WO2021026686A1

WO2021026686A1 - Use of insecticidal protein

Info

Publication number: WO2021026686A1
Application number: PCT/CN2019/099991
Authority: WO
Inventors: 韩超; 于彩虹; 谢香庭; 周毅; 刘海利
Original assignee: 北京大北农生物技术有限公司
Priority date: 2019-08-09
Filing date: 2019-08-09
Publication date: 2021-02-18
Also published as: AR119615A1; BR112021009540B1; CN111315218A; CN111315218B; BR112021009540A2; UY38823A

Abstract

A use of an insecticidal protein, comprising: bringing a Helicoverpa gelotopoeon pest into contact with at least a Vip3Aa protein; and controlling the Helicoverpa gelotopoeon pest by means of producing in a plant a Vip3Aa protein capable of killing the Helicoverpa gelotopoeon.

Description

Use of insecticidal protein

Technical field

The present invention relates to the use of an insecticidal protein, in particular to the use of a Vip3Aa protein to control South American cotton bollworm damage to plants by expressing it in plants.

Background technique

The South American cotton bollworm Helicoverpa gelotopoeon belongs to the genus Bollworm of the Lepidoptera Noctuidae. It is mainly distributed in southern South America such as Brazil, Argentina, Bolivia, Paraguay and Uruguay. Helicoverpa armigera is a polyphagous pest. It mainly damages cash crops such as soybean, cotton, alfalfa, sunflower, chickpea and corn. Its characteristics are: the whole larval stage can damage most plant tissues such as stalks, leaves, inflorescences and fruits . It likes to eat soybeans. The larvae can feed on 81.8% of the aboveground tissues of soybeans. The larvae can consume 340cm ² soybean leaves. The larvae can consume 15 soybean seeds at the last instar, which will seriously affect the yield.

Cultivated soybean (Glycine max (L.) Merri) is an important economic crop grown globally as the main source of vegetable oil and vegetable protein, and is an important food and forage crop in China. Soybean is one of the most popular plants for the bollworm in South America. In Agenyan, soybean production is reduced by 5% to 30% every year due to the damage of the bollworm in South America, causing serious economic losses. In order to control the South American cotton bollworm, the main methods that people usually use are agricultural control, chemical control, physical control and biological control.

Agricultural control is the comprehensive and coordinated management of multiple factors in the entire farmland ecosystem, regulating crops, pests, and environmental factors to create a farmland ecological environment that is conducive to crop growth and not conducive to the occurrence of South American bollworm. In South America, no-tillage farming is adopted for most of the farmland, and there is almost no agricultural prevention and control measures. If the population growth over the winter in the previous year is very likely to promote the population outbreak in the next year, causing economic losses to soybeans and other crops.

Chemical control means pesticide control. It is the use of chemical pesticides to kill pests. It is an important part of the integrated management of South American cotton bollworm. It has the characteristics of fast, convenient, simple and high economic benefits, especially the outbreak of South American cotton bollworm. Under circumstances, it is an essential emergency measure. At present, chemical control methods are mainly liquid spray and powder spray, which have good control effects before the third instar of South American cotton bollworm larvae. At this time, the larvae have small food intake and weak resistance to pesticides. This can be determined according to the peak period of trapping insects under the light. -2 instar larvae stage, or determine the control time according to the first instar larvae as the pest. Usually use 20% chlorantraniliprole suspension, or 48% flubendiamide suspension, or 25% beta-cyfluthrin microcapsule suspension, or 48% chlorpyrifos solution for spraying. Chemical control also has its limitations. Improper use often leads to pesticide damage to crops, resistance to insect pests, destruction of natural enemies, environmental pollution, damage to farmland ecosystems, and pesticide residues that threaten the safety of humans and livestock. as a result of.

Physical control is mainly based on the response of pests to various physical factors in environmental conditions, using various physical factors such as light, electricity, color, temperature and humidity, as well as mechanical equipment for trapping, radiation sterility and other methods to control pests. Use nets or lights to trap and kill adults when they are in full bloom. Taking advantage of the strong phototaxis of South American Helicoverpa armigera adults, set a black light lamp to trap and kill the adults during the emergence period to reduce the amount of eggs and larvae density in the field; but the black light lamp needs to clean the dirt on the filter in time every day, otherwise it will affect the emission of black light. In turn, it affects the insecticidal effect; and requires high stability of the power supply voltage, and there is a danger of hurting people's eyes in operation; in addition, the one-time investment in installing the lamp is relatively large.

Biological control is the use of certain beneficial organisms or biological metabolites to control the population of pests in order to reduce or eliminate pests. For example, choose pesticides with low toxicity to natural enemies and adjust the application according to the difference in the occurrence period of pests and natural enemies in the field. Time, avoid spraying when natural enemies occur in large numbers to protect natural enemies; secondly, release Trichogrammatidae or spray Bacillus thuringiensis SD-5, South American cotton bollworm nuclear polyhedrosis virus preparations to control South American cotton bollworm. It is characterized by safety for humans and livestock, less environmental pollution, and long-term control of certain pests; however, the effect is often unstable, and the same investment is required regardless of the occurrence of South American cotton bollworm.

In order to solve the limitations of agricultural control, chemical control, physical control and biological control in practical applications, scientists have discovered through research that the insect-resistant gene encoding insecticidal protein from Bacillus thuringiensis is transferred into plants, and some resistance can be obtained. Insects transgenic plants to control plant pests.

Vip3Aa insecticidal protein is one of many insecticidal proteins, and it is a specific protein produced by Bacillus thuringiensis. Vip3Aa protein has a toxic effect on sensitive insects by stimulating apoptosis-type programmed cell death. Vip3Aa protein is hydrolyzed into four main protein products in the insect intestine, and only one protein hydrolysate (66KD) is the toxic core structure of Vip3Aa protein. The Vip3Aa protein binds to the midgut epithelial cells of sensitive insects and initiates programmed cell death, causing the lysis of midgut epithelial cells and the death of the insects. It does not cause any disease to non-sensitive insects, and does not cause apoptosis and dissolution of midgut epithelial cells.

It has been proven that Vip3Aa transgenic plants can resist Lepidoptera pests such as cutworm, cotton bollworm, and Spodoptera frugiperda. However, there is no information on the control of South American cotton bollworm by producing transgenic plants expressing Vip3Aa protein. Reports of damage to plants.

Summary of the invention

The purpose of the present invention is to provide a use of insecticidal protein. It provides for the first time a method for controlling the harm of South American cotton bollworm to plants by producing transgenic plants expressing Vip3Aa protein, and effectively overcomes the prior art agricultural control, chemical control, and physical control And biological control and other technical defects.

In order to achieve the above objective, the present invention provides a method for controlling South American cotton bollworm pests, which comprises contacting the South American cotton bollworm pests with at least the Vip3Aa protein.

Further, the Vip3Aa protein is present in at least a host cell that produces the Vip3Aa protein, and the South American cotton bollworm pest at least contacts the Vip3Aa protein by ingesting the host cell.

Furthermore, the Vip3Aa protein is present in the bacteria or transgenic plants that at least produce the Vip3Aa protein, and the South American cotton bollworm pests at least contact the Vip3Aa protein by ingesting the tissues of the bacteria or the transgenic plant. The growth of the South American cotton bollworm pests is inhibited and/or killed, so as to realize the control of the South American cotton bollworm damage to plants.

The tissue of the transgenic plant is roots, leaves, stems, fruits, tassels, ears, anthers or filaments.

The plant is soybean, mung bean, cowpea, rape, cabbage, cauliflower, cabbage, and radish.

The transgenic plant can be in any growth stage.

The control of plant damage by the South American cotton bollworm does not change due to the change of planting location and/or planting time.

The step before the contacting step is to plant a plant containing the polynucleotide encoding the Vip3Aa protein.

Preferably, the amino acid sequence of the Vip3Aa protein has an amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, or SEQ ID NO: 7. The nucleotide sequence of the Vip3Aa protein has the nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.

Based on the above technical solution, the plant may also include at least one second nucleotide different from the nucleotide encoding the Vip3Aa protein.

Further, the second nucleotide encodes Cry insecticidal protein, Vip insecticidal protein, protease inhibitor, lectin, α-amylase or peroxidase.

In the present invention, the expression of Vip3Aa protein in a transgenic plant may be accompanied by the expression of one or more Cry insecticidal proteins and/or Vip insecticidal proteins. The co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering to make the plant contain and express the desired gene. In addition, one plant (the first parent) can express the Vip3Aa protein through genetic engineering operations, and the second plant (the second parent) can express Cry insecticidal proteins and/or Vip insecticidal proteins through genetic engineering operations. The progeny plants expressing all the genes introduced into the first parent and the second parent are obtained by crossing the first parent and the second parent.

