CN108611362A - The purposes of insecticidal proteins - Google Patents

Abstract

The present invention relates to a kind of purposes of insecticidal proteins, including：Greenish brown hawk moth pest is at least contacted with Vip3Aa albumen.The present invention can kill the Vip3Aa albumen of greenish brown hawk moth to control greenish brown hawk moth pest by generation in plant；Compared with cultural control method, physical control method, biological control method and chemical prevention and control method that the prior art uses; the present invention carries out the protection in the time of infertility, whole plant to prevent the infringement of greenish brown hawk moth pest to plant; and pollution-free, noresidue; effect stability, thoroughly, it is simple, conveniently, it is economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, pass through the table in plant more particularly to a kind of Vip3Aa protein It reaches and causes harm the purposes of plant to control greenish brown hawk moth.

Background technology

Greenish brown hawk moth Clanis bilineata (walker), larva are commonly called as bean worm, beans pellet, beans cicada, belong to Lepidoptera day Moth section moire hawkmoth subfamily greenish brown hawk moth category, is distributed mainly on China's Huanghuai Area and the Yangtze river basin and South China, big in China The main producing region of beans is one of main Soybean Pests.Greenish brown hawk moth is explosive pest, and harm characteristics are：Larva gluttony blade, Less serious case's blade is snapped into hole, incises, and the strain of severe one beans remains petiole at polished rod, and cannot bear pods, and seriously affects yield.

The cultivated soybean (Glycine max (L.) Merri) is a kind of conduct vegetable oil and vegetable protein master of grown worldwide The Important Economic crop for wanting source is the important cereal crops of China.Greenish brown hawk moth is the primary pest for endangering soybean, every year because of beans Hawkmoth can cause different degrees of grain loss, less serious case's underproduction 1-2 at, severe one underproduction 3-4 at.In order to prevent greenish brown hawk moth, people The main method of generally use has cultural control, chemical prevention, physical control and biological control.

Cultural control be the multifactor comprehensive coordination management of entire farmland ecosystem, regulation and control crop, pest, environment because Element creates a farmland ecological environment for being conducive to plant growth and being unfavorable for greenish brown hawk moth generation.Such as select ripe evening, stalk it is hard, The strong kind of skin depth, Flood resistance, can mitigate causing harm for greenish brown hawk moth；Or autumn ploughing, winter irrigation in time, reduce hibernating base；Or Rice field-upland field rotation avoids continuous cropping legume as possible, is caused harm with mitigating.Because cultural control is mostly preventive measure, using having one Fixed limitation, cannot function as emergency measure, just seem helpless when greenish brown hawk moth is broken out.

Chemical prevention, that is, pesticide control is to kill pest using chemical insecticide, is the important of greenish brown hawk moth comprehensive treatment Component part, it have the characteristics that quickly, conveniently, easy and high economic benefit be especially in the case of the big generation of greenish brown hawk moth Essential emergency measure.Chemical prevention and control method is mainly medicine liquid spray and medicinal powder sprinkling at present, in killing bean hawkmoth larva 1-3 ages There is preferable control effect in period, and as polypide is bigger, drug resistance is stronger, and effect of chemical control is poorer, it will be difficult to reach prevention Purpose.Chemical prevention simultaneously also has its limitation, poisoning occurs as improper use frequently can lead to crops, pest generates and resists Pharmacological property, and killing natural enemy, pollution environment, make farmland ecosystem be constituted to the safety of people, animal by destruction and pesticide residue The adverse consequences such as threat.

The physical control mainly reaction according to pest to various physical factors in environmental condition, such as using various physical factors Light, electricity, color, humiture etc. and mechanical equipment trapped and killed, the methods of steriliation by irradiation carrys out pest control.It is most widely used at present Be frequency ventilating type insecticidal lamp trapping, it utilize adult pest phototaxis, closely use up, at a distance use wave, lure pest to lean on Closely, have the effect of to the prevention of greenish brown hawk moth adult certain；But frequency ventilating type insecticidal lamp needs daily cleaning high-voltage fence in time On dirt, otherwise can influence insecticidal effect；And it cannot turn on light in thundery sky, the danger hurted sb.'s feelings of operationally also shocking by electricity； In addition the disposably input of installation lamp is larger.

Biological control is to control pest population quantity using certain beneficial organisms or biological metabolic product, is reduced with reaching Or the purpose of pest is eliminated, such as greenish brown hawk moth is prevented with bacillus thuringensis or bacillus thruingensis.Its main feature is that people, animal safety, to environment dirt Dye is few, can reach the purpose controlled for a long time to certain pests；But effect is often unstable, no matter and greenish brown hawk moth occur weight it is equal Progress need to equally be invested.

In order to solve the limitation of cultural control, chemical prevention, physical control and biological control in practical applications, science Family by research find the anti insect gene for the encoding insecticidal proteins for coming from bacillus thuringiensis is transferred in plant, can obtain Some insect-resistant transgenic plants are obtained to prevent insect pest of the plant.Vip3Aa insecticidal proteins are one kind in numerous insecticidal proteins, be by The specific protein that bacillus thuringiensis generates.

Vip3Aa albumen is by exciting the apoptosis of apoptosis type to have poisoning effect to sensibility insect. Vip3Aa albumen is hydrolyzed to 4 kinds of major protein products in insect gut, wherein only a kind of protein hydrolysate (66KD) For the toxicity nuclear structure of Vip3Aa albumen.The midgut epithelial cell of Vip3Aa protein binding sensitive insects, active cell program Property it is dead, cause the dissolving of midgut epithelial cell to lead to insect death.Any illness is not generated to non-sensitive insect, will not be caused The apoptosis of midgut epithelial cell and dissolving.

The Lepidopteras such as black cutworm, bollworm and Spodopterafrugiperda can be resisted by being proved to turn the plant of Vip3Aa genes (Lepidoptera) infringement of pest, however, there is no so far about by generation express Vip3Aa albumen transfer-gen plant come The report that control greenish brown hawk moth causes harm to plant.

Invention content

The object of the present invention is to provide a kind of purposes of insecticidal proteins, provides for the first time and Vip3Aa albumen is expressed by generation Transfer-gen plant control method of the greenish brown hawk moth to plant hazard, and effectively overcome prior art cultural control, chemical prevention, The technological deficiencies such as physical control and biological control.

To achieve the above object, the present invention provides a kind of methods of control greenish brown hawk moth pest, including by greenish brown hawk moth pest At least contacted with Vip3Aa albumen.

Further, the Vip3Aa albumen is present in the host cell at least generating the Vip3Aa albumen, described Greenish brown hawk moth pest is at least contacted with the Vip3Aa albumen by the host cell of ingesting.

Further, the Vip3Aa albumen is present in the bacterium at least generating the Vip3Aa albumen or transgenosis is planted In object, the greenish brown hawk moth pest is at least connect with the Vip3Aa albumen by the tissue of the ingest bacterium or genetically modified plants It touches, the greenish brown hawk moth pest, which grows, after contact is suppressed and/or causes death, to realize the control for endangering greenish brown hawk moth plant System.

The genetically modified plants may be at arbitrary breeding time.

The genetically modified plants are organized as blade, stalk, fruit, tassel, female fringe, anther..

The control for endangering greenish brown hawk moth plant does not change because of the change of planting site and/or implantation time.

The plant is soybean, mung bean, cowpea and locust tree.

The step of before the contact procedure, contains the plant for the polynucleotides for encoding the Vip3Aa albumen to plant.

Preferably, the amino acid sequence of the Vip3Aa albumen has SEQ ID NO:1 or SEQ ID NO:Ammonia shown in 3 Base acid sequence.The nucleotide sequence of the Vip3Aa albumen has SEQ ID NO:2 or SEQ IDNO:Nucleotides sequence shown in 4 Row.

Based on the above technical solution, the plant can also include at least one different from encoding the Vip3Aa Second of nucleotide of the nucleotide of albumen.

Further, second of nucleotide coding Cry classes insect-killing protein, Vip classes insect-killing protein, protease suppression Preparation, agglutinin, alpha-amylase or peroxidase.

Preferably, second of nucleotide coding Cry1Ab or Cry2Ab albumen.

Further, the amino acid sequence of the Cry1Ab albumen has SEQ ID NO:Amino acid sequence shown in 5. The nucleotide sequence of the Cry1Ab albumen has SEQ ID NO:Nucleotide sequence shown in 6.The Cry2Ab albumen Amino acid sequence has SEQ ID NO:Amino acid sequence shown in 7.The nucleotide sequence of the Cry2Ab albumen has SEQ ID NO:Nucleotide sequence shown in 8.

Selectively, second of the nucleotide is the dsRNA for inhibiting important gene in target insect pests.

To achieve the above object, the present invention also provides the purposes that a kind of Vip3Aa protein controls greenish brown hawk moth pest.

To achieve the above object, the present invention also provides a kind of methods for the plant generating control greenish brown hawk moth pest, including The polynucleotide sequence of coding Vip3Aa albumen is introduced into the genome of the plant.

