a nucleotide sequence, is taken food area very Little, its blade injury rate is all below 20%.

Thus prove proceed to the sugarcane plant of vip3a-01 nucleotide sequence, proceed to the sugarcane of vip3a-02 nucleotide sequence Plant, proceed to the sugarcane plant of vip3a-01-cry1ab nucleotide sequence and proceed to the sweet of cry1ab+vip3a nucleotide sequence Sugarcane plant all shows the activity of high anti-striped stem borer, this activity enough to ill effect is produced to the growth of striped stem borer thus It is made to be controlled in field.Simultaneously the brill moth by controlling striped stem borer cause harm it is also possible to reduces disease on sugarcane Raw, greatly improve yield and the quality of sugarcane.

3rd, the insect resistant effect detection of Transgenic Sorghum plant

Take the sorghum plant proceeding to vip3a-01 nucleotide sequence, the Chinese sorghum plant proceeding to vip3a-02 nucleotide sequence respectively Strain, proceed to vip3a-01-cry1ab nucleotide sequence sorghum plant, proceed to cry1ab+vip3a nucleotide sequence Chinese sorghum plant Strain, wild type sorghum plant and the fresh blade being accredited as not genetically modified sorghum plant (expansion tender leaf) through taqman, with no Bacterium water is rinsed well and is blotted the water on blade with gauze, then Sorghum Leaves is cut into the strip of about 1cm × 2cm, takes 1 Strip blade after piece is cut is put on the moisturizing filter paper of round plastic culture dish bottom, puts 10 head height fine strain of millet bars in each culture dish Snout moth's larva (newly hatched larvae), after worm examination culture dish is added a cover, in temperature 22-26 DEG C, relative humidity 70%-80%, photoperiod (light dark) 0: After placing 3 days under conditions of 24, according to striped stem borer larvae development progress, the death rate and three indexs of blade injury rate, obtain Resistance total score (300 points of full marks): the resistance total score=100 × death rate+[100 × death rate+90 × (just incubate borer population/connect worm total Number)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- leaf Piece damage ratio).Proceed to totally 3 transformation event strains (s25, s26 and s27) of vip3a-01 nucleotide sequence, proceed to vip3a- Totally 3 transformation event strains (s28, s29 and s30) of 02 nucleotide sequence, proceed to vip3a-01-cry1ab nucleotide sequence Totally 3 transformation event strains (s31, s32 and s33), proceed to totally 3 transformation event strains of cry1ab+vip3a nucleotide sequence (s34, s35 and s36), is accredited as not genetically modified (ngm3) totally 1 strain, (ck3) totally 1 strain of wild type through taqman System；3 plants are selected to be tested from each strain, every plant is repeated 6 times.Result is as shown in table 3.

Table 3, Transgenic Sorghum plant inoculate the pest-resistant experimental result of striped stem borer

The result of table 3 shows: proceeds to the sorghum plant of vip3a-01 nucleotide sequence, proceeds to vip3a-02 nucleotide sequence Sorghum plant, proceed to the sorghum plant of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a nucleotides sequence The sorghum plant of row is respectively provided with preferable insecticidal effect to striped stem borer, and the average mortality of striped stem borer is substantially all 60% More than, part even up to 100%, also substantially all more than 240 points, part is even up to 299 points to its resistance total score；And warp Taqman is accredited as the resistance total score of not genetically modified sorghum plant and wild type sorghum plant typically at 20 points about.

Compared with wild type sorghum plant, proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to vip3a-02 core The sorghum plant of nucleotide sequence, proceed to the sorghum plant of vip3a-01-cry1ab nucleotide sequence and proceed to cry1ab+vip3a The sorghum plant of nucleotide sequence can cause the mortality of striped stem borer newly hatched larvae, and a small amount of survival larvae development is entered Degree causes significantly to suppress, and growth retardation shows very weak vitality simultaneously, and proceeds to vip3a-01 nucleotide sequence Sorghum plant, proceed to the sorghum plant of vip3a-02 nucleotide sequence, proceed to and taken food area very little, the height of nucleotide sequence Fine strain of millet plant is generally only subject to slight damage with the sorghum plant proceeding to cry1ab+vip3a nucleotide sequence, is taken food area very Little, its blade injury rate is all below 20%.

Thus prove proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to the Chinese sorghum of vip3a-02 nucleotide sequence Plant, the sorghum plant proceeding to vip3a-01-cry1ab nucleotide sequence and the height proceeding to cry1ab+vip3a nucleotide sequence Fine strain of millet plant all shows the activity of high anti-striped stem borer, this activity enough to ill effect is produced to the growth of striped stem borer thus It is made to be controlled in field.Simultaneously the brill moth by controlling striped stem borer cause harm it is also possible to reduces disease on Chinese sorghum Raw, greatly improve yield and the quality of Chinese sorghum.