Preferably, the second nucleotide encodes a Cry1Ab or Cry2Ab protein.

Further, the amino acid sequence of the Cry1Ab protein has the amino acid sequence shown in SEQ ID NO: 9. The nucleotide sequence of the Cry1Ab protein has the nucleotide sequence shown in SEQ ID NO: 10. The amino acid sequence of the Cry2Ab protein has the amino acid sequence shown in SEQ ID NO: 11. The nucleotide sequence of the Cry2Ab protein has the nucleotide sequence shown in SEQ ID NO: 12.

Optionally, the second nucleotide is a dsRNA that inhibits important genes in the target insect pest.

In order to achieve the above objective, the present invention also provides a use of Vip3Aa protein to control South American cotton bollworm pests.

To achieve the above objective, the present invention also provides a method for producing a plant for controlling South American cotton bollworm pests, which comprises introducing a polynucleotide sequence encoding Vip3Aa protein into the genome of the plant.

In order to achieve the above object, the present invention also provides a method for producing plant propagules for controlling South American cotton bollworm pests, comprising crossing the first plant obtained by the method with the second plant, and/or removing the plant propagule from the method. The reproductive tissues on the obtained plant are cultured to produce plant propagules containing the polynucleotide sequence encoding the Vip3Aa protein.

To achieve the above objective, the present invention also provides a method for cultivating plants for controlling South American cotton bollworm pests, including:

Planting at least one plant propagule, the genome of which includes a polynucleotide sequence encoding the Vip3Aa protein;

Growing the plant propagule into a plant;

The plants are grown under artificial inoculation with South American cotton bollworm pests and/or South American cotton bollworm pests naturally occurring damage, and the harvest has reduced plant damage and/or compared with other plants that do not have the polynucleotide sequence encoding the Vip3Aa protein Or plants with increased plant yield.

The "plant propagule" mentioned in the present invention includes but is not limited to plant sexual propagule and plant asexual propagule. The plant sexual propagules include but are not limited to plant seeds; the plant asexual propagules refer to the vegetative organs or certain special tissues of the plant, which can produce new plants in vitro; the vegetative organs or certain Species of special tissues include, but are not limited to, roots, stems and leaves. For example: plants with roots as vegetative bodies include strawberries and sweet potatoes; plants with stems as vegetative bodies include sugarcane and potatoes (tubes); leaves are vegetative The propagule plants include aloe and begonia.

The "contact" in the present invention refers to touching, staying and/or feeding, specifically insects and/or pests touching, staying and/or feeding plants, plant organs, plant tissues or plant cells, said plants, Plant organs, plant tissues, or plant cells can have insecticidal proteins expressed in their bodies, or have insecticidal proteins and/or microorganisms that produce insecticidal proteins on the surfaces of the plants, plant organs, plant tissues or plant cells.

The "control" and/or "prevention" mentioned in the present invention refers to the guidance that the American cotton bollworm pests are at least in contact with the Vip3Aa protein, and the growth of the South American cotton bollworm pests is inhibited and/or killed after the contact. Further, the South American cotton bollworm pests at least contact the Vip3Aa protein by feeding on plant tissues, and all or part of the South American cotton bollworm pests are inhibited from growing and/or cause death after the contact. Inhibition refers to sublethal, that is, it has not been lethal but can cause certain effects in growth and development, behavior, physiology, biochemistry, and tissue, such as slow growth and/or stop. At the same time, the plants should be normal in morphology and can be cultured under conventional methods for consumption and/or production of products. In addition, plants and/or plant seeds containing a polynucleotide sequence encoding the Vip3Aa protein for controlling South American bollworm pests can be used with non-transgenic plants under artificial inoculation of South American bollworm pests and/or South American bollworm pests. Wild-type plants have reduced plant damage compared to wild-type plants, and specific manifestations include, but are not limited to, improved leaf resistance, and/or increased grain weight, and/or increased yield. The "control" and/or "prevention" effects of the Vip3Aa protein on the South American cotton bollworm can exist independently. Specifically, any tissue of the transgenic plant (containing the polynucleotide sequence encoding the Vip3Aa protein) simultaneously and/or asynchronously, Exist and/or produce, Vip3Aa protein and/or another substance that can control South American cotton bollworm pests, then the presence of the other substance Vip3Aa cannot lead to the complete and/or "control" and/or "control" effects Or part of it is achieved by the other substance, and has nothing to do with the Vip3Aa protein. Normally, in the field, the process of South American bollworm pests ingesting plant tissues is short and difficult to observe with the naked eye. Therefore, under artificial inoculation with South American bollworm pests and/or under conditions where the South American bollworm pests are naturally harmful, such as genetically modified Plants (containing the polynucleotide sequence encoding the Vip3Aa protein) have dead South American cotton bollworm pests, and/or South American cotton bollworm pests on which growth is inhibited, and/or are related to non-transgenic wild-type plants. The method and/or use of the present invention is achieved by having weakened plant damage, that is, the method and/or use of controlling South American cotton bollworm pests is achieved by contacting the South American cotton bollworm pests with at least the Vip3Aa protein.

RNA interference (RNA interference, RNAi) refers to a phenomenon that is highly conserved during evolution, induced by double-stranded RNA (dsRNA), and homologous mRNA is efficiently and specifically degraded. Therefore, RNAi technology can be used in the present invention to specifically eliminate or shut down the expression of specific genes in target insect pests, especially genes related to the growth and development of target insect pests.

The adult South American cotton bollworm has a wingspan of 30-40 mm; it has elongated filamentous antennae. The color of the first pair of wings changes from light brown to dark brown, with obvious kidney-shaped spots near the center. The edge band of the wings is light brown, the secondary edge band is wider and darker than the rest of the wings. The second pair of wings is light brown and has a clear tendency to darken towards the outer edges. The eggs are hemispherical, pearly white, and have stripes at the apex. The mature larva is about 35 mm long and has a variable body color, which can be green, pink, yellow, brown or even black. There is a jagged white band on each side of the body with bright black bristles.

The South American bollworm is widely distributed in South American countries and regions such as Brazil, Argentina, Bolivia, Paraguay and Uruguay. 3-5 generations occur every year in Argentine, from November of the previous year to April of the following year, each generation is 30-40 days. The insect lives as a pupae for overwintering, and the adults lay eggs on flower buds and leaves after emergence, and the single female yield reaches 300-1000 grains. It takes 5-10 days for the eggs to reach the larvae. After the larvae hatch, they begin to feed on the mesophyll, leaving the epidermis. The food intake of 3-5 years old increased greatly, resulting in a large number of nicks and holes in the leaves. The larvae lasts for 12-20 days. Mature larvae burrow into the ground to make cocoons and pupate. The damage degree of South American cotton bollworm is mainly affected by the base of the insect source and temperature and humidity. Higher humidity and lower temperature in summer are beneficial to its occurrence, but heavy rain in the egg and early larval stages is not conducive to its occurrence.

In the classification system, Lepidoptera is generally divided into suborders, superfamily, families, etc., based on morphological characteristics such as the vein sequence, linkage mode and antenna type of adult wings. Noctuidae is the most abundant family in Lepidoptera. More than 20,000 species have been found in the world, and there are thousands of records in China alone. Most of the Noctuidae insects are pests of crops, which can feed on leaves and bollworms, such as cotton bollworm and Prodenia litura. Although the Chinese cotton bollworm (Helicoverpa armigera), Spodoptera litura, etc. and the South American cotton bollworm belong to the family Lepidoptera, apart from the similarity in the classification criteria, there are great differences in other morphological structures; Just like strawberries and apples in plants (which belong to the Rosaceae Rosaceae), they both have bisexual flowers, radial symmetry, and 5 petals, but their fruit and plant morphology are very different. However, because people are less exposed to insects, especially agricultural pests, they pay less attention to the differences in insect morphology, which makes people think that the morphology of insects is similar. In fact, the South American cotton bollworm has its unique characteristics in terms of larval morphology and adult morphology. For example, the Chinese cotton bollworm and South American cotton bollworm larvae have a large apical thorn-like set on the inside of the forefoot, 1-3 finer and gradually smaller thorn-like bristles, and 2-4 tapered and strong spines on the outside. Setaria; adult forewings, females of Chinese cotton bollworm and South American cotton bollworm are olive yellow, and males are rusty yellow. The larvae of the South American cotton bollworm, which belongs to the family Noctuidae, have 3-6 fine spiny bristles on the inside of the forefoot, and a thin top spiny bristles on the outside; the adult forewing is brown.