To achieve the above object, the present invention also provides a kind of sides for the propagulum generating control greenish brown hawk moth pest Method includes hybridizing the first plant obtained by the method with the second plant, and/or remove the plant obtained by the method The upper tissue with fertility is cultivated, to which the plant for generating the polynucleotide sequence containing coding Vip3Aa albumen is numerous Grow body.

To achieve the above object, the present invention also provides a kind of methods of the plant of culture control greenish brown hawk moth pest, including：

An at least propagulum is planted, the genome of the propagulum includes the more of coding Vip3Aa albumen Nucleotide sequence；

The propagulum is set to grow up to plant；

Keep the plant raw under conditions of artificial infection greenish brown hawk moth pest and/or greenish brown hawk moth pest naturally-occurring endanger Long, harvest has the plant injury weakened compared with the plant of other polynucleotide sequences for not having coding Vip3Aa albumen And/or the plant with increased plant products.

Heretofore described " propagulum " includes but not limited to plant tannins and plant vegetative propagule. The plant tannins include but not limited to vegetable seeds；The plant vegetative propagule refers to the nutrition organs of plant Or certain particular tissues, new plant can be generated in vitro；The nutrition organs or certain particular tissues include but It is not limited to root, stem and leaf, such as：Include strawberry and sweet potato etc. by the plant of vegetative propagule of root；Using stem as vegetative propagule Plant include sugarcane and potato (stem tuber) etc.；Include aloe and begonia etc. by the plant of vegetative propagule of leaf.

Heretofore described " contact " refers to touching, stops and/or ingest, and specially insect and/or pest touch, stop It stays and/or feeding plant, plant organ, plant tissue or plant cell, the plant, plant organ, plant tissue or plant Cell can also be the plant, plant organ, plant tissue or plant cell either its internal expression insecticidal proteins Surface is with insecticidal proteins and/or with the microorganism for generating insecticidal proteins.

" control " and/or " prevention " of the present invention refer to that greenish brown hawk moth pest at least contacts with Vip3Aa albumen, contact Greenish brown hawk moth pest growth afterwards is suppressed and/or causes death.Further, greenish brown hawk moth pest by feeding plant tissue at least It is contacted with Vip3Aa albumen, all or part of greenish brown hawk moth pest, which grows, after contact is suppressed and/or causes death.Inhibition refers to Sub- lethal, i.e., not yet lethal but certain effect that can cause growth and development, behavior, physiology, biochemistry and tissue etc. is such as grown Development is slow and/or stops.Meanwhile plant should be morphologically normal, and can under conventional approaches cultivate for product Consumption and/or generation.In addition, the plant of the control greenish brown hawk moth pest of the polynucleotide sequence containing coding Vip3Aa albumen And/or vegetable seeds, under conditions of artificial infection greenish brown hawk moth pest and/or greenish brown hawk moth pest naturally-occurring endanger, with non-turn The WT lines of gene compare with weaken plant injury, specific manifestation include but not limited to improve blade resistance and/ Or the kernel weight improved, and/or volume increase etc..Vip3Aa albumen is to " control " and/or " prevention " of greenish brown hawk moth effect can be with Self-existent, specifically, any tissue of genetically modified plants (polynucleotide sequence containing coding Vip3Aa albumen) is simultaneously And/or asynchronously, exist and/or generate, another substance of Vip3Aa albumen and/or controllable greenish brown hawk moth pest, then institute That states another substance cannot cause " control " and/or " prevention " effect complete and/or partly by described there are Vip3Aa Another substance realization, and it is unrelated with Vip3Aa albumen.Under normal conditions, in crop field, greenish brown hawk moth pest feeding plant tissue Process is of short duration and is difficult to observe with the naked eye, and therefore, endangers in artificial infection greenish brown hawk moth pest and/or greenish brown hawk moth pest naturally-occurring Under conditions of evil, as there is death in any tissue of genetically modified plants (polynucleotide sequence containing coding Vip3Aa albumen) Greenish brown hawk moth pest, and/or on it stop grow the greenish brown hawk moth pest being suppressed, and/or are planted with non-transgenic wild type At least by greenish brown hawk moth pest strain as realizes the method and/or purposes of the present invention, i.e., compared to the plant injury weakened It is contacted with Vip3Aa albumen to realize the method and/or purposes of control greenish brown hawk moth pest.

In the present invention, a kind of expression of the Vip3Aa albumen in genetically modified plants can be along with one or more Cry The expression of class insect-killing protein and/or Vip class insect-killing proteins.It is this to be planted in same strain transgenosis more than a kind of Pesticidal toxins Being co-expressed in object can make plant include and express required gene to realize by genetic engineering.In addition, a kind of plant ( 1 parent) Vip3Aa protein can be expressed by genetic engineering procedure, second of plant (the 2nd parent) can pass through hereditary work Journey operation expression Cry classes insect-killing protein and/or Vip class insect-killing proteins.Table is obtained by the 1st parent and the 2nd parents Up to the progeny plants for all genes for introducing the 1st parent and the 2nd parent.

RNA interference (RNAinterference, RNAi) refer to be highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, homologous mRNA efficient selective degradation the phenomenon that.Therefore in the present invention RNAi technology specific depletion can be used or close the expression of specific gene in target insect pests, especially and targeted insect The relevant gene of pest growth and development.

Greenish brown hawk moth at the long 40-46mm of polypide, wing expanse 100-120mm.Body and wing yellowish-brown, cephalothorax mulberry.Fore wing It is long and narrow, there is the wave-like cross striation of 6 heavy colours.Hind wing is small, crineous, and wing base outer rim has a yellowish-brown ribbon stripe.Ovum is spherical in shape, diameter 2-3mm, the yolk white of primiparity, becomes brown before hatching, aging.Larva body is about 90mm, yellow green.There is a yellow green on head Protrusion, pereiopoda 4 is right, and uropodium 1 is right.There is a yellow green caudal horn in tail portion.Pupal cell long 40-45mm, wide 15mm, spindle, bronzing, abdomen Portion's implication obviously protrudes, in fishing sigmoid.

A generation (Hebei, Shandong, Jiangsu, Anhui) occurs for greenish brown hawk moth to two generations (Hubei, Jiangxi), with mature larva for 1 year The depths 9-12cm is overwintering in soil, the area without shade such as head dunghill side, ridge more hidden in beans field or near legume, next year Spring warms up the native native room of table work of larva rising and pupates.Beginning late June sees that adult, adult are hidden by day and come out at night, and is hidden in honeysuckle or growth daytime In dense crops and weeds clump.It comes into play at dusk, power of circling in the air is strong, and migration is big, can suddenly fly in tens meters of high-altitudes, night Mating, 3h can lay eggs after mating, and 1 ovum, 7 days or so ovum phase, production oviposition 320-380 per moth are produced on general 1 leaf.August For larva peak period, larvae underwent 5 instars, first larvae has negative phototropism, blade back of hiding daytime, night feeding, and the cloudy day causes harm all day.1- 2 ages caused harm top bite leaf margin at incising, and did not migrated generally.3-4 age appetite increases, and can also turn strain and cause harm.5 instar larvaes are gluttonies Stage accounts for about the 90% of larval phase appetite.September larva buries overwintering.

