CN111315218B

CN111315218B - Use of insecticidal proteins

Info

Publication number: CN111315218B
Application number: CN201980005158.9A
Authority: CN
Inventors: 韩超; 于彩虹; 谢香庭; 周毅; 刘海利
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2019-08-09
Filing date: 2019-08-09
Publication date: 2021-10-19
Anticipated expiration: 2039-08-09
Also published as: BR112021009540A2; BR112021009540B1; AR119615A1; WO2021026686A1; CN111315218A; UY38823A

Abstract

Use of a pesticidal protein comprising: contacting the Nanmei cotton bollworm pest with at least Vip3Aa protein to control the Nanmei cotton bollworm pest by generating Vip3Aa protein in the plant body capable of killing Nanmei cotton bollworm.

Description

Use of insecticidal proteins

Technical Field

The invention relates to application of a pesticidal protein, in particular to application of Vip3Aa protein in controlling a Nanmei cotton bollworm-damaged plant through expression in the plant.

Background

Helicoverpa gelotopoeon, a plant belonging to the genus Trichoplusia of the Lepidoptera family, is distributed mainly in southern America countries and regions such as Brazil, Argentina, Boravia, Paraguay and Urguay. The Nanmei cotton bollworm is a multi-feeding pest and mainly harms commercial crops such as soybean, cotton, alfalfa, sunflower, chickpea, corn and the like, and is characterized in that: the whole larval stage can be most plant tissues such as harmful stalks, leaves, inflorescences, fruits and the like. The soybean is favored, the larvae can take 81.8% of the tissues of the overground part of the soybean, and the larvae can consume 340cm²The soybean leaves of the soybean seeds can consume 15 soybean seeds with the larval end age, and the yield is seriously influenced.

Cultivated soybean (Glycine max (L.) Merri), an important commercial crop grown worldwide as a major source of vegetable oil and vegetable protein, is an important food and feed crop in china. Soybean is one of the most favorite plants of nanmei cotton bollworm, and in argentina, the soybean is damaged and the yield is reduced by 5 to 30 percent in each year, which causes serious economic loss. For the control of Nanmei cotton bollworms, agricultural, chemical, physical and biological control are the main methods commonly used by people.

Agricultural control is to comprehensively coordinate and manage multiple factors of the whole farmland ecosystem, regulate and control crop, pest and environmental factors and create a farmland ecological environment which is beneficial to crop growth and not beneficial to the occurrence of Nanmei cotton bollworms. In south America, most farmlands adopt a no-tillage cultivation mode, almost no agricultural control measures exist, and the population growth in overwintering in the last year is likely to promote the population outbreak in the next year and cause economic loss to crops such as soybeans.

The chemical control, that is, the pesticide control, is to utilize chemical insecticide to kill pests, is an important component of comprehensive control of the Nanmei cotton bollworm, has the characteristics of rapidness, convenience, simplicity and high economic benefit, and is an essential emergency measure especially under the condition that the Nanmei cotton bollworm is greatly generated. The chemical prevention and control method mainly comprises liquid medicine spraying and powder spraying, has a good prevention and control effect before 3 th instar of Nanmei cotton bollworm larvae, has small food consumption and weak drug resistance of the larvae, and can determine the larval stage of 1-2 th instar according to the peak stage of trapping and collecting the larvae under a lamp or determine the prevention and control time according to the damage state of the early instar larvae. Usually, 20% of chlorantraniliprole suspending agent, 48% of flubendiamide suspending agent, 25% of high-efficiency cyfluthrin microcapsule suspending agent or 48% of chlorpyrifos solution is selected for spraying. Chemical control also has limitations, such as pesticide damage to crops, pesticide resistance of pests, natural enemy killing, environmental pollution, destruction of farmland ecosystem, threat to safety of pesticide residues to people and livestock, and the like, which are caused by improper use.

Physical control mainly utilizes various physical factors such as light, electricity, color, temperature and humidity and mechanical equipment for trapping, radiation sterilization and the like to control pests according to the reaction of the pests on various physical factors in environmental conditions. When the adult insects are sent out, the adult insects are trapped and killed by a net puff or light. The strong phototaxis of the Nanmei cotton bollworm imagoes is utilized, and black lights are arranged in the eclosion period to trap and kill the imagoes so as to reduce the egg falling amount and the larva density in the field; however, the black light lamp needs to clean up dirt on the optical filter in time every day, otherwise the black light can be influenced to emit, and further the insect killing effect is influenced; the requirement on the stability of the power supply voltage is high, and the operation of the device also has the danger of hurting eyes of people; furthermore, the lamp is installed in a relatively large investment.