Insects of the same genus Noctuidae differ not only in morphological characteristics, but also in feeding habits. For example, the Chinese bollworm infests cotton bolls or corn ears with a borer type, while South American bollworms prefer soybeans. The difference in eating habits also implies that the enzymes and receptor proteins produced by the digestive system in the body are different. The enzymes produced in the digestive tract are the key to the function of Bt genes. Only enzymes or receptor proteins that can bind to specific Bt genes can make a certain Bt gene have an anti-insect effect on the pest. More and more studies have shown that insects of the same order, different families, and even different species of the same family have different sensitivity to the same Bt protein. For example, the Vip3Aa gene has shown insect resistance to Chilo suppressalis and Ostrinia furnacalis, both of the family Chilo suppressalis, but the Vip3Aa gene is not resistant to the Indian rice borer Plodia interpunctella and the European corn borer Ostrinia nubilalis, which belong to the same family. Insect effect. The above-mentioned pests belong to the family Lepidoptera Pyrocera, but the same Bt protein shows different resistance effects to these pests of Pyrididae. In particular, the European corn borer and the Asian corn borer even belong to the genus Ostrinia (the same order, the same family and the same genus) in the classification, but their responses to the same Bt protein are completely different, which more fully shows that the Bt protein and The interaction between enzymes and receptors in insects is complex and unpredictable.

The genome of a plant, plant tissue or plant cell in the present invention refers to any genetic material in a plant, plant tissue or plant cell, and includes cell nucleus, plastid and mitochondrial genome.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene", which encodes a protein or polypeptide in a desired host cell. Those skilled in the art can easily recognize that the polynucleotide and/or nucleotide of the present invention can be placed under the control of the regulatory sequence in the target host.

As is well known to those skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other strand, and vice versa. As DNA replicates in plants, other complementary strands of DNA are produced. Thus, the present invention includes the use of polynucleotides and their complementary strands exemplified in the sequence listing. The "coding strand" commonly used in the art refers to the strand that is combined with the antisense strand. In order to express protein in the body, a strand of DNA is typically transcribed into a complementary strand of mRNA, which serves as a template to translate the protein. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" chain has a series of codons (the codons are three nucleotides, and reading three at a time can produce specific amino acids), which can be read as an open reading frame (ORF) to form the target protein or peptide. The present invention also includes RNA having functions equivalent to the exemplified DNA.

The nucleic acid molecules or fragments of the present invention hybridize with the Vip3Aa gene of the present invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Vip3Aa gene of the present invention. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain circumstances. In the present invention, if two nucleic acid molecules can form an anti-parallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules show complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present invention, when each nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, it is said that the two nucleic acid molecules show "complete complementarity". If two nucleic acid molecules can hybridize to each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize to each other with sufficient stability so that they anneal and bind to each other under conventional "highly stringent" conditions, the two nucleic acid molecules are said to have "complementarity". Deviation from complete complementarity is permissible, as long as the deviation does not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to be used as a primer or probe, it is only necessary to ensure that it has sufficient complementarity in sequence so that a stable double-stranded structure can be formed under the specific solvent and salt concentration used.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that can specifically hybridize with the complementary strand of another matched nucleic acid molecule under highly stringent conditions. Suitable stringent conditions to promote DNA hybridization, for example, treatment with 6.0× sodium chloride/sodium citrate (SSC) at approximately 45° C., and then washing with 2.0×SSC at 50° C. These conditions are important to those skilled in the art. Is well known. For example, the salt concentration in the washing step can be selected from about 2.0×SSC, 50°C under low stringency conditions to about 0.2×SSC, 50°C under high stringency conditions. In addition, the temperature conditions in the washing step can be raised from room temperature of about 22°C under low stringency conditions to approximately 65°C under high stringency conditions. The temperature conditions and the salt concentration can both change, or one of them can remain unchanged while the other variable changes. Preferably, the stringent conditions of the present invention may be in a 6×SSC, 0.5% SDS solution, and SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8 at 65°C. Specific hybridization occurred, and then the membrane was washed once with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

Therefore, sequences that have anti-insect activity and hybridize with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 and SEQ ID NO: 8 of the present invention under stringent conditions are included in the present invention. These sequences are at least about 40%-50% homologous, about 60%, 65%, or 70% homologous to the sequences of the present invention, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology.

The genes and proteins described in the present invention not only include specific example sequences, but also include parts and/or fragments (including comparison with the full-length protein and/or fragments) that preserve the insecticidal activity characteristics of the specific example protein End deletion), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins. The "variant" or "variation" refers to a nucleotide sequence encoding the same protein or an equivalent protein with insecticidal activity. The "equivalent protein" refers to a protein that has the same or substantially the same biological activity against South American cotton bollworm pests as the claimed protein.

The "fragment" or "truncated" of the DNA molecule or protein sequence in the present invention refers to a part of the original DNA or protein sequence (nucleotide or amino acid) involved or an artificially modified form (such as a sequence suitable for plant expression) ), the length of the aforementioned sequence may vary, but the length is sufficient to ensure (encode) that the protein is an insect toxin.

Using standard techniques, genes can be modified and gene variants can be easily constructed. For example, techniques for making point mutations are well known in the art. For another example, US Patent No. 5605793 describes a method of using DNA reassembly to generate other molecular diversity after random fragmentation. Commercial endonucleases can be used to make fragments of full-length genes, and exonucleases can be used in accordance with standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cleave nucleotides from the ends of these genes. A variety of restriction endonucleases can also be used to obtain genes encoding active fragments. Proteases can be used to directly obtain active fragments of these toxins.

In the present invention, equivalent proteins and/or genes encoding these equivalent proteins can be derived from Bt isolates and/or DNA libraries. There are many ways to obtain the insecticidal protein of the present invention. For example, antibodies against insecticidal proteins disclosed and claimed in the present invention can be used to identify and isolate other proteins from a protein mixture. In particular, antibodies may be caused by the part of the protein that is the most constant and most different from other Bt proteins. These antibodies can then be used to specifically identify equivalent proteins with characteristic activities by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins or equivalent proteins or fragments of such proteins disclosed in the present invention can be easily prepared using standard procedures in the art. The genes encoding these proteins can then be obtained from microorganisms.

Due to the abundance of genetic code, a variety of different DNA sequences can encode the same amino acid sequence. The production of these alternative DNA sequences encoding the same or substantially the same protein is within the skill level of those skilled in the art. These different DNA sequences are included within the scope of the present invention. The "substantially the same" sequence refers to a sequence that has amino acid substitutions, deletions, additions or insertions but does not substantially affect the insecticidal activity, and also includes fragments that retain the insecticidal activity.

The substitution, deletion or addition of amino acid sequence in the present invention is a conventional technique in the art. Preferably, such amino acid changes are: small property changes, that is, conservative amino acid substitutions that do not significantly affect protein folding and/or activity; small deletions, Usually about 1-30 amino acid deletions; small amino or carboxy terminal extensions, such as one methionine residue at the amino terminal; small connecting peptides, such as about 20-25 residues long.

Examples of conservative substitutions are those that occur within the following amino acid groups: basic amino acids (such as arginine, lysine, and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids ( Such as glutamine, asparagine), hydrophobic amino acids (such as leucine, isoleucine and valine), aromatic amino acids (such as phenylalanine, tryptophan and tyrosine), and small molecules Amino acids (such as glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that generally do not change a specific activity are well known in the art and have been described by, for example, N. Neurath and R.L. Hill in "Protein" published by Academic Press in 1979. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their opposite interchanges.

It is obvious to those skilled in the art that such substitutions can occur outside the regions that play an important role in the function of the molecule and still produce active polypeptides. For the polypeptides of the present invention, the amino acid residues that are necessary for its activity and are therefore selected not to be substituted can be identified according to methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (see, for example, Cunningham and Wells , 1989, Science 244: 1081-1085). The latter technique is to introduce mutations at each positively charged residue in the molecule, and detect the anti-insect activity of the resulting mutant molecule to determine the amino acid residues that are important to the activity of the molecule. The substrate-enzyme interaction site can also be determined by the analysis of its three-dimensional structure. This three-dimensional structure can be determined by techniques such as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, for example, de Vos et al., 1992, Science 255 : 306-312; Smith et al., 1992, J. Mol. Biol 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

In the present invention, the Vip3Aa protein includes but is not limited to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7 The amino acid sequence with certain homology is also included in In the present invention. The similarity/identity between these sequences and the sequences of the present invention is typically greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99%. The preferred polynucleotides and proteins of the present invention can also be defined according to more specific ranges of identity and/or similarity. For example, the sequences exemplified by the present invention are 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity.