In categorizing system, generally mainly according to morphological features such as the types of the nervuration of adult wing, linkage mode and feeler, Lepidoptera is divided into suborder, Superfamily, section etc..Sphingidae is a section for Lepidoptera, has more than 200 under its command and belongs to, about 1450 kinds, in About 150 kinds known to state.Undergraduate course insect is generally called hawkmoth, and most of Sphingidae build is larger, and fore wing is big and long and narrow, wing apex angle Point, feeler is slightly thick, and compound eye is big, and beak is flourishing, such as maduca sexta and greenish brown hawk moth.Although maduca sexta (Manduca sexta) and beans Hawkmoth (Clanis bilineata) belongs to Lepidoptera Sphingidae, in addition to there are similitudes in criteria for classification, in other shapes Then there is huge difference in state structure；Like the strawberry in plant (the Rosales rose family is belonged to as apple), they There are colored both sexes, radiation symmetric, the features such as 5, petal, but its fruit and plant forms are multifarious.Greenish brown hawk moth is not Pipe is that all have its unique feature from Larva Morpho. Logy or adult form.Such as greenish brown hawk moth chest back side center has 1 Dark brown ordinate, fore wing are more simple brown, and there is 1 small-sized triangle dark brown spot in wing end；And belong to day The maduca sexta head and chest of moth section have thinner dark brown, and belly back side, which respectively saves rear, has brownish black band, fore wing narrow Long, there is larger semicircle breen color spot in the nearly center of leading edge；There are hypercolour spot in hind wing crineous, base portion top.So in appearance Slight difference, what is embodied in fact is the fundamental difference in individual reproduction and group's procreation.Belong to the insect of Sphingidae not only There are larger differences in morphological feature, while on feeding habit, and there is also differences.Such as greenish brown hawk moth is distributed mainly on China Huanghuai Area and the Yangtze river basin and South China, main harm soybean, mung bean, cowpea, locust tree, acacia, Chinese wistaria and Pueraria lobota category, Li Dou The plants such as belong to, and be all that the maduca sexta of Sphingidae then mainly lives in America, is mainly food with the leaf of plant of Solanaceae and stem. The difference of feeding habit implies enzyme caused by internal digestive system and receptor protein difference.And the enzyme generated in alimentary canal The key point that Bt genes work, only can with the protein bound enzymes of specific b t or receptor protein, be possible to so that Some Bt gene pairs pest is with insect resistant effect.More and more studies have shown that not equal with mesh, even equal not of the same race Insect is different to the sensitive sex expression of Bt albumen of the same race.Such as the striped rice borer Chilo of Vip3Aa gene pairs Pyralidaes Suppressalis and Ostrinia furnacalis Ostrinia furnacalis show anti-insect activity, but for belonging to snout moth's larva Indian meal moth Plodia interpunctella and European corn borer the Ostrinia nubilalis of moth section are but without pest-resistant effect Fruit.Above-mentioned several pests belong to lepidoptera pyralidae, but Bt albumen of the same race these types of Pyralidae pest is shown it is different Resistance effect.Especially European corn borer and Ostrinia furnacalis belong to (same mesh in the upper Pyralidae Ostrinia that even belongs to of classification It is equal to belong to), but it is completely different to the reaction of Bt albumen of the same race, has more absolutely proved Bt albumen and insect bodies The interaction mode of interior enzyme and receptor is complicated and is difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and include nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotide form complete " gene ", are encoded in required host cell Protein or polypeptide.The polynucleotides of the present invention and/or nucleotide it is readily appreciated that can be placed in by those skilled in the art Under regulating and controlling sequence control in purpose host.

Well-known to those skilled in the art, DNA typically exists with double-stranded form.In this arrangement, chain with Another chain complementation, vice versa.Other complementary strands of DNA are produced since DNA is replicated in plant.In this way, packet of the present invention Include the use to exemplary polynucleotides and its complementary strand in sequence table." coding strand " that this field is often used refers to be chained with antisense The chain of conjunction.In order to express protein in vivo, a chain of DNA is transcribed into the complementary strand of a mRNA by typical case, it is as mould Plate translates protein.MRNA is actually to be transcribed from " antisense " chain of DNA." ariyoshi " or " coding " chain has a series of passwords Son (codon is three nucleotide, and primary reading three can generate specific amino acids), can be used as open reading frame (ORF) and reads It reads to form target protein or peptide.The invention also includes the RNA for having suitable function with exemplary DNA.

Nucleic acid molecule of the present invention or its segment under strict conditions with Vip3Aa gene recombinations of the present invention.It is any conventional Nucleic acid hybridization or amplification method may be used to identify the presence of Vip3Aa genes of the present invention.Nucleic acid molecules or its segment are certain In the case of can with other nucleic acid molecules carry out specific hybrid.In the present invention, if two nucleic acid molecules can be formed it is antiparallel Double-strandednucleic acid structure, so that it may to say that the two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid point Son shows complete complementarity, then it is another nucleic acid molecules " complement " to claim one of nucleic acid molecules.In the present invention, When the corresponding nucleotide mutual added time of each nucleotide and another nucleic acid molecules of a nucleic acid molecules, then claim the two cores Acid molecule is shown " complete complementarity ".If two nucleic acid molecules can be with enough stability phase mutual crosses to make them It anneals and is bonded to each other under the conditions of at least conventional " low stringent ", then the two nucleic acid molecules are referred to as that " minimum level is mutual It mends ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses to make them in conventional " height It anneals and is bonded to each other under the conditions of strictly ", then claim the two nucleic acid molecules that there is " complementarity ".Deviateing from complete complementarity is It can allow, as long as this deviation not exclusively prevents two molecules from forming duplex structure.In order to enable a nucleic acid molecules As primer or probe, it is only necessary to it is adequately complementary to ensure that it has in sequence so that in used specific solvent and Stable duplex structure can be formed under salinity.

In the present invention, substantially homologous sequence is one section of nucleic acid molecules, which can under high stringency Specific hybrid occurs with the complementary strand of another section of nucleic acid molecules to match.Promote the suitable stringent condition of DNA hybridization, example Such as, it is about handled with 6.0 × sodium chloride/sodium citrate (SSC) under the conditions of 45 DEG C, then with 2.0 × SSC under the conditions of 50 DEG C Washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected from minuent sternly About 2.0 × SSC of glazing bar part, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature in washing step Condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of the room temperature of Low stringency conditions.Temperature condition and salt are dense Degree can all change, can also one of them remain unchanged and another variable changes.Preferably, of the present invention Stringent condition can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C with SEQ ID NO:2 and SEQ ID NO:4 occur spy Then specific hybridization respectively washes film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Therefore, have anti-insect activity and under strict conditions with SEQ ID NO of the present invention:2 and SEQ ID NO:4 hybridization Sequence is included in the invention.These sequences and sequence of the present invention at least about 40%-50% are homologous, about 60%, 65% or 70% is homologous, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or bigger sequence homology.

Heretofore described gene and protein not only include specific exemplary sequence, further include save it is described specific (including compared with full length protein and/or end lacks for the part of the insecticidal activity feature of exemplary protein and/or segment Lose), variant, mutant, the substituent protein of amino acid (have substitute), chimera and fusion protein." variant " or " become It is different " refer to the nucleotide sequence for encoding same albumen or encoding the equivalent protein for having insecticidal activity." equivalent protein " refers to There is the albumen of the bioactivity of identical or essentially identical anti-greenish brown hawk moth pest with the albumen of claim.

The original DNA or egg that " segment " or " truncation " of heretofore described DNA molecular or protein sequence refers to A part of Bai Xulie (nucleotide or amino acid) or its artificial reconstructed form (such as being suitble to the sequence of plant expression), aforementioned sequence Variation may be present in the length of row, but length is enough to ensure that (coding) protein is insect toxins.

Gene variant can be built with modifier and readily using standard technique.For example, it is well known that manufacture point The technology of mutation.In another example U.S. Patent number 5605793, which describes to reassembly using DNA after random fracture, generates other molecules Multifarious method.The segment of commercialization endonuclease manufacture full-length gene can be used, and can be according to standardization program Use exonuclease.It is, for example, possible to use enzyme such as Bal31 or direct mutagenesis cut off core from the end systems of these genes Thuja acid.A variety of restriction enzymes can also be used to obtain the gene of encoding active segment.It can be directly obtained using protease The active fragment of these toxin.

The present invention can derive equivalent protein from Bt isolates and/or DNA library and/or encode these equivalent proteins Gene.There are many insecticidal proteins that method obtains the present invention.It is, for example, possible to use the desinsection egg that the present invention discloses and claims White antibody is identified and isolated from other albumen from protein mixture.Particularly, antibody may be by albumen it is most constant and and its Caused by its most different protein part of Bt albumen.May then pass through immunoprecipitate, enzyme linked immunosorbent assay (ELISA) (ELISA) or Western immunoblot methods exclusively identify the equivalent protein for having activity characteristic using these antibody.This field standard journey can be used Sequence readily prepares the antibody of the segment of albumen or equivalent protein or this albuminoid disclosed in the present invention.It then can be from micro- life The gene for encoding these albumen is obtained in object.

Due to the Feng Yuxing of genetic codon, a variety of different DNA sequence dnas can encode identical amino acid sequence.It generates These encode the alternative DNA sequence dna of identical or essentially identical albumen just in the technical merit of those skilled in the art.This A little different DNA sequence dnas are included within the scope of the invention." substantially the same " sequence refers to having amino acid substitution, lacking The sequence of insecticidal activity is lost, added or be inserted into but do not influence substantially, also includes the segment for retaining insecticidal activity.

Replacing, missing or adding for amino acid sequence is the ordinary skill in the art in the present invention, preferably this amino acid Variation is：Small characteristic changing does not significantly affect folding and/or the substitution of active conserved amino acid of albumen；Small missing, The missing of normally about 1-30 amino acid；Small amino or c-terminus extend, such as aminoterminal extends a methionine residues； Small connection peptide, for example, about 20-25 residue are long.

The example of conservative substitution is the substitution occurred in following amino acid group：Basic amino acid (such as arginine, lysine And histidine), it is acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, asparagine), hydrophobic Acidic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (such as glycine, alanine, serine, threonine and methionine).Usually do not change given activity Those amino acid substitutions are well-known in the art, and by for example, N.Neurath and R.L.Hill are 1979 Published by year new york academic publishing house (Academic Press)《Protein》In be described.Most common exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/ Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and their opposite exchanges.