Above-mentioned experimental result also shows to proceed to the milpa of vip3a-01 nucleotide sequence, proceeds to vip3a-02 nucleotides The milpa of sequence, proceed to the milpa of vip3a-01-cry1ab nucleotide sequence, proceed to cry1ab+vip3a nucleotides The milpa of sequence, proceed to the sugarcane plant of vip3a-01 nucleotide sequence, proceed to the sugarcane of vip3a-02 nucleotide sequence Plant, proceed to the sugarcane plant of vip3a-01-cry1ab nucleotide sequence, proceed to the sugarcane of cry1ab+vip3a nucleotide sequence Plant, proceed to the sorghum plant of vip3a-01 nucleotide sequence, proceed to the sorghum plant of vip3a-02 nucleotide sequence, proceed to The sorghum plant of vip3a-01-cry1ab nucleotide sequence and proceed to the sorghum plant of cry1ab+vip3a nucleotide sequence to height Control/the preventing and treating of fine strain of millet bar snout moth's larva apparently because plant itself can produce vip3a albumen, so, well known to those skilled in the art, According to the identical toxic action to striped stem borer for the vip3a albumen, the transfer-gen plant of similar expressed vip3a albumen can be produced Can be used in controlling/prevent and treat the harm of striped stem borer.In the present invention, vip3a albumen includes but is not limited to institute in specific embodiment Provide the vip3a albumen of amino acid sequence, simultaneously transfer-gen plant can also produce at least one different from the of vip3a albumen Two kinds of insect-killing proteins, such as vip albuminoid, cry albuminoid.

In sum, the purposes of insecticidal proteins of the present invention passes through to produce the vip3a that can kill striped stem borer in plant body Albumen is controlling striped stem borer insect；Cultural control method, chemical prevention and control method and the physical control side using with prior art Method is compared, and the present invention carries out the infringement protected to prevent and treat striped stem borer insect of the time of infertility, whole plant to plant, and no dirty Dye, noresidue, effect stability, thoroughly, simple, convenient, economical.

It should be noted last that, above example only in order to technical scheme to be described and unrestricted, although ginseng According to preferred embodiment, the present invention is described in detail, it will be understood by those within the art that, can be to the present invention Technical scheme modify or equivalent, without deviating from the spirit and scope of technical solution of the present invention.

Claims

1. a kind of control striped stem borer insect method it is characterised in that include by striped stem borer insect at least with vip3a albumen Contact, the amino acid sequence of described vip3a albumen has shown in seq id no:1 or seq id no:3 or seq id no:5 Amino acid sequence.

2. the method controlling striped stem borer insect according to claim 1 is it is characterised in that described vip3a albumen exists In the host cell at least producing described vip3a albumen, described striped stem borer insect is by ingesting described host cell at least Contact with described vip3a albumen.

3. the method controlling striped stem borer insect according to claim 2 is it is characterised in that described vip3a albumen exists In the bacterium at least producing described vip3a albumen or genetically modified plants, described striped stem borer insect is by the described bacterium that ingests Or the tissue of described genetically modified plants is at least contacted with described vip3a albumen, described striped stem borer insect growth after contact is subject to Suppress and/or lead to death, to realize striped stem borer is endangered with the control of plant.

4. according to claim 3 control striped stem borer insect method it is characterised in that described plant be derived from corn, Sugarcane, Chinese sorghum, grain, fiber crops or the seed of Job's tears.

5. the method for the control striped stem borer insect according to any one of claim 2 to 4 is it is characterised in that described contact Step before step is the plant containing the polynucleotides encoding described vip3a albumen for the plantation.

6. the method controlling striped stem borer insect according to claim 5 is it is characterised in that the core of described vip3a albumen Nucleotide sequence has the nucleotide sequence shown in seq id no:2 or seq id no:4 or seq id no:6.

7. the method controlling striped stem borer insect according to claim 6 is it is characterised in that described plant is also included at least A kind of second nucleotides different from the nucleotides encoding described vip3a albumen.

8. the method controlling striped stem borer insect according to claim 7 is it is characterised in that described second nucleotides is compiled Code cry class insect-killing protein, vip class insect-killing protein, protease inhibitors, agglutinin, AMS or peroxidase.

9. the method controlling striped stem borer insect according to claim 8 is it is characterised in that described second nucleotides is compiled Code cry1ab albumen.

10. the method controlling striped stem borer insect according to claim 9 is it is characterised in that described cry1ab albumen Amino acid sequence has the amino acid sequence shown in seq id no:7 or seq id no:11.

11. methods controlling striped stem borer insects according to claim 10 are it is characterised in that described second nucleotides There is the nucleotide sequence shown in seq id no:8 or seq id no:12.

12. methods controlling striped stem borer insects according to claim 7 are it is characterised in that described second nucleotides Dsrna for important gene in suppression target insect pests.