The regulatory sequences in the present invention include but are not limited to promoters, transit peptides, terminators, enhancers, leader sequences, introns and other regulatory sequences operably linked to the Vip3Aa protein.

The promoter is a promoter that can be expressed in a plant, and the "promoter that can be expressed in a plant" refers to a promoter that ensures that the coding sequence linked to it is expressed in plant cells. The promoter expressible in plants may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoter derived from cauliflower mosaic virus, Arabidopsis Ubi10 promoter, maize Ubi promoter, rice GOS2 gene promoter, etc. Alternatively, the expressible promoter in a plant can be a tissue-specific promoter, that is, the promoter directs the expression level of the coding sequence in some tissues of the plant, such as in green tissues, to be higher than that of other tissues of the plant (by conventional RNA test to determine), such as PEP carboxylase promoter. Alternatively, the promoter expressible in plants may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern refers to that when a plant is subjected to mechanical or insect gnawing trauma, the expression of the coding sequence under the control of the promoter is significantly higher than that under normal growth conditions. Examples of wound-inducing promoters include, but are not limited to, promoters of potato and tomato protease inhibitor genes (pin I and pinII) and maize protease inhibitor gene (MPI).

The transit peptide (also known as a secretion signal sequence or a targeting sequence) is to guide the transgene product to a specific organelle or cell compartment. For the receptor protein, the transit peptide can be heterologous, for example, using the encoded chloroplast to transport The peptide sequence targets the chloroplast, or uses the'KDEL' retention sequence to target the endoplasmic reticulum, or uses the CTPP of the barley lectin gene to target the vacuole.

The leader sequence includes, but is not limited to, a picornavirus leader sequence, such as EMCV leader sequence (encephalomyocarditis virus 5'non-coding region); Potato Y virus group leader sequence, such as MDMV (maize dwarf mosaic virus) leader sequence; Human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequence (AMV RNA4) of the coat protein mRNA of alfalfa mosaic virus; leader sequence of tobacco mosaic virus (TMV).

The enhancer includes, but is not limited to, the cauliflower mosaic virus (CaMV) enhancer, the scrophularia mosaic virus (FMV) enhancer, the carnation weathering loop virus (CERV) enhancer, and the cassava vein mosaic virus (CsVMV) enhancer , Porphyra mosaic virus (MMV) enhancer, Night scented tree yellow leaf curl virus (CmYLCV) enhancer, Multan cotton leaf curl virus (CLCuMV), Dayflower yellow mottle virus (CoYMV) and peanut chlorotic line Mosaic virus (PCLSV) enhancer.

For monocot applications, the introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron and the "super ubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, a polyadenylation signal sequence derived from Agrobacterium tumefaciens nopaline synthase (NOS) gene , Polyadenylation signal sequence derived from protease inhibitor II (pin II) gene, polyadenylation signal sequence derived from pea ssRUBISCO E9 gene and α-tubulin (α-tubulin) gene Polyadenylation signal sequence.

In the present invention, "effective linkage" refers to the linkage of nucleic acid sequences, and the linkage allows a sequence to provide a function required for the linked sequence. In the present invention, the "effective connection" can be to connect a promoter to a sequence of interest, so that the transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and it is desired to obtain expression of the protein, "effectively linking" means: the promoter is connected to the sequence in a manner that allows the resulting transcript to be efficiently translated. If the connection between the promoter and the coding sequence is a transcript fusion and the expression of the encoded protein is desired, such a connection is made so that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the connection between the promoter and the coding sequence is translational fusion and it is desired to realize the expression of the encoded protein, make such a connection so that the first translation initiation codon contained in the 5'untranslated sequence and the promoter They are connected, and the way of connection is such that the relationship between the obtained translation product and the translation open reading frame of the desired protein is in line with the reading frame. Nucleic acid sequences that can be "operably linked" include, but are not limited to: sequences that provide gene expression functions (ie gene expression elements, such as promoters, 5'untranslated regions, introns, protein coding regions, 3'untranslated regions, poly Adenylation site and/or transcription terminator), sequences that provide DNA transfer and/or integration functions (i.e. T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), provide options Sexual function sequences (i.e. antibiotic resistance markers, biosynthetic genes), sequences that provide scoring marker functions, sequences that assist sequence manipulation in vitro or in vivo (i.e. polylinker sequences, site-specific recombination sequences) and provide The sequence of the replication function (ie the bacterial origin of replication, autonomous replication sequence, centromere sequence).

The "insecticide" or "insect resistance" mentioned in the present invention means that it is toxic to crop pests, so as to achieve "control" and/or "control" crop pests. Preferably, the "insecticide" or "insect resistance" refers to killing crop pests. More specifically, the target insect is the South American cotton bollworm pest.

The Vip3Aa protein in the present invention is toxic to South American cotton bollworm pests. The plant of the present invention, especially soybean, contains exogenous DNA in its genome. The exogenous DNA contains a nucleotide sequence encoding the Vip3Aa protein. South American cotton bollworm pests contact the protein by feeding on plant tissues. After contact, South America The growth of cotton bollworm pests is inhibited and/or causes death. Inhibition refers to lethal or sublethal. At the same time, the plants should be normal in morphology and can be cultured under conventional methods for consumption and/or production of products. In addition, the plant can basically eliminate the need for chemical or biological insecticides (the chemical or biological insecticide is an insecticide for the South American cotton bollworm pest targeted by the Vip3Aa protein).

The expression level of insecticidal crystal protein (ICP) in plant materials can be detected by a variety of methods described in the art, for example, by applying specific primers to quantify the mRNA encoding the insecticidal protein produced in the tissue, or directly specific Measure the amount of insecticidal protein produced.

Different tests can be used to determine the insecticidal effect of ICP in plants. The target insect in the present invention is mainly South American cotton bollworm.

In the present invention, the Vip3Aa protein may have the amino acid sequence shown in SEQ ID NO: 1 and SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7 in the sequence list. In addition to the coding region of the Vip3Aa protein, other elements may also be included, such as a protein encoding a selectable marker.

In addition, the expression cassette containing the nucleotide sequence encoding the Vip3Aa protein of the present invention can also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including but not limited to, glufosinate Phosphine resistance genes (such as bar gene, pat gene), bendichlor resistance gene (such as pmph gene), glyphosate resistance gene (such as EPSPS gene), bromoxynil resistance gene, sulfonylurea Resistance genes, resistance genes to the herbicide thatchquat, resistance genes to cyanamide or resistance genes to glutamine synthetase inhibitors (such as PPT), so as to obtain both high insecticidal activity and herbicidal activity Agent-resistant transgenic plants.

In the present invention, foreign DNA is introduced into a plant, such as a gene encoding the Vip3Aa protein or an expression cassette or a recombinant vector is introduced into plant cells. Conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, micro-launch bombardment, Direct DNA ingestion into protoplasts, electroporation or whisker silicon-mediated DNA introduction.

The present invention provides a method for controlling pests, which has the following advantages:

1. Internal control. The prior art mainly controls the harm of South American cotton bollworm pests through external effects, such as agricultural control, chemical control, physical control and biological control; and the present invention uses the Vip3Aa protein that can inhibit the growth of South American cotton bollworms by producing in the plant. The control of South American cotton bollworm pests is through internal factors.

2. No pollution and no residue. Although the chemical control methods used in the prior art have played a certain role in controlling the harm of South American bollworm pests, they also brought pollution, damage and residue to human, livestock and farmland ecosystems; the present invention is used to control South American bollworm pests. The method can eliminate the above-mentioned adverse consequences.

3. Prevention and treatment during the whole growth period. The methods used in the prior art to control South American bollworm pests are all phased, while the present invention protects plants throughout the growth period. Transgenic plants (Vip3Aa protein) can be used from germination, growth, to flowering and fruiting. Resist the damage of South American cotton bollworm.

4. Whole plant control. The methods of controlling South American bollworm pests used in the prior art are mostly local, such as foliar spraying; while the present invention protects the entire plant, such as the roots, leaves, stems, and fruits of transgenic plants (Vip3Aa protein) , Male ears, female ears, anthers, etc. are all resistant to South American cotton bollworm.

5. The effect is stable. The frequency-vibration insecticidal lamp used in the prior art not only needs to clean up the dirt of the high-voltage power grid in time every day, but also cannot be used during thunderstorms; the present invention enables the Vip3Aa protein to be expressed in the plant body, which effectively overcomes the frequency-vibration killing The effect of insect lamp is affected by external factors, and the control effect of the transgenic plant (Vip3Aa protein) of the present invention is stable and consistent in different locations, different times, and different genetic backgrounds.