For a person skilled in the art it should be evident that this substitution can play an important role to molecular function Region except occur, and still generate active peptides.For the polypeptide by the present invention, activity is required and therefore selects not Substituted amino acid residue can reflect according to methods known in the art, such as direct mutagenesis or alanine scanning mutagenesis It is fixed (such as referring to, Cunningham and Wells, 1989, Science244：1081-1085).Latter technique is each in the molecule At a positively charged residue introduce mutation, detection gained mutating molecule anti-insect activity, so that it is determined that the molecular activity and It overstates the amino acid residue wanted.Substrate-enzyme interacting site can also be measured by the analysis of its three-dimensional structure, and this three Dimension structure can be measured by technologies such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as de Vos, 1992, Science 255：306-312；Smith etc., 1992, J.Mol.Biol 224:899-904；Wlodaver etc., 1992, FEBS Letters 309：59-64).

In the present invention, Vip3Aa albumen includes but not limited to SEQ ID NO:1、SEQ ID NO:Amino acid shown in 3 There is sequence the amino acid sequence of certain homology to be also included in the present invention.These sequences and sequence similarities/phase of the present invention The same sex is typically larger than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably more than 95%, and 99% can be more than.Can also according to particularly the phase same sex and/or similarity range define the present invention preferred multinuclear glycosides Acid and protein.Such as have 60% with the exemplary sequence of the present invention, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, The 98% or 99% phase same sex and/or similarity.

In the present invention, the genetically modified plants for generating the Vip3Aa albumen include but not limited to COT102 transgene cottons Event and/or vegetable material (as described in CN1004395507C), COT202 comprising COT102 transgenic cotton events Transgenic cotton event and/or vegetable material comprising COT202 transgenic cotton events are (as described by CN1886513A ) or MIR162 transgenic corn events and/or the vegetable material comprising MIR162 transgenic corn events (such as exist Described in CN101548011A), the method and/or purposes of the present invention may be implemented, i.e., at least by greenish brown hawk moth pest It is contacted with Vip3Aa albumen to realize the method and/or purposes of control greenish brown hawk moth pest, more specifically, the Vip3Aa albumen is deposited It is in the genetically modified plants at least generating the Vip3Aa albumen, the greenish brown hawk moth pest passes through the genetically modified plants that ingest Tissue at least contacted with the Vip3Aa albumen, after contact greenish brown hawk moth pest growth is suppressed and/or causes death, To realize the control for endangering greenish brown hawk moth plant.

Heretofore described regulating and controlling sequence include but not limited to promoter, transit peptides, terminator, enhancer, targeting sequencing, Introne and other regulatory sequences for being operably connected to the Vip3Aa albumen.

The promoter is effable promoter in plant, and " the effable promoter in plant " refers to ensuring The promoter that coded sequence connected to it is expressed in plant cell.Effable promoter can be composing type in plant Promoter.It includes but not limited to derive from cauliflower mosaic virus to instruct the example of the promoter of constitutive expression in plant The promoter etc. of 35S promoter, arabidopsis Ubi10 promoters, corn Ubi promoters, rice GOS2 genes.Alternatively, plant In effable promoter can be organizing specific promoter, i.e., the promoter plant some tissue in such as in chlorenchyma It is middle to instruct the expression of coded sequence higher than its hetero-organization (test and be measured by conventional RNA) of plant, such as PEP carboxylics Change enzyme promoters.Alternatively, effable promoter can be wound-induced promoter in plant.Wound-induced promoter or guidance When the promoter of the expression pattern of wound-induced refers to the wound caused by plant is subjected to machinery or is gnawed by insect, promoter tune The expression of coded sequence under control under the conditions of normal growth compared with being significantly increased.The example of wound-induced promoter includes but unlimited In the startup of protease suppressor (pin I and the pin II) and zein enzyme suppressor (MPI) of potato and tomato Son.

The transit peptides (also known as secretory signal sequence or targeting sequencing) are to instruct transgene product to specific organelle Or cellular compartment, for receptor protein, the transit peptides can be heterologous, for example, utilizing encoding chloroplast transit peptide Sequence targets chloroplaset, either utilizes ' KDEL ' to retain sequence targeting endoplasmic reticulum or utilizes barley plants agglutinin gene CTPP targets vacuole.

The targeting sequencing is including but not limited to picornavirus targeting sequencing, such as EMCV targeting sequencings (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) targeting sequencing；Human immunity Globular protein heavy-chain binding protein matter (BiP)；The coat protein mRNA's of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4)；Tobacco mosaic virus (TMV) (TMV) targeting sequencing.

The enhancer is including but not limited to cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) increase Hadron, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), duck plantar Straw colour mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon is applied, the introne is including but not limited to corn hsp70 intrones, corn are general Plain introne, Adh introne 1s, crose synthase intron or rice Act1 intrones.For dicotyledon is applied, institute Introne is stated including but not limited to CAT-1 intrones, pKANNIBAL intrones, PIV2 intrones and " super ubiquitin " include Son.

The terminator can be the suitable polyadenylation signal sequence to work in plant, including but unlimited In from the Polyadenylation of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Signal sequence, derives from pea at the polyadenylation signal sequence for deriving from protease-inhibitor Ⅱ (pin II) gene The polyadenylation signal sequence of ssRUBISCO E9 genes and the poly for deriving from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " indicates the connection of nucleic acid sequence, described to be coupled so that a sequence provide pair The function of being needed for linked sequence.Described in the present invention " effectively connection " can be by promoter and interested sequence phase Even so that the transcription of the interested sequence is controlled and regulates and controls by the promoter.When interested sequential coding albumen and " effectively connection " indicates when going for the expression of the albumen：Promoter is connected with the sequence, and connected mode to obtain Transcript efficient translation.If promoter and the albumen that the connection of coded sequence is that transcript merges and want that realization encodes Expression when, manufacture such connection so that the first translation initiation codon is the starting of coded sequence in obtained transcript Codon.Alternatively, if promoter and the table that the connection of coded sequence is the albumen that realization coding was merged and wanted in translation Up to when, manufacture such connection so that the first translation initiation codon and the promoter contained in 5 ' non-translated sequences is connected, And the relationship of the translation opening code-reading frame of the translation product that connection type the makes albumen desired with coding is to meet reading Code frame.Can the nucleic acid sequence of " effectively connection " include but not limited to：Sequence (the i.e. gene expression of gene expression function is provided Element, for example, promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), provide DNA transfer and/or integration function sequence (i.e. T-DNA border sequences, locus specificity recombinase Recognition site, integrate enzyme recognition site), provide selectivity function sequence (i.e. antibiotic resistance markers, biosynthesis base Cause), provide can score marker function sequence, in vitro or in vivo assist series of operations sequence (i.e. polylinker sequence, site Specific recombination sites) and provide copy function sequence (the i.e. replication orgin, autonomously replicating sequence of bacterium, centromere sequence Row).

It is toxic that heretofore described " desinsection " or " pest-resistant ", which refers to crop pests, to realize " control " And/or " prevention " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to killing crop pests.More specifically, mesh It is greenish brown hawk moth pest to mark insect.

Vip3Aa albumen has toxicity to greenish brown hawk moth pest in the present invention.Plant in the present invention, especially soybean, at it Contain exogenous DNA in genome, the exogenous DNA includes the nucleotide sequence of coding Vip3Aa albumen, and greenish brown hawk moth pest passes through Feeding plant tissue is contacted with the albumen, and greenish brown hawk moth pest, which grows, after contact is suppressed and/or causes death.Inhibition refers to causing It is dead or sub- lethal.Meanwhile plant should be morphologically normal, and the consumption for product can be cultivated under conventional approaches And/or it generates.In addition, the plant can substantially eliminate needs (chemistry or the biological insecticides to chemistry or biological insecticides For the insecticide of the greenish brown hawk moth pest targeted for Vip3Aa albumen).

In vegetable material the expression of insecticidal crystal protein (ICP) can by described a variety of methods in the art into Row detection, such as quantified by the mRNA of the coded insect-killing protein using special primer to being generated in tissue, or directly The amount for the insect-killing protein that specific detection generates.

Different experiments can be applied to measure the insecticidal effect of ICP in plant.Targeted insect is mainly beans day in the present invention Moth.

In the present invention, the Vip3Aa albumen can have SEQ ID NO in sequence table:1 and SEQ IDNO:Shown in 3 Amino acid sequence.Other than the code area comprising Vip3Aa albumen, it also may include other elements, such as encoding selection markers Protein.

In addition, the expression cassette comprising the nucleotide sequence for encoding Vip3Aa albumen of the present invention in plant can also at least A kind of protein of encoding herbicide resistance gene is expressed together, and the herbicide resistance gene includes but not limited to glufosinate-ammonium Resistant gene (such as bar genes, pat genes), phenmedipham resistant gene (such as pmph genes), Glyphosate resistance gene (such as EPSPS Gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of herbicide Dalapon, to ammonia The resistant gene of the resistant gene or glutamine synthetase inhibitor (such as PPT) of nitrile, to obtain both have high insecticidal activity, Genetically modified plants with Herbicid resistant again.