13. according to claim 5 control striped stem borer insects methods it is characterised in that described plant also include to A kind of few second nucleotides different from the nucleotides encoding described vip3a albumen.

14. methods controlling striped stem borer insects according to claim 13 are it is characterised in that described second nucleotides Coding cry class insect-killing protein, vip class insect-killing protein, protease inhibitors, agglutinin, AMS or peroxidase.

15. methods controlling striped stem borer insects according to claim 14 are it is characterised in that described second nucleotides Coding cry1ab albumen.

16. methods controlling striped stem borer insects according to claim 15 are it is characterised in that described cry1ab albumen Amino acid sequence has the amino acid sequence shown in seq id no:7 or seq id no:11.

17. methods controlling striped stem borer insects according to claim 16 are it is characterised in that described second nucleotides There is the nucleotide sequence shown in seq id no:8 or seq id no:12.

18. methods controlling striped stem borer insects according to claim 13 are it is characterised in that described second nucleotides Dsrna for important gene in suppression target insect pests.

The method of the 19. control striped stem borer insects according to any one of claim 2 to 4 is it is characterised in that described plant Also include at least one second nucleotides different from the nucleotides encoding described vip3a albumen.

20. methods controlling striped stem borer insects according to claim 19 are it is characterised in that described second nucleotides Coding cry class insect-killing protein, vip class insect-killing protein, protease inhibitors, agglutinin, AMS or peroxidase.

21. methods controlling striped stem borer insects according to claim 20 are it is characterised in that described second nucleotides Coding cry1ab albumen.

22. methods controlling striped stem borer insects according to claim 21 are it is characterised in that described cry1ab albumen Amino acid sequence has the amino acid sequence shown in seq id no:7 or seq id no:11.

23. methods controlling striped stem borer insects according to claim 22 are it is characterised in that described second nucleotides There is the nucleotide sequence shown in seq id no:8 or seq id no:12.

24. methods controlling striped stem borer insects according to claim 19 are it is characterised in that described second nucleotides Dsrna for important gene in suppression target insect pests.

The method of the 25. control striped stem borer insects according to any one of Claims 1-4 is it is characterised in that described The nucleotide sequence of vip3a albumen has the nucleotides sequence shown in seq id no:2 or seq id no:4 or seq id no:6 Row.

26. according to claim 25 control striped stem borer insects methods it is characterised in that described plant also include to A kind of few second nucleotides different from the nucleotides encoding described vip3a albumen.

27. methods controlling striped stem borer insects according to claim 26 are it is characterised in that described second nucleotides Coding cry class insect-killing protein, vip class insect-killing protein, protease inhibitors, agglutinin, AMS or peroxidase.

28. methods controlling striped stem borer insects according to claim 27 are it is characterised in that described second nucleotides Coding cry1ab albumen.

29. methods controlling striped stem borer insects according to claim 28 are it is characterised in that described cry1ab albumen Amino acid sequence has the amino acid sequence shown in seq id no:7 or seq id no:11.

30. methods controlling striped stem borer insects according to claim 29 are it is characterised in that described second nucleotides There is the nucleotide sequence shown in seq id no:8 or seq id no:12.

31. methods controlling striped stem borer insects according to claim 26 are it is characterised in that described second nucleotides Dsrna for important gene in suppression target insect pests.

A kind of 32. vip3a protein control the purposes of striped stem borer insect it is characterised in that the amino acid of described vip3a albumen Sequence has the amino acid sequence shown in seq id no:1 or seq id no:3 or seq id no:5.

A kind of 33. methods producing the plant controlling striped stem borer insect are it is characterised in that include the genome to described plant The middle polynucleotide sequence introducing coding vip3a albumen, the amino acid sequence of described vip3a albumen have seq id no:1 or Amino acid sequence shown in seq id no:3 or seq id no:5.

34. a kind of method producing the propagulum controlling striped stem borer insect is it is characterised in that include by claim The first plant that 15 methods describeds obtain and the second plant hybridization, and/or take off the plant being obtained by claim 33 methods described The tissue in strain with fertility is cultivated, thus producing the plant of the polynucleotide sequence containing coding vip3a albumen Brood body.

A kind of 35. cultures control the method for the plant of striped stem borer insect it is characterised in that including:

Plant at least one propagulum, the genome of described propagulum includes encoding many nucleosides of vip3a albumen Acid sequence, the amino acid sequence of described vip3a albumen has shown in seq id no:1 or seq id no:3 or seq id no:5 Amino acid sequence；

Described propagulum is made to grow up to plant；

Make described plant raw under conditions of artificial infection striped stem borer insect and/or striped stem borer insect naturally-occurring harm Long, have compared with the plant that harvests the polynucleotide sequence that there is no coding vip3a albumen with other plant injury weakening and/ Or there is the plant of the plant products of increase.