6. Simple, convenient and economical. The frequency-vibration insecticidal lamp used in the prior art requires a large one-time investment, and improper operation also has the risk of electric shock; the present invention only needs to plant a transgenic plant capable of expressing Vip3Aa protein, and no other measures are required. , Thereby saving a lot of manpower, material and financial resources.

7. The effect is thorough. The method used in the prior art for controlling South American cotton bollworm pests has incomplete effects and only has a mitigating effect; while the transgenic plant (Vip3Aa protein) of the present invention has almost 100% control effect on the first hatched larvae of South American cotton bollworm. Individual surviving larvae basically stopped developing. After 3 days, the larvae were basically still in the initial hatching state. They were all obviously stunted and had stopped developing. They could not survive in the natural environment of the field, while the genetically modified plants were generally only slightly damaged.

The technical solutions of the present invention will be further described in detail below through the accompanying drawings and embodiments.

Description of the drawings

Fig. 1 is a construction flow chart of the recombinant cloning vector DBN01-T containing the nucleotide sequence of Vip3Aa-01 for use of the insecticidal protein of the present invention;

Fig. 2 is a construction flow chart of the recombinant expression vector DBN100002 containing the nucleotide sequence of Vip3Aa-01 for use of the insecticidal protein of the present invention.

detailed description

The technical solution of the application of the insecticidal protein of the present invention is further illustrated by specific examples below.

The first embodiment, gene acquisition and synthesis

1. Obtain the nucleotide sequence

The amino acid sequence (789 amino acids) of the Vip3Aa-01 insecticidal protein is shown in SEQ ID NO:1 in the sequence table; the nucleotide sequence of Vip3Aa-01 encoding the amino acid sequence of the Vip3Aa-01 insecticidal protein ( 2370 nucleotides), as shown in SEQ ID NO: 2 in the sequence table.

The amino acid sequence (789 amino acids) of the Vip3Aa-02 insecticidal protein is shown in SEQ ID NO: 3 in the sequence table; the Vip3Aa-02 nucleotide sequence encoding the amino acid sequence of the Vip3Aa-02 insecticidal protein ( 2370 nucleotides), as shown in SEQ ID NO: 4 in the sequence list.

The amino acid sequence (789 amino acids) of the Vip3Aa-03 insecticidal protein is shown in SEQ ID NO: 5 in the sequence table; the Vip3Aa-03 nucleotide sequence encoding the amino acid sequence of the Vip3Aa-03 insecticidal protein ( 2370 nucleotides), as shown in SEQ ID NO: 6 in the sequence list.

The amino acid sequence (789 amino acids) of the Vip3Aa-04 insecticidal protein is shown in SEQ ID NO: 7 in the sequence table; the Vip3Aa-04 nucleotide sequence encoding the amino acid sequence of the Vip3Aa-04 insecticidal protein ( 2370 nucleotides), as shown in SEQ ID NO: 8 in the sequence list.

The amino acid sequence (615 amino acids) of the Cry1Ab insecticidal protein, as shown in SEQ ID NO: 9 in the sequence table; the Cry1Ab nucleotide sequence (1848 nucleotides) encoding the amino acid sequence of the Cry1Ab insecticidal protein , As shown in SEQ ID NO: 10 in the sequence table.

The amino acid sequence of the Cry2Ab insecticidal protein (634 amino acids), as shown in SEQ ID NO: 11 in the sequence list; the Cry2Ab nucleotide sequence (1905 nucleotides) encoding the amino acid sequence of the Cry2Ab insecticidal protein , As shown in SEQ ID NO: 12 in the sequence table.

2. Synthesize the above nucleotide sequence

Synthesize the Vip3Aa-01 nucleotide sequence (as shown in SEQ ID NO: 2 in the sequence list), the Vip3Aa-02 nucleotide sequence (as shown in SEQ ID NO: 4 in the sequence list), and the Vip3Aa -03 nucleotide sequence (as SEQ ID NO: 6 in the sequence list), the Vip3Aa-04 nucleotide sequence (as SEQ ID NO: 8 in the sequence list), the Cry1Ab nucleotide sequence (as shown in the sequence list) In SEQ ID NO: 10) and the Cry2Ab nucleotide sequence (as shown in SEQ ID NO: 12 in the sequence list); the synthesized Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2) The 5'end is also connected with a Sca I restriction site, and the 3'end of the Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2) is also connected with a Spe I restriction site; the synthesized Vip3Aa-02 The 5'end of the nucleotide sequence (SEQ ID NO: 4) is also connected with a Sca I restriction site, and the 3'end of the Vip3Aa-02 nucleotide sequence (SEQ ID NO: 4) is also connected with Spe I Restriction site; the synthesized nucleotide sequence of Vip3Aa-03 (SEQ ID NO: 6) has a Sca I restriction site attached to the 5'end, and the nucleotide sequence of Vip3Aa-03 (SEQ ID NO: : 6) is also connected to the 3'end of the Spe I restriction site; the synthesized Vip3Aa-04 nucleotide sequence (SEQ ID NO: 8) is also connected to the 5'end of the Sca I restriction site, so The 3'end of the Vip3Aa-04 nucleotide sequence (SEQ ID NO: 8) is also connected with a Spe I restriction site; the 5'end of the synthesized Cry1Ab nucleotide sequence (SEQ ID NO: 10) is also Kas I restriction site is connected, and the 3'end of the Cry1Ab nucleotide sequence (SEQ ID NO: 10) is also connected to the BamH I restriction site; the synthesized Cry2Ab nucleotide sequence (SEQ ID NO: The 5'end of 12) is also connected with a Nco I restriction site, and the 3'end of the Cry2Ab nucleotide sequence (SEQ ID NO: 12) is also connected with an Spe I restriction site.

The second embodiment, construction of recombinant expression vector and transformation of Agrobacterium with recombinant expression vector

1. Construction of a recombinant cloning vector containing Vip3Aa gene

Connect the synthesized Vip3Aa-01 nucleotide sequence to the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and proceed according to the instructions of Promega's product pGEM-T vector to obtain the inverted recombinant cloning vector DBN01- T, the construction process is shown in Figure 1 (where Amp represents the ampicillin resistance gene; flori represents the replication origin of phage f1; LacZ is the actual codon of LacZ; SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase Enzyme promoter; Vip3Aa-01 is the nucleotide sequence of Vip3Aa-01 (SEQ ID NO: 2); MCS is the multiple cloning site).

Then the recombinant cloning vector DBN01-T was transformed into E. coli T1 competent cells (Transgen, Beiing, China, CAT: CD501) by the heat shock method, and the heat shock conditions were: 50 μL E. coli T1 competent cells, 10 μL plasmid DNA (recombinant Cloning vector DBN01-T), water bath at 42℃ for 30s; shaking culture at 37℃ for 1h (shaking at 100rpm speed), coated with IPTG (isopropylthio-β-D-galactoside) and X-gal (5-bromo-4-chloro-3-indole-β-D-galactoside) ampicillin (100mg/L) LB plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/ L. Agar 15g/L, adjusted to pH 7.5 with NaOH) overnight. Pick white colonies and culture them in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, adjusted to pH 7.5 with NaOH) at 37℃ overnight. Alkaline extraction of the plasmid: Centrifuge the bacterial solution at 12000rpm for 1min, remove the supernatant, and precipitate the bacterial cells with 100μL ice-cold solution I (25mM Tris-HCl, 10mM EDTA (ethylenediaminetetraacetic acid), 50mM glucose , PH8.0) suspended; add 200μL of newly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; add 150μL ice cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, place on ice for 5-10min; centrifuge for 5min at a temperature of 4℃ and rotate at 12000rpm, add 2 volumes of absolute ethanol to the supernatant and mix After homogenization, leave it at room temperature for 5 minutes; centrifuge for 5 minutes at a temperature of 4°C and a speed of 12000 rpm, discard the supernatant, wash the pellet with ethanol with a concentration (V/V) of 70% and dry; add 30 μL of RNase (20 μg/ml) Dissolve the precipitate with TE (10mM Tris-HCl, 1mM EDTA, pH8.0); digest the RNA in a water bath at 37°C for 30 minutes; store at -20°C for later use.

After the extracted plasmid was identified by Sca I and Spe I, the positive clones were sequenced and verified. The results showed that the nucleotide sequence of Vip3Aa-01 inserted in the recombinant cloning vector DBN01-T was SEQ ID NO: 2 in the sequence table. The nucleotide sequence shown, that is, the nucleotide sequence of Vip3Aa-01 is inserted correctly.