In the present invention, by Exogenous DNA transfered plant, the gene of Vip3Aa albumen or expression cassette or recombination as described in will encode Vector introduction plant cell, conventional method for transformation include but not limited to that Agrobacterium-medialed transformation, micro transmitting bombard, are straight It connects and DNA is taken in into the DNA importings that protoplast, electroporation or silicon whisker mediate.

The present invention provides a kind of methods of control pest, have the following advantages：

1, internal cause prevents.The prior art is mainly that the harm of greenish brown hawk moth pest is controlled by external action, that is, external cause, such as Cultural control, chemical prevention, physical control and biological control；And the present invention is can to inhibit greenish brown hawk moth by being generated in plant The Vip3Aa albumen of growth controls greenish brown hawk moth pest, i.e., is prevented by internal cause.

2, pollution-free, noresidue.Although harm of the chemical prevention and control method that the prior art uses to control greenish brown hawk moth pest Certain effect is played, but pollution, destruction and residual also are brought to people, animal and farmland ecosystem simultaneously；Use the present invention The method for controlling greenish brown hawk moth pest, can eliminate above-mentioned adverse consequences.

3, the time of infertility prevents.The method for the control greenish brown hawk moth pest that the prior art uses all is interim, and this hair Bright is the protection for being carried out to plant the time of infertility, and genetically modified plants (Vip3Aa albumen) are from germination, growth, until blooming, tying Fruit can resist the infringement of greenish brown hawk moth.

4, whole plant is prevented.The method for the control greenish brown hawk moth pest that the prior art uses is locality mostly, such as blade face It sprays；And the present invention is protected to entire plant, such as the root of genetically modified plants (Vip3Aa albumen), blade, stalk, fruit Reality, tassel, female fringe, anther etc. can all resist greenish brown hawk moth infringement.

5, effect stability.The frequency ventilating type insecticidal lamp that the prior art uses not only needs daily the dirt of cleaning high-voltage fence in time Dirt, and cannot be used in thundery sky；The present invention is that the Vip3Aa albumen is made to be expressed in plant, efficiently against The defect that the effect of frequency ventilating type insecticidal lamp is influenced by extraneous factor, and the preventions of genetically modified plants of the present invention (Vip3Aa albumen) Effect is also all stable and consistent in different location, different time, different genetic backgrounds.

6, simple, conveniently, it is economical.The disposably input for the frequency ventilating type insecticidal lamp that the prior art uses is larger, and operates not When the danger hurted sb.'s feelings of also shocking by electricity；The present invention need to only plant the genetically modified plants that can express Vip3Aa albumen, without Other measures are used, to save a large amount of human and material resources and financial resources.

7, effect is thorough.The method for the control greenish brown hawk moth pest that the prior art uses, effect is halfway, is only served Mitigation acts on；And genetically modified plants (Vip3Aa albumen) of the present invention are almost percent to the control effect of greenish brown hawk moth newly hatched larvae Hundred, extremely survival larva also substantially stops development individually, and larva is all significantly to develop substantially still in just state is incubated after 3 days It is bad, and stopped developing, it can not survive in the natural environment of field, and genetically modified plants are generally only by slight damage.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Description of the drawings

Fig. 1 is the recombinant cloning vector containing Vip3Aa-01 nucleotide sequences of the purposes of insecticidal proteins of the present invention DBN01-T builds flow chart；

Fig. 2 is the recombinant expression carrier containing Vip3Aa-01 nucleotide sequences of the purposes of insecticidal proteins of the present invention DBN100002 builds flow chart；

Fig. 3 is that the Transgenic soybean plants of the method for present invention control pest are inoculated with the insect resistant effect figure of greenish brown hawk moth.

Specific implementation mode

The technical solution of the purposes of insecticidal proteins is further illustrated the present invention below by specific embodiment.

The acquisition and synthesis of first embodiment, gene

1, nucleotide sequence is obtained

The amino acid sequence (789 amino acid) of Vip3Aa-01 insect-killing proteins, such as SEQ IDNO in sequence table:1 institute Show；Vip3Aa nucleotide sequence (2370 nucleosides of the coding corresponding to the amino acid sequence of the Vip3Aa insect-killing proteins Acid), such as SEQ ID NO in sequence table:Shown in 2.

The amino acid sequence (789 amino acid) of Vip3Aa-02 insect-killing proteins, such as SEQ IDNO in sequence table:3 institutes Show；Vip3Aa-02 nucleotide sequence (2370 of the coding corresponding to the amino acid sequence of the Vip3Aa-02 insect-killing proteins Nucleotide), such as SEQ ID NO in sequence table:Shown in 4.

The amino acid sequence (615 amino acid) of Cry1Ab-01 insect-killing proteins, such as SEQ IDNO in sequence table:5 institutes Show；Cry1Ab-01 nucleotide sequence (1848 of the coding corresponding to the amino acid sequence of the Cry1Ab-01 insect-killing proteins Nucleotide), such as SEQ ID NO in sequence table:Shown in 6.

The amino acid sequence (634 amino acid) of Cry2Ab-01 insect-killing proteins, such as SEQ IDNO in sequence table:7 institutes Show；Cry2Ab-01 nucleotide sequence (1905 of the coding corresponding to the amino acid sequence of the Cry2Ab-01 insect-killing proteins Nucleotide), such as SEQ ID NO in sequence table:Shown in 8.

2, above-mentioned nucleotide sequence is synthesized

Synthesize the Vip3Aa-01 nucleotide sequences (SEQ ID NO in such as sequence table:Shown in 2), the Vip3Aa-02 Nucleotide sequence (SEQ ID NO in such as sequence table:Shown in 4), the Cry1Ab-01 nucleotide sequences (SEQ in such as sequence table ID NO:Shown in 6) and the Cry2Ab-01 nucleotide sequences (SEQ ID NO in such as sequence table:Shown in 8)；What is synthesized is described Vip3Aa-01 nucleotide sequences (SEQ ID NO:2) 5 ' ends are also associated with ScaI restriction enzyme sites, the Vip3Aa-01 nucleosides Acid sequence (SEQ ID NO:2) 3 ' ends are also associated with SpeI restriction enzyme sites；The Vip3Aa-02 nucleotide sequences of synthesis (SEQ IDNO:4) 5 ' ends are also associated with ScaI restriction enzyme sites, Vip3Aa-02 nucleotide sequences (the SEQ IDNO:4) 3 ' ends are also associated with SpeI restriction enzyme sites；Cry1Ab-01 nucleotide sequences (the SEQID NO of synthesis:6) 5 ' ends also connect It is connected to SpeI restriction enzyme sites, Cry1Ab-01 nucleotide sequences (the SEQID NO:6) 3 ' ends are also associated with BamHI digestions position Point；The Cry2Ab-01 nucleotide sequences (the SEQ ID NO of synthesis:8) 5 ' ends are also associated with NcoI restriction enzyme sites, described Cry2Ab-01 nucleotide sequences (SEQ ID NO:8) 3 ' ends are also associated with SpeI restriction enzyme sites.

Second embodiment, the structure of recombinant expression carrier and recombinant expression carrier convert Agrobacterium

1, the recombinant cloning vector containing Vip3Aa genes is built

By the Vip3Aa-01 nucleotide sequences of synthesis be connected into cloning vector pGEM-T (Promega, Madison, USA, CAT:A3600 on), operating procedure is carried out by Promega Products pGEM-T carrier specifications, obtains down recombinant cloning vector DBN01-T, (wherein, Amp indicates ampicillin resistance gene to structure flow as shown in Figure 1；F1 indicates answering for bacteriophage f1 Starting point processed；LacZ is LacZ codons in fact；SP6 is SP6RNA polymerase promoters；T7 is t7 rna polymerase promoter； Vip3Aa-01 is Vip3Aa-01 nucleotide sequences (SEQ ID NO:2)；MCS is multiple cloning sites).