According to the above method of constructing the recombinant cloning vector DBN01-T, the synthesized nucleotide sequence of Vip3Aa-02 was connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Vip3Aa-02 is Vip3Aa-02 Nucleotide sequence (SEQ ID NO: 4). Enzyme digestion and sequencing verified the correct insertion of the Vip3Aa-02 nucleotide sequence in the recombinant cloning vector DBN02-T.

According to the above method of constructing the recombinant cloning vector DBN01-T, the synthesized nucleotide sequence of Vip3Aa-03 was connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein Vip3Aa-03 is Vip3Aa-03 Nucleotide sequence (SEQ ID NO: 6). Enzyme digestion and sequencing verified the correct insertion of the Vip3Aa-03 nucleotide sequence in the recombinant cloning vector DBN03-T.

According to the above method of constructing the recombinant cloning vector DBN01-T, the synthesized nucleotide sequence of Vip3Aa-04 was connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, where Vip3Aa-04 is Vip3Aa-04 Nucleotide sequence (SEQ ID NO: 8). Enzyme digestion and sequencing verified the correct insertion of the Vip3Aa-04 nucleotide sequence in the recombinant cloning vector DBN04-T.

According to the above method of constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab nucleotide sequence was connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN05-T, wherein Cry1Ab is the Cry1Ab nucleotide sequence (SEQ ID NO: 10). Enzyme digestion and sequencing verified the correct insertion of the Cry1Ab nucleotide sequence in the recombinant cloning vector DBN05-T.

According to the above method of constructing the recombinant cloning vector DBN01-T, the synthesized Cry2Ab nucleotide sequence was connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN06-T, wherein Cry2Ab is the Cry2Ab nucleotide sequence (SEQ ID NO: 12). Enzyme digestion and sequencing verified the correct insertion of the Cry2Ab nucleotide sequence in the recombinant cloning vector DBN06-T.

2. Construct a recombinant expression vector containing the Vip3Aa gene

Restriction enzymes Sca I and Spe I were used to digest the recombinant cloning vector DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from the CAMBIA agency)), and cut the nucleotide sequence of Vip3Aa-01 The fragment is inserted between the Sca I and Spe I sites of the expression vector DBNBC-01, and the vector construction using conventional enzyme digestion methods is well known to those skilled in the art, and the recombinant expression vector DBN100002 is constructed. The construction process is shown in Figure 2. Shows (Kan: kanamycin gene; RB: right border; prAtUbi10: Arabidopsis Ubiquitin (ubiquitin) gene promoter (SEQ ID NO: 13); Vip3Aa-01: Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2); tNos: the terminator of nopaline synthase gene (SEQ ID NO: 14); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 15); PAT: glufosinate acetyltransferase gene ( SEQ ID NO: 16); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 17); LB: left border).

The recombinant expression vector DBN100002 was transformed into E. coli T1 competent cells by heat shock method. The heat shock conditions were: 50μL E. coli T1 competent cells, 10μL plasmid DNA (recombinant expression vector DBN100002), 42℃ water bath for 30s; 37℃ shaking culture 1h (shaking on a shaker at 100rpm); then on a LB solid plate containing 50mg/L Kanamycin (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L , Adjust the pH to 7.5 with NaOH) and incubate at 37℃ for 12h, pick the white colonies, and place them in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamya 50mg/L, adjusted to pH 7.5 with NaOH) incubate overnight at 37°C. Alkaline extraction of its plasmid. The extracted plasmid was digested with restriction enzymes ScaI and SpeI and identified, and the positive clones were sequenced and identified. The results showed that the nucleotide sequence of the recombinant expression vector DBN100002 between the ScaI and Spe I sites was SEQ in the sequence table. ID NO: The nucleotide sequence shown in 2, namely the nucleotide sequence of Vip3Aa-01.

According to the above method for constructing the recombinant vector DBN100002, the Vip3Aa-02 nucleotide sequence cut from the recombinant cloning vector DBN02-T with Sca I and Spe I was inserted into the expression vector DBNBC-01 to obtain the recombinant vector DBN100741. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100741 contained the nucleotide sequence shown in SEQ ID NO: 4 in the sequence list, namely the Vip3Aa-02 nucleotide sequence, the Vip3Aa-02 nucleotide sequence The prAtUbi10 promoter and tNos terminator can be connected.

According to the above method for constructing the recombinant vector DBN100002, the Vip3Aa-03 nucleotide sequence cut from the recombinant cloning vector DBN03-T with Sca I and Spe I was inserted into the expression vector DBNBC-01 to obtain the recombinant vector DBN100742. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100742 contained the nucleotide sequence shown in SEQ ID NO: 6 in the sequence list, that is, the Vip3Aa-03 nucleotide sequence, the Vip3Aa-03 nucleotide sequence The prAtUbi10 promoter and tNos terminator can be connected.

According to the above method for constructing the recombinant vector DBN100002, the Vip3Aa-04 nucleotide sequence cut from the recombinant cloning vector DBN04-T with Sca I and Spe I was inserted into the expression vector DBNBC-01 to obtain the recombinant vector DBN100743. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100743 contained the nucleotide sequence shown in SEQ ID NO: 8 in the sequence list, that is, the Vip3Aa-04 nucleotide sequence, the Vip3Aa-04 nucleotide sequence The prAtUbi10 promoter and tNos terminator can be connected.

According to the above method of constructing the recombinant vector DBN100002, Sca I and Spe I, Kas I and BamH I were respectively digested with the Vip3Aa-02 nucleotide sequence and Cry1Ab nucleoside from the recombinant cloning vectors DBN02-T and DBN05-T The acid sequence was inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN100003. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100003 contains the nucleotide sequence shown in SEQ ID NO: 4 and SEQ ID NO: 10 in the sequence list, namely the nucleotide sequence of Vip3Aa-02 and the nucleotide sequence of Cry1Ab. Acid sequence.

According to the above method of constructing the recombinant vector DBN100002, Sca I and Spe I, Nco I and Spe I were respectively digested with the Vip3Aa-01 nucleotide sequence and Cry2Ab nucleoside from the recombinant cloning vectors DBN01-T and DBN06-T The acid sequence was inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN100370. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100370 contains the nucleotide sequence shown in SEQ ID NO: 4 and SEQ ID NO: 12 in the sequence list, namely the nucleotide sequence of Vip3Aa-01 and the nucleotide sequence of Cry2Ab. Acid sequence.

3. Transformation of Agrobacterium with recombinant expression vector

The correctly constructed recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by liquid nitrogen, and the transformation conditions were: 100 μL agricultural Bacillus LBA4404, 3μL plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, 37°C warm water bath for 10 minutes; inoculate the transformed Agrobacterium LBA4404 into LB test tube at 28°C and rotate at 200rpm and culture for 2h, Apply to the LB plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L Kanamycin until a positive single clone grows, pick the single clone, culture and extract its plasmid, use restriction endonuclease to Recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 were digested and verified by restriction enzyme digestion. The results showed that the recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003, and DBN100370 were completely correct in structure.

The third embodiment, the acquisition of transgenic plants

1. Obtain genetically modified soybean plants

According to the conventional Agrobacterium infection method, the cotyledonary node tissue of the aseptically cultured soybean variety Zhonghuang 13 was co-cultured with the Agrobacterium described in 3 in the second embodiment to transform the recombinant T-DNA expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 (including the promoter sequence of the Arabidopsis ubiquitin gene, the nucleotide sequence of Vip3Aa-01, the nucleotide sequence of Vip3Aa-02, the nucleotide sequence of Vip3Aa-03 Nucleotide sequence, Vip3Aa-04 nucleotide sequence, Vip3Aa-02-Cry1Ab nucleotide sequence, Vip3Aa-01-Cry2Ab nucleotide sequence, PAT gene and tNos terminator sequence) were transferred into the soybean genome, and obtained Soybean plants transformed with the nucleotide sequence of Vip3Aa-01, Soybean plants transformed with the nucleotide sequence of Vip3Aa-02, Soybean plants transformed with the nucleotide sequence of Vip3Aa-03, Soybean plants transformed with the nucleotide sequence of Vip3Aa-04 Plants, soybean plants transformed with the nucleotide sequence of Vip3Aa-02-Cry1Ab and soybean plants transformed with the nucleotide sequence of Vip3Aa-01-Cry2Ab; at the same time, wild-type soybean plants were used as controls.

For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds are germinated in soybean germination medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) , Inoculate the seeds on the germination medium and cultivate them under the following conditions: temperature 25±1℃; photoperiod (light/dark) is 16/8h. 4-6 days after germination, take the aseptic soybean seedlings with the enlarged cotyledon nodes in bright green, cut off the hypocotyls 3-4mm below the cotyledon nodes, cut the cotyledons longitudinally, and remove the apical buds, lateral buds and seed roots. Use the back of a scalpel to wound the cotyledon node, and contact the wounded cotyledon node tissue with the Agrobacterium suspension, where the Agrobacterium can transfer the Vip3Aa nucleotide sequence to the wounded cotyledon node tissue (Step 1: Infection step ) In this step, the cotyledon node tissue is preferably immersed in the Agrobacterium suspension (OD ₆₆₀ =0.5-0.8), and the infection medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS) 40mg/L, 2-morpholineethanesulfonic acid (MES) 4g/L, and zeatin (ZT) 2mg/L, pH5.3) to start the vaccination. The cotyledon node tissue is co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation step). Preferably, the cotyledon node tissue after the infection step is in a solid medium (MS salt 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L , PH5.6). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, the recovery medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamine Acid 100mg/L, aspartic acid 100mg/L, pH 5.6) contains at least one antibiotic (cephalosporin) that is known to inhibit the growth of Agrobacterium, and no selective agent for plant transformants is added (Step 3: Recovery step ). Preferably, the regenerated tissue mass of the cotyledon node is cultured on a solid medium with antibiotics but no selective agent to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the tissue pieces regenerated from the cotyledon nodes are cultured on a medium containing a selection agent (glufosinate) and the growing transformed callus is selected (step 4: selection step). Preferably, the tissue masses regenerated from the cotyledon nodes are selected in a selective solid medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, 6-benzyl adenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glufosinate 6mg/L, pH5.6), leading to the selection of transformed cells Sexual growth. Then, the transformed cells regenerate plants (step 5: regeneration step). Preferably, the tissue masses regenerated from the cotyledon nodes grown on the medium containing the selection agent are in a solid medium (B5 differentiation medium and B5 rooting medium) Cultivate on top to regenerate plants.

The screened resistant tissue pieces were transferred to the B5 differentiation medium (B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cephalosporin 150mg/L L, glutamic acid 50 mg/L, aspartic acid 50 mg/L, gibberellin 1 mg/L, auxin 1 mg/L, glufosinate 6 mg/L, pH 5.6) were cultured and differentiated at 25°C. The differentiated seedlings are transferred to the B5 rooting medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole-3- Butyric acid (IBA) 1mg/L), in the rooting culture, cultivated at 25°C to a height of about 10cm, and moved to the greenhouse to cultivate until it becomes fruity. In the greenhouse, culture at 26°C for 16 hours a day, and then at 20°C for 8 hours.

Fourth embodiment, use TaqMan to verify transgenic plants

Take the soybean plant transferred into the Vip3Aa-01 nucleotide sequence, the soybean plant transferred into the Vip3Aa-02 nucleotide sequence, the soybean plant transferred into the Vip3Aa-03 nucleotide sequence, and the Vip3Aa-04 nucleotide sequence About 100mg of leaves of soybean plants, soybean plants with the nucleotide sequence of Vip3Aa-02-Cry1Ab and soybean plants with the nucleotide sequence of Vip3Aa-01-Cry2Ab were used as samples, and the genome was extracted with Qiagen’s DNeasy Plant Maxi Kit DNA, the copy number of PAT gene was detected by Taqman probe fluorescence quantitative PCR method to determine the copy number of Vip3Aa gene. At the same time, the wild-type soybean plant was used as a control, and the detection and analysis were performed according to the above method. The experiment is set to be repeated 3 times and the average value is taken.

The specific method for detecting the copy number of PAT gene is as follows:

Step 11. Obtain the soybean plant transferred into the Vip3Aa-01 nucleotide sequence, the soybean plant transferred into the Vip3Aa-02 nucleotide sequence, the soybean plant transferred into the Vip3Aa-03 nucleotide sequence, and transfer into the Vip3Aa-04 core 100 mg of the leaves of soybean plants with nucleotide sequence, soybean plants with Vip3Aa-02-Cry1Ab nucleotide sequence, soybean plants with Vip3Aa-01-Cry2Ab nucleotide sequence, and wild-type soybean plant, respectively, in a mortar Use liquid nitrogen to grind into a homogenate, and take 3 replicates for each sample;

Step 12. Use Qiagen's DNeasy Plant Mini Kit to extract the genomic DNA of the above sample, and refer to its product manual for specific methods;

Step 13. Use NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above sample;

Step 14. Adjust the genomic DNA concentration of the above sample to the same concentration value, and the range of the concentration value is 80-100ng/μL;

Step 15. Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the identified sample with known copy number as the standard product, and use the wild-type soybean plant sample as the control, 3 replicates for each sample, and take the average Value; the sequence of the fluorescent quantitative PCR primer and probe are:

The following primers and probes are used to detect the PAT nucleotide sequence:

Primer 1: gagggtgttgtggctggtattg is shown in SEQ ID NO: 18 in the sequence list;

Primer 2: tctcaactgtccaatcgtaagcg is shown in SEQ ID NO: 19 in the sequence table;

Probe 1: cttacgctgggccctggaaggctag is shown in SEQ ID NO: 20 in the sequence table;

The PCR reaction system is:

The 50× primer/probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in an amber test tube at 4°C.

The PCR reaction conditions are:

Use SDS2.3 software (Applied Biosystems) to analyze the data.

The experimental results showed that the nucleotide sequence of Vip3A-01, the nucleotide sequence of Vip3Aa-02, the nucleotide sequence of Vip3A-03, the nucleotide sequence of Vip3A-04, the nucleotide sequence of Vip3Aa-02-Cry1Ab and the nucleotide sequence of Vip3Aa-01- The Cry2Ab nucleotide sequence has been integrated into the genome of the tested soybean plant, and the soybean plant with the Vip3Aa-01 nucleotide sequence, the soybean plant with the Vip3Aa-02 nucleotide sequence, and the Vip3Aa- Soybean plant with 03 nucleotide sequence, soybean plant with Vip3Aa-04 nucleotide sequence, soybean plant with Vip3Aa-02-Cry1Ab nucleotide sequence and soybean with Vip3Aa-01-Cry2Ab nucleotide sequence The plants all obtained single-copy transgenic soybean plants.

Fifth embodiment, detection of insect resistance effect of transgenic plants

Soybean plants transformed into the nucleotide sequence of Vip3Aa-01, soybean plants transformed into the nucleotide sequence of Vip3Aa-02, soybean plants transformed into the nucleotide sequence of Vip3Aa-03, and those transformed into the nucleotide sequence of Vip3Aa-04 Soybean plants, soybean plants transformed with the nucleotide sequence of Vip3Aa-02-Cry1Ab, soybean plants transformed with the nucleotide sequence of Vip3Aa-01-Cry2Ab, wild-type soybean plants, and soybean plants identified as non-transgenic by Taqman to South American cotton boll The anti-insect effect of Chinese cotton bollworm and Chinese cotton bollworm was tested.

Take the soybean plant transferred into the Vip3Aa-01 nucleotide sequence, the soybean plant transferred into the Vip3Aa-02 nucleotide sequence, the soybean plant transferred into the Vip3Aa-03 nucleotide sequence, and the Vip3Aa-04 nucleotide sequence Soybean plants, soybean plants transformed into the nucleotide sequence of Vip3Aa-02-Cry1Ab and soybean plants transformed into the nucleotide sequence of Vip3Aa-01-Cry2Ab, wild-type soybean plants and soybean plants identified as non-transgenic by Taqman (V3 Rinse the fresh leaves of the first second leaf) with sterile water and use gauze to absorb the water on the leaves, then remove the veins, and cut them into a circle with a diameter of about 1cm. Take 1-3 pieces (determine the leaves according to the insect feed Quantity) The cut round leaves are placed on the filter paper in the hole of the bioassay plate, the filter paper is moistened with distilled water, and each hole is covered with 1 newly hatched larva, and the temperature is 26-28°C, relative humidity After being placed for 5 days under the conditions of 70-80% and photoperiod (light/dark) 16:8, the mortality and leaf damage rate of South American cotton bollworm and Chinese cotton bollworm (leaf damage rate refers to the area of the leaf eaten by the pest) The percentage of total leaf area) indicator. 2 strains (S1, S2) with the nucleotide sequence of Vip3Aa-01, 2 strains (S3, S4) with the nucleotide sequence of Vip3Aa-02, and Vip3Aa-03 A total of 2 strains (S5, S6) with the sequence, a total of 2 strains (S7, S8) with the nucleotide sequence of Vip3Aa-04, and a total of 2 strains with the nucleotide sequence of Vip3Aa-02-Cry1Ab Lines (S9, S10), a total of 2 strains (S11, S12) that were transformed into the nucleotide sequence of Vip3Aa-01-Cry2Ab, were identified as non-transgenic (NGM) by Taqman, a total of 1 strain, wild type ( Negative control, CK) 1 strain; 6 strains from each strain were selected for testing, and 32 bioassay holes were repeated for each strain. Among the experiments on the anti-insect effect of transgenic plants, the South American cotton bollworm experiment was completed in Agenyan, South America. The results are shown in Table 1 to Table 4.