Then by recombinant cloning vector DBN01-T heat shock methods convert Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT：CD501), hot shock condition is：50 μ l Escherichia coli T1 competent cells, 10 μ l Plasmid DNA (weight Group cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds；37 DEG C of shaken cultivations 1 hour (shaking table shakes under 100rpm rotating speeds), in table Face is coated with the ammonia of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indoles-β-D- galactosides of the bromo- 4- of 5-) LB tablets (tryptone 10g/L, yeast extract 5g/L, the NaCl 10g/L, agar 15g/ of parasiticin (100 mg/litre) L, overnight with NaOH tune pH to growth on 7.5).Picking white colony, in LB liquid medium, (tryptone 10g/L, yeast carry Object 5g/L, NaCl 10g/L, ampicillin 100mg/L are taken, with NaOH tune pH to being cultivated under the conditions of 37 DEG C of temperature in 7.5) Overnight.Its plasmid of alkalinity extraction：Bacterium solution is centrifuged into 1min under 12000rpm rotating speeds, removes supernatant, precipitates 100 μ l ice of thalline The solution I (25mM Tris-HCl, 10mM EDTA (ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) of precooling suspends；It is added The solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) that 200 μ l are newly prepared, pipe is overturned 4 times, and ice is set in mixing Upper 3-5min；The ice-cold solution IIIs of 150 μ l (3M potassium acetates, 5M acetic acid) are added, mixes well immediately, places 5- on ice 10min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, 2 times of volume absolute ethyl alcohols, mixing are added in supernatant After be placed at room temperature for 5min；5min is centrifuged under the conditions of 4 DEG C of temperature, rotating speed 12000rpm, abandons supernatant, precipitation concentration (V/V) To be dried after 70% ethyl alcohol washing；Be added 30 μ l containing RNase (20 μ g/ml) TE (10mM Tris-HCl, 1mM EDTA, PH8.0) dissolving precipitation；The water-bath 30min at 37 DEG C of temperature digests RNA；It is saved backup for -20 DEG C in temperature.

The plasmid of extraction carries out sequence verification after ScaI and SpeI digestions identification, to positive colony, the results showed that recombination The Vip3Aa-01 nucleotides sequences being inserted into cloning vector DBN01-T are classified as SEQ ID NO:Nucleosides shown in 2 Acid sequence, i.e. Vip3Aa-01 nucleotide sequences are correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by the Vip3Aa-02 nucleotide sequences of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN02-T, wherein Vip3Aa-02 is Vip3Aa-02 nucleotide Sequence (SEQ ID NO:4).Vip3Aa-02 nucleotide sequences described in digestion and sequence verification recombinant cloning vector DBN02-T It is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by the Cry1Ab-01 nucleotide sequences of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN03-T, wherein Cry1Ab-01 is Cry1Ab-01 nucleotide Sequence (SEQ ID NO:6).Cry1Ab-01 nucleotide sequences described in digestion and sequence verification recombinant cloning vector DBN03-T It is correctly inserted into.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, by the Cry2Ab-01 nucleotide sequences of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN04-T, wherein Cry2Ab-01 is Cry2Ab-01 nucleotide Sequence (SEQ ID NO:8).Cry2Ab-01 nucleotide sequences described in digestion and sequence verification recombinant cloning vector DBN04-T It is correctly inserted into.

2, the recombinant expression carrier containing Vip3Aa genes is built

Distinguish digestion recombinant cloning vector DBN01-T and expression vector DBNBC-01 with restriction enzyme ScaI and SpeI (carrier framework：PCAMBIA2301 (CAMBIA mechanisms can provide)), the Vip3Aa-01 nucleotide sequence fragments cut are inserted To between the sites ScaI and SpeI of expression vector DBNBC-01, the enzymatic cleavage methods carrier construction using routine is art technology Known to personnel, it is built into recombinant expression carrier DBN100002, structure flow (Kan as shown in Figure 2：Kanamycins base Cause；RB：Right margin；prAtUbi10：Arabidopsis Ubiquitin (ubiquitin) gene promoter (SEQ ID NO:9)；Vip3Aa- 01：Vip3Aa-01 nucleotide sequences (SEQ ID NO:2)；tNos：Terminator (the SEQID NO of rouge alkali synthetase gene: 10)；PAT：Glufosinate acetyl transferase gene (SEQ ID NO:11)；LB：Left margin).

Recombinant expression carrier DBN100002 heat shock methods are converted into Escherichia coli T1 competent cells, hot shock condition For：50 μ l Escherichia coli T1 competent cells, 10 μ l Plasmid DNA (recombinant expression carrier DBN100702), 42 DEG C of water-baths 30 seconds； 37 DEG C of shaken cultivations 1 hour (shaking table shakes under 100rpm rotating speeds)；Then in the LB of kanamycins containing 50mg/L (Kanamycin) Solid plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH on 7.5) It is cultivated 12 hours under the conditions of 37 DEG C of temperature, picking white colony, in LB liquid medium (tryptone 10g/L, yeast extraction Object 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation. Its plasmid of alkalinity extraction.To be identified after restriction enzyme ScaI and the SpeI digestion of the plasmid of extraction, and by positive colony into Row sequencing identification, the results showed that nucleotides sequences of the recombinant expression carrier DBN100002 between the sites ScaI and SpeI is classified as sequence SEQ ID NO in table:Nucleotide sequence shown in 2, i.e. Vip3Aa-01 nucleotide sequences.

According to the method for above-mentioned structure recombinant vector DBN100002, by ScaI and SpeI digestion recombinant cloning vectors The Vip3Aa-02 nucleotide sequences that DBN02-T is cut are inserted into expression vector DBNBC-01, obtain recombinant vector DBN100741.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100741 contains for SEQ in sequence table ID NO:Nucleotide sequence shown in 4, i.e. Vip3Aa-02 nucleotide sequences, the Vip3Aa-02 nucleotide sequences can connect institute State prAtUbi10 promoters and tNos terminators.

According to the method for above-mentioned structure recombinant vector DBN100002, ScaI and SpeI, SpeI and BamHI are distinguished into digestion The Vip3Aa-02 nucleotide sequences and Cry1Ab-01 nucleotides sequences that recombinant cloning vector DBN02-T and DBN03-T are cut Row are inserted into expression vector DBNBC-01, obtain recombinant expression carrier DBN100003.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100003 contains for SEQ ID NO in sequence table:4 and SEQ ID NO:Nucleotide sequence shown in 6, That is Vip3Aa-02 nucleotide sequences and Cry1Ab-01 nucleotide sequences, Vip3Aa-02 nucleotide sequences and described Cry1Ab-01 nucleotide sequences can connect the prAtUbi10 promoters and tNos terminators.

According to the method for above-mentioned structure recombinant vector DBN100002, ScaI and SpeI, NcoI and SpeI are distinguished into digestion weight The Vip3Aa-02 nucleotide sequences and Cry2Ab-01 nucleotide sequences that group cloning vector DBN02-T and DBN04-T are cut It is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100370.Digestion and sequence verification recombinant expression carrier Nucleotide sequence in DBN100370 contains for SEQ ID NO in sequence table:4 and SEQ ID NO:Nucleotide sequence shown in 8, That is Vip3Aa-02 nucleotide sequences and Cry2Ab-01 nucleotide sequences, Vip3Aa-02 nucleotide sequences and described Cry2Ab-01 nucleotide sequences can connect the prAtUbi10 promoters and tNos terminators.

3, recombinant expression carrier converts Agrobacterium

To having been built up correct recombinant expression carrier DBN100002, DBN100741, DBN100003 and DBN100370 It is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT with liquid nitrogen method:In 18313-015), conversion condition For：100 μ L Agrobacterium LBA4404s, 3 μ L Plasmid DNA (recombinant expression carrier)；It is placed in liquid nitrogen 10 minutes, 37 DEG C of tepidariums 10 Minute；By the Agrobacterium LBA4404 after conversion be inoculated in LB test tubes in 28 DEG C of temperature, rotating speed be 200rpm under the conditions of cultivate 2 Hour, it is applied on the LB tablets of the rifampin containing 50mg/L (Rifampicin) and the kanamycins (Kanamycin) of 100mg/L Until growing positive monoclonal, picking Colony Culture simultaneously extracts its plasmid, with restriction enzyme to recombinant expression carrier Digestion verification is carried out after DBN100002, DBN100741, DBN100003 and DBN100370 digestion, the results showed that recombinant expression carries Body DBN100002, DBN100741, DBN100003 and DBN100370 structure is completely correct.

The acquisition of 3rd embodiment, transfer-gen plant

1, Transgenic soybean plants are obtained

According to the Agrobacterium infestation method routinely used, by the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile culture and the Agrobacterium co-cultivation described in 3 in two embodiments, the recombinant expression carrier DBN100002 that in second embodiment 2 are built, T-DNA (including the promoter sequence of arabidopsis ubiquitin gene, the Vip3Aa- of DBN100741, DBN100003 and DBN100370 01 nucleotide sequence, Vip3Aa-02 nucleotide sequences, Vip3Aa-02-Cry1Ab-01 nucleotide sequences, Vip3Aa-02- Cry2Ab-01 nucleotide sequences, pat gene and tNos terminator sequences) it is transferred in soybean genome, it is transferred to The soybean plant strain of Vip3Aa-01 nucleotide sequences, is transferred to Vip3Aa- at the soybean plant strain for being transferred to Vip3Aa-02 nucleotide sequences The soybean plant strain of 02-Cry1Ab-01 nucleotide sequences and the soybean for being transferred to Vip3Aa-01-Cry2Ab-01 nucleotide sequences are planted Strain；Simultaneously as a contrast with Wild-type soy plant.

For agriculture bacillus mediated transformation of soybean, briefly, by ripe soya seeds in soybean germination culture medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprouted, seed is inoculated on germination medium, By the following conditions culture：25 ± 1 DEG C of temperature；Photoperiod (light dark) is 16/8h.It is taken after sprouting 4-6 days swollen at bud green cotyledonary node Big soybean aseptic seedling, cuts hypocotyl under cotyledonary node at 3-4 millimeters, longitudinally slit cotyledon removes terminal bud, lateral bud and seed Root.Wound is carried out at cotyledonary node with the knife spine of scalpel, the cotyledonary node tissue crossed with agrobacterium suspension contact wound, wherein Agrobacterium can be by Vip3Aa-01 nucleotide sequences, Vip3Aa-02 nucleotide sequences, Vip3Aa-02-Cry1Ab-01 nucleotide Sequence and Vip3Aa-02-Cry2Ab-01 nucleotide sequences are transferred to the cotyledonary node tissue (step 1 that wound is crossed：Infect step) In this step, cotyledonary node tissue preferably immerses agrobacterium suspension, and (OD660=0.5-0.8 infects culture medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2-morpholine ethane sulfonic acid (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) in start inoculation.Cotyledonary node tissue co-cultures one period (3 days) with Agrobacterium (step 2：Co-culture step).Preferably, cotyledonary node group is woven in infect step after in solid medium (MS salt 4.3g/L, B5 dimension He is life, sucrose 20g/L, glucose 10g/L, 2-morpholine ethane sulfonic acid (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6) Upper culture.After the stage of co-cultivation herein, can there are one selectivity " recovery " step.In " recovery " step, renewal cultivation Base (B5 salt 3.1g/L, B5 vitamin, 2-morpholine ethane sulfonic acid (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least in the presence of it is a kind of oneself know suppression The antibiotic (cephalosporin) of Agrobacterium growth processed, does not add the selective agent (step 3 of vegetable transformant：Recovering step).It is preferred that The tissue block on ground, cotyledon node regeneration is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium simultaneously Convalescence is provided for infected cell.Then, the tissue block of cotyledon node regeneration is cultivated on the culture medium containing selective agent (glufosinate) And transformed calli (the step 4 that growth selection：Select step).Preferably, the tissue block of cotyledon node regeneration is having selection Screening solid medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, the 6-benzyladenine (6-BAP) of agent 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, hygromycin 50mg/L, PH5.6 it is cultivated on), leads to the cell selective growth of conversion.Then, the cytothesis of conversion is at plant (step 5：Regeneration step Suddenly), it is preferable that the tissue block of the cotyledon node regeneration grown on the culture medium containing selective agent is in solid medium (B5 differentiation trainings Support base and B5 root medias) on culture with aftergrowth.

It screens obtained resistant tissues block and is transferred to the B5 differential mediums (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, Gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6) on, differentiation is cultivated at 25 DEG C.The seedling come is differentiated to turn Move on to the B5 root medias (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole -3-butyric acid (IBA) 1mg/L), in culture of rootage, is cultivated to about 10cm high at 25 DEG C, move to hot-house culture It is extremely solid.In the greenhouse, 16h is cultivated at 26 DEG C daily, 8h is cultivated at 20 DEG C.

Fourth embodiment verifies transfer-gen plant with TaqMan

The soybean for taking respectively and being transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, be transferred to Vip3Aa-02 nucleotide sequences Plant, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02-Cry1Ab-01 nucleosides The blade of the soybean plant strain of acid sequence about 100mg extracts its base as sample, with the DNeasy Plant Maxi Kit of Qiagen Because of a group DNA, Vip3Aa genes, Cry1Ab genes and Cry2Ab genes are detected by Taqman fluorescence probe quantitative PCR methods Copy number.Simultaneously as a contrast with Wild-type soy plant, it is detected analysis according to the method described above.Experiment sets 3 repetitions, takes Average value.

Detecting Vip3Aa genes, Cry1Ab genes and Cry2Ab gene copy numbers, the specific method is as follows：

Step 11 takes and is transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, is transferred to Vip3Aa-02 nucleotides sequences respectively The soybean plant strain of row, is transferred to Vip3Aa-02- at the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences Each 100mg of blade of the soybean plant strain and Wild-type soy plant of Cry2Ab-01 nucleotide sequences, uses liquid nitrogen in mortar respectively It is ground into homogenate, each sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the ranging from 80- of the concentration value 100ng/μL；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR methods, with by being copied known to identification The sample of shellfish number is as standard items, and as a contrast with the sample of Wild-type soy plant, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively：

Following primer and probe is used for detecting PAT nucleotide sequences：

Primer 1：SEQ ID NO in GAGGGTGTTGTGGCTGGTATTG such as sequence table:Shown in 12；

Primer 2：SEQ ID NO in TCTCAACTGTCCAATCGTAAGCG such as sequence table:Shown in 13；

Probe 1：SEQ ID NO in CTTACGCTGGGCCCTGGAAGGCTAG such as sequence table:Shown in 14；

PCR reaction systems are：

50 × the primer/probe mixture includes each 45 μ l of each primer of 1mM concentration, 50 μ of probe of 100 μM of concentration L and 860 μ l 1 × TE buffer solutions, and at 4 DEG C, be housed in amber tube.

PCR reaction conditions are：

Data are analyzed using SDS2.3 softwares (Applied Biosystems).

The experimental results showed that Vip3A-01 nucleotide sequences, Vip3Aa-02 nucleotide sequences, Vip3Aa-02-Cry1Ab- 01 nucleotide sequence and Vip3Aa-02-Cry2Ab-01 nucleotide sequences have been integrated into the chromosome of detected soybean plant strain In group, and be transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, the soybean plant strain for being transferred to Vip3Aa-02 nucleotide sequences, It is transferred to the soybean plant strain of Vip3Aa-02-Cry1Ab-01 nucleotide sequences and is transferred to Vip3Aa-02-Cry2Ab-01 nucleotides sequences The Transgenic soybean plants that the soybean plant strain of row is singly copied.

The insect resistant effect detection of 5th embodiment, transfer-gen plant

By the soybean plant strain for being transferred to Vip3Aa-01 nucleotide sequences, be transferred to Vip3Aa-02 nucleotide sequences soybean plant Strain is transferred to the soybean plant strain of Vip3Aa-02-Cry1Ab-01 nucleotide sequences and is transferred to Vip3Aa-02-Cry2Ab-01 nucleotide The soybean plant strain of sequence；Corresponding Wild-type soy plant, and non-transgenic soybean plant strain is accredited as to beans through Taqman Hawkmoth carries out insect resistant effect detection.

1, the insect resistant effect detection of Transgenic soybean plants

The soybean for taking respectively and being transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, be transferred to Vip3Aa-02 nucleotide sequences Plant, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02-Cry2Ab-01 nucleosides The soybean plant strain of acid sequence, Wild-type soy plant and it is accredited as the new of non-transgenic soybean plant strain (tri-leaf period) through Taqman Fresh leaves, it is clean with aseptic water washing and blotted the water on blade with gauze, while it being cut into the square of about 2cm × 2cm, it takes 1 cut after square blade be put on the moisturizing filter paper of round plastic culture dish bottom, the filter paper is soaked with distilled water, often It puts 5 greenish brown hawk moths (newly hatched larvae) in a culture dish to be capped afterwards, in 25-28 DEG C of temperature, relative humidity 70%-80%, photoperiod (light dark) 16:After being placed 3 days under conditions of 8, referred to according to killing bean hawkmoth larva development progress, the death rate and blade injury rate three Mark obtains resistance total score (full marks 300 divide)：Resistance total score=100 × the death rate+[100 × death rate+90 × (just incubate borer population/ Connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- blade injuries rate).Totally 3 strains (S1, S2, S3) of Vip3Aa-01 nucleotide sequences are transferred to, Vip3Aa-02 nucleosides is transferred to Totally 3 strains (S4, S5, S6) of acid sequence, are transferred to totally 3 transformation events of Vip3Aa-02-Cry1Ab-01 nucleotide sequences Strain (S7, S8, S9), be transferred to Vip3Aa-02-Cry2Ab-01 nucleotide sequences totally 3 transformation event strains (S10, S11, S12), it is accredited as non-transgenic (NGM) totally 1 strain through Taqman, (CK) of wild type totally 1 strain；From each strain 3 plants are selected to be tested, every plant is repeated 6 times.As a result as shown in table 1 and Fig. 3.

Non-transgenic soybean material (CK) totally 1 strain；6 plants are selected to be tested from each strain, every plant is repeated 1 times.Knot Fruit is as shown in table 1 and Fig. 1.

Table 1, Transgenic soybean plants are inoculated with the pest-resistant experimental result of greenish brown hawk moth

Table 1 the result shows that：It is transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, is transferred to Vip3Aa-02 nucleotides sequences The soybean plant strain of row, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02- The soybean plant strain of Cry2Ab-01 nucleotide sequences all has preferable insecticidal effect, the average mortality of greenish brown hawk moth to greenish brown hawk moth 90% or more, resistance total score is also at 280 points or more；And it is accredited as non-transgenic soybean plant strain and wild through Taqman The resistance total score of type soybean plant strain is generally at 50 points or so.