Table 1. The lethality of South American cotton bollworm after inoculation of genetically modified soybean plants

Table 2. The lethality of Chinese cotton bollworm after inoculation of genetically modified soybean plants

Table 3 Leaf damage of South American cotton bollworm inoculated with transgenic soybean plants

Table 4 Leaf damage of genetically modified soybean plants inoculated with Chinese cotton bollworm

The results of Table 1 and Table 3 show that: soybean plants transformed into the nucleotide sequence of Vip3Aa-01, soybean plants transformed into the nucleotide sequence of Vip3Aa-02, soybean plants transformed into the nucleotide sequence of Vip3Aa-03, transformed into Soybean plants with the nucleotide sequence of Vip3Aa-04, soybean plants with the nucleotide sequence of Vip3Aa-02-Cry1Ab and soybean plants with the nucleotide sequence of Vip3Aa-01-Cry2Ab all have good killing effects on the South American cotton bollworm. Insect effect, the average mortality of South American cotton bollworm is more than 90%; meanwhile, the above soybean plants are generally only slightly damaged by South American cotton bollworm, and the leaf damage rate is about 10%; and Taqman identified as non-transgenic soybean The lethality rate and leaf damage rate of South American cotton bollworm on the plant and wild-type soybean plant were about 7% and 47%, respectively.

The results in Table 2 and Table 4 show that: soybean plants transformed into the nucleotide sequence of Vip3Aa-01, soybean plants transformed into the nucleotide sequence of Vip3Aa-02, soybean plants transformed into the nucleotide sequence of Vip3Aa-03, transformed into Soybean plants with the nucleotide sequence of Vip3Aa-04, soybean plants with the nucleotide sequence of Vip3Aa-02-Cry1Ab and soybean plants with the nucleotide sequence of Vip3Aa-01-Cry2Ab have moderate insecticidal effects on the Chinese cotton bollworm Resistance, the average mortality rate of Chinese cotton bollworm is about 78%; at the same time, the above soybean plants are generally slightly damaged by Chinese cotton bollworm, and the leaf damage rate is about 18%; and Taqman identified non-transgenic soybean plants The lethality of Chinese cotton bollworm and the leaf damage rate of wild-type soybean plants were about 6% and 46%, respectively.

At the same time, the results in Table 1-4 also show that, compared with the Chinese cotton bollworm, soybean plants transformed with the Vip3Aa-01 nucleotide sequence, soybean plants transformed with the Vip3Aa-02 nucleotide sequence, and Vip3Aa- Soybean plant with 03 nucleotide sequence, soybean plant with Vip3Aa-04 nucleotide sequence, soybean plant with Vip3Aa-02-Cry1Ab nucleotide sequence and soybean with Vip3Aa-01-Cry2Ab nucleotide sequence The lethality rate of the plants to the newly hatched larvae of the South American cotton bollworm was significantly higher than that of the Chinese cotton bollworm; and the leaf damage rate of the South American cotton bollworm was significantly lower than that of the Chinese cotton bollworm.

This proves that the soybean plant with the nucleotide sequence of Vip3Aa-01, the soybean plant with the nucleotide sequence of Vip3Aa-02, the soybean plant with the nucleotide sequence of Vip3Aa-03, and the nucleotide sequence of Vip3Aa-04 Soybean plants with the sequence, soybean plants transformed with the nucleotide sequence of Vip3Aa-02-Cry1Ab, and soybean plants transformed with the nucleotide sequence of Vip3Aa-01-Cry2Ab all showed the activity of inhibiting the South American cotton bollworm, which is sufficient for South American The growth of Helicoverpa armigera produces adverse effects so that it can be controlled in the field, and this inhibitory activity is unexpected due to the Chinese Helicoverpa armigera.

The above experimental results also show that the soybean plant transferred into the Vip3Aa-01 nucleotide sequence, the soybean plant transferred into the Vip3Aa-02 nucleotide sequence, the soybean plant transferred into the Vip3Aa-03 nucleotide sequence, and the Vip3Aa-04 nuclear The control/control of the South American cotton bollworm by the soybean plant with the nucleotide sequence of Vip3Aa-02-Cry1Ab and the soybean plant with the nucleotide sequence of Vip3Aa-02-Cry1Ab and the soybean plant with the nucleotide sequence of Vip3Aa-01-Cry2Ab are obviously due to the plant itself. Vip3Aa protein is produced. Therefore, as is well known to those skilled in the art, based on the toxic effect of Vip3Aa protein on South American cotton bollworm, the plants transferred into Vip3Aa protein in the present invention can also produce at least one second insecticidal protein different from Vip3Aa protein. , Such as Cry protein.

In summary, the use of the insecticidal protein of the present invention is to control South American cotton bollworm pests by producing Vip3Aa protein that can kill the South American cotton bollworm in the plant; it is similar to the agricultural control methods, chemical control methods, and physical control methods used in the prior art. Compared with the biological control method, the present invention protects the plant during the whole growth period and the whole plant to prevent and control the infestation of South American cotton bollworm pests, and has no pollution, no residue, stable, thorough, simple, convenient and economical effect.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those of ordinary skill in the art should understand that the technology of the present invention can be The solutions are modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention.

Claims

A method for controlling South American cotton bollworm pests, which is characterized in that it comprises contacting the South American cotton bollworm pests with at least Vip3Aa protein.
The method for controlling South American cotton bollworm pests according to claim 1, wherein the Vip3Aa protein is present in at least a host cell that produces the Vip3Aa protein, and the South American cotton bollworm pest at least interacts with the host cell by ingesting the host cell. The Vip3Aa protein contact.
The method for controlling South American cotton bollworm pests according to claim 2, wherein the Vip3Aa protein is present in at least the bacteria or transgenic plants that produce the Vip3Aa protein, and the South American cotton bollworm pests feed on the bacteria or The tissue of the transgenic plant is at least in contact with the Vip3Aa protein, and the growth of the South American cotton bollworm pest after the contact is inhibited and/or death is caused, so as to realize the control of the South American cotton bollworm harmful to the plant.
The method for controlling South American cotton bollworm pests according to claim 3, wherein the tissue of the transgenic plant is root, leaf, stem, fruit, tassel, ear, anther or filament; preferably, the The plants are soybeans, cotton, firstfa, sunflower, chickpeas, and corn.
The method for controlling South American cotton bollworm pests according to any one of claims 1 to 4, wherein the amino acid sequence of the Vip3Aa protein has SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: the amino acid sequence shown in 7;

Preferably, the amino acid sequence of the Vip3Aa protein has a nucleotide sequence shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8.
The method for controlling South American cotton bollworm pests according to any one of claims 3 to 5, wherein the plant further comprises at least one second nucleotide different from the nucleotide encoding the Vip3Aa protein .
The method for controlling South American cotton bollworm pests according to claim 6, wherein the second nucleotide encodes Cry insecticidal protein, Vip insecticidal protein, protease inhibitor, lectin, α-starch Enzyme or peroxidase.
The method for controlling South American cotton bollworm pests according to claim 7, wherein the second nucleotide encodes a Cry1Ab protein or a Cry2Ab protein;

Preferably, the amino acid sequence of the Cry1Ab protein has the amino acid sequence shown in SEQ ID NO: 9; or the amino acid sequence of the Cry2Ab protein has the amino acid sequence shown in SEQ ID NO: 11;

More preferably, the nucleotide sequence of the Cry1Ab protein has the nucleotide sequence shown in SEQ ID NO: 10; or the nucleotide sequence of the Cry2Ab protein has the nucleotide sequence shown in SEQ ID NO: 12 .
The method for controlling South American cotton bollworm pests according to claim 6, wherein the second nucleotide is a dsRNA that inhibits important genes in target insect pests.
A use of Vip3Aa protein to control South American cotton bollworm pests.