Fig. 3's the result shows that：Compared with Wild-type soy plant, be transferred to Vip3Aa-01 nucleotide sequences soybean plant strain, The soybean plant strain for being transferred to the soybean plant strain of Vip3Aa-02 nucleotide sequences, being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences It is apparent to the control effect of greenish brown hawk moth newly hatched larvae with the soybean plant strain that is transferred to Vip3Aa-02-Cry2Ab-01 nucleotide sequences, The larva to survive on a small quantity is also significantly inhibited, and larval growth development is slow, while showing extremely weak vitality, in nature It can not generally survive under environment；And it is transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, is transferred to Vip3Aa-02 nucleotides sequences The soybean plant strain of row, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02- The soybean plant strain of Cry2Ab-01 nucleotide sequences is generally only by slight damage, and blade injury rate is below 10%.

Thus it proves to be transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, be transferred to the big of Vip3Aa-02 nucleotide sequences Beans plant, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02-Cry2Ab-01 cores The soybean plant strain of nucleotide sequence all shows the activity for inhibiting greenish brown hawk moth, and it is bad that this activity is enough the generation of the growth to greenish brown hawk moth Effect is to make it be controlled in field.

Above-mentioned experimental result also shows to be transferred to the soybean plant strain of Vip3Aa-01 nucleotide sequences, is transferred to Vip3Aa-02 nucleosides The soybean plant strain of acid sequence, the soybean plant strain for being transferred to Vip3Aa-02-Cry1Ab-01 nucleotide sequences and it is transferred to Vip3Aa-02- The soybean plant strain of Cry2Ab-01 nucleotide sequences is to control/prevention of greenish brown hawk moth apparently because plant itself can generate Vip3Aa albumen, so, it is well known to those skilled in the art, according to Vip3Aa albumen to the toxic action of greenish brown hawk moth, the present invention In be transferred to Vip3Aa albumen plant and can also generate at least one second of insect-killing protein different from Vip3Aa albumen, such as Cry albuminoids.

In conclusion the purposes of insecticidal proteins of the present invention can kill the Vip3Aa eggs of greenish brown hawk moth by being generated in plant It is white to control greenish brown hawk moth pest；Cultural control method, chemical prevention and control method, physical control method and the life used with the prior art Object control method is compared, the present invention to plant carry out the time of infertility, whole plant protection to prevent the infringement of greenish brown hawk moth pest, and Pollution-free, noresidue, effect stability, thoroughly, it is simple, conveniently, it is economical.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, it will be understood by those of ordinary skill in the art that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit of the technical scheme of the invention and range.

Sequence table

<110>Beijing great Bei agricultures Bioisystech Co., Ltd

<120>The purposes of insecticidal proteins

<130> DBNBC127

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 789

<212> PRT

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 1

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Ile Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 2

<211> 2370

<212> DNA

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 2

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcattaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 3

<211> 789

<212> PRT

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 3

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Ile Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 4

<211> 2370

<212> DNA

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 4

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 5

<211> 615

<212> PRT

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr

610 615

<210> 6

<211> 1848

<212> DNA

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 6

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga 1848

<210> 7

<211> 634

<212> PRT

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 7

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 8

<211> 1905

<212> DNA

<213>Bacillus thuringiensis (Bacillus thuringiensis)

<400> 8

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 9

<211> 1322

<212> DNA

<213>Arabidopsis (Arabidopsis thaliana)

<400> 9

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 10

<211> 530

<212> DNA

<213> Agrobacterium tumefaciens

<400> 10

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 11

<211> 552

<212> DNA

<213> Streptomyces hygroscopicus

<400> 11

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 12

<211> 22

<212> DNA

<213>Primer 1 (Artificial Sequence)

<400> 12

gagggtgttg tggctggtat tg 22

<210> 13

<211> 23

<212> DNA

<213>Primer 2 (Artificial Sequence)

<400> 13

tctcaactgt ccaatcgtaa gcg 23

<210> 14

<211> 25

<212> DNA

<213>Probe 1 (Artificial Sequence)

<400> 14

cttacgctgg gccctggaag gctag 25

Claims (20)

1. a kind of method of control greenish brown hawk moth pest, which is characterized in that including at least connecing greenish brown hawk moth pest with Vip3Aa albumen It touches.

2. the method for control greenish brown hawk moth pest according to claim 1, which is characterized in that the Vip3Aa albumen is present in In the host cell at least generating the Vip3Aa albumen, the greenish brown hawk moth pest by ingest the host cell at least with institute State the contact of Vip3Aa albumen.

3. the method for control greenish brown hawk moth pest according to claim 2, which is characterized in that the Vip3Aa albumen is present in In the bacterium or genetically modified plants that at least generate the Vip3Aa albumen, the greenish brown hawk moth pest by ingest the bacterium or turn The tissue of gene plant is at least contacted with the Vip3Aa albumen, after contact greenish brown hawk moth pest growth be suppressed and/or Lead to death, to realize the control that plant is endangered greenish brown hawk moth.

4. the method for control greenish brown hawk moth pest according to claim 3, which is characterized in that the genetically modified plants can be located In arbitrary breeding time.

5. the method for control greenish brown hawk moth pest according to claim 3, which is characterized in that the tissue of the genetically modified plants For blade, stalk, fruit, tassel, female fringe, anther.

6. the method for control greenish brown hawk moth pest according to claim 3, which is characterized in that described to endanger plant to greenish brown hawk moth Control do not change because of the change of planting site and/or implantation time.

7. the method for controlling greenish brown hawk moth pest according to claim 3 to 6 any one of them, which is characterized in that the plant is Soybean, mung bean, cowpea and locust tree.

8. the method for controlling greenish brown hawk moth pest according to claim 2 to 7 any one of them, which is characterized in that the contact step The step of before rapid, contains the plant for the polynucleotides for encoding the Vip3Aa albumen to plant.

9. the method for controlling greenish brown hawk moth pest according to claim 1 to 8 any one of them, which is characterized in that the Vip3Aa The amino acid sequence of albumen has SEQ ID NO:1 or SEQ ID NO:Amino acid sequence shown in 3.

10. the method for control greenish brown hawk moth pest according to claim 9, which is characterized in that the ammonia of the Vip3Aa albumen Base acid sequence has SEQ ID NO:2 or SEQ ID NO:Nucleotide sequence shown in 4.

11. the method for controlling greenish brown hawk moth pest according to claim 2 to 10 any one of them, which is characterized in that the plant Further include second of nucleotide of at least one nucleotide for being different from encoding the Vip3Aa albumen.

12. the method for control greenish brown hawk moth pest according to claim 11, which is characterized in that second of the nucleotide is compiled Code Cry classes insect-killing protein, Vip classes insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.

13. the method for control greenish brown hawk moth pest according to claim 12, which is characterized in that second of the nucleotide is compiled Code Cry1Ab albumen and Cry2Ab albumen.

14. the method for control greenish brown hawk moth pest according to claim 13, which is characterized in that the ammonia of the Cry1Ab albumen Base acid sequence has SEQ ID NO:The amino acid sequence of amino acid sequence shown in 5, the Cry2Ab albumen has SEQ ID NO:Amino acid sequence shown in 7.

15. the method for control greenish brown hawk moth pest according to claim 14, which is characterized in that the core of the Cry1Ab albumen Nucleotide sequence has SEQ ID NO:The nucleotide sequence of nucleotide sequence shown in 6, the Cry2Ab albumen has SEQ ID NO:Nucleotide sequence shown in 8.

16. the method for control greenish brown hawk moth pest according to claim 11, which is characterized in that second of the nucleotide is Inhibit the dsRNA of important gene in target insect pests.

17. a kind of purposes of Vip3Aa protein control greenish brown hawk moth pest.

18. a kind of method for the plant generating control greenish brown hawk moth pest, which is characterized in that include into the genome of the plant Introduce the polynucleotide sequence of coding Vip3Aa albumen.

19. a kind of method for the propagulum generating control greenish brown hawk moth pest, which is characterized in that including will be by claim 18 The first plant that the method obtains hybridizes with the second plant, to generate the polynucleotide sequence containing coding Vip3Aa albumen Brood body.

20. a kind of method of the plant of culture control greenish brown hawk moth pest, which is characterized in that including：

At least one propagulum is planted, the genome of the propagulum includes the multinuclear glycosides for encoding Vip3Aa albumen Acid sequence；

The propagulum is set to grow up to plant；

So that the plant is grown under conditions of artificial infection greenish brown hawk moth pest and/or greenish brown hawk moth pest naturally-occurring endanger, receives Obtain has the plant injury and/or tool weakened compared with the plant of other polynucleotide sequences for not having coding Vip3Aa albumen There is the plant of increased plant products.