Biological control is to control the population quantity of pests by using certain beneficial organisms or biological metabolites so as to achieve the purpose of reducing or eliminating the pests, such as selecting pesticides with low toxicity to natural enemies, adjusting the pesticide application time according to the difference of the occurrence periods of the pests and the natural enemies in the field, and avoiding pesticide application when a large number of natural enemies occur so as to protect the natural enemies; and secondly, releasing trichogramma (Trichogrammatidae) or spraying Bacillus thuringiensis SD-5 and Nanmei cotton bollworm nucleopolyhedrosis virus preparations to control Nanmei cotton bollworms. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; however, the effect is often unstable and the same investment is required for the occurrence of light weight and weight of Nanmei cotton bollworms.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes of coding insecticidal proteins from bacillus thuringiensis into plants through research.

The Vip3Aa insecticidal protein is one of a number of insecticidal proteins, a specific protein produced by bacillus thuringiensis. The Vip3Aa protein has a poisoning effect on sensitive insects by triggering apoptotic-type apoptosis. The Vip3Aa protein is hydrolyzed in the insect gut to 4 major protein products, of which only one (66KD) is the toxic core structure of Vip3Aa protein. The Vip3Aa protein binds to the midgut epithelial cells of sensitive insects, initiating apoptosis, causing lysis of the midgut epithelial cells leading to insect death. It has no disease to non-sensitive insects, and will not cause apoptosis and lysis of midgut epithelial cells.

Plants transformed with Vip3Aa have been shown to be resistant to lepidopteran (Lepidoptera) pests such as black cutworm, Heliothis armigera and Spodoptera frugiperda, however, there has been no report to date on the control of plant damage by Nanmei Heliothis armigera by generating transgenic plants expressing Vip3Aa protein.

Disclosure of Invention

The invention aims to provide the application of insecticidal protein, provides a method for controlling harm of Nanmei cotton bollworms to plants by generating transgenic plants expressing Vip3Aa protein for the first time, and effectively overcomes the technical defects of agricultural control, chemical control, physical control, biological control and the like in the prior art.

To achieve the above objects, the present invention provides a method for controlling a Nanomelas cotton bollworm pest, comprising contacting the Nanomelas cotton bollworm pest with at least Vip3Aa protein.

Further, the Vip3Aa protein is present in a host cell that produces at least the Vip3Aa protein, and the southern American cotton bollworm pest is in contact with at least the Vip3Aa protein by feeding the host cell.

Still further, the Vip3Aa protein is present in a bacterium or transgenic plant that produces at least the Vip3Aa protein, and the corn earworm pest is contacted with at least the Vip3Aa protein by feeding a tissue of the bacterium or transgenic plant, upon which the corn earworm pest growth is inhibited and/or caused to die, to achieve control of corn earworm damage to the plant.

The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, female ear, anther or filament.

The plant is semen glycines, semen Phaseoli Radiati, semen Vignae sinensis, caulis et folium Brassicae campestris, caulis et folium Brassicae Capitatae, cauliflower, Chinese cabbage, and radix Raphani.

The transgenic plant may be at any stage of growth.

The control of the Nanomean Heliothis armigera hazard plants is not altered by changes in the planting location and/or planting time.

The contacting step is preceded by the step of growing a plant comprising a polynucleotide encoding the Vip3Aa protein.

Preferably, the amino acid sequence of the Vip3Aa protein has an amino acid sequence shown as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5 or SEQ ID NO. 7. The nucleotide sequence of the Vip3Aa protein has a nucleotide sequence shown in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6 or SEQ ID NO. 8.

On the basis of the above technical scheme, the plant can also comprise at least one second nucleotide which is different from the nucleotide for encoding the Vip3Aa protein.

Further, the second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In the present invention, expression of the Vip3Aa protein in a transgenic plant may be accompanied by expression of one or more Cry-class insecticidal proteins and/or Vip-class insecticidal proteins. Co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering the plant to contain and express the desired genes. Alternatively, one plant (the 1 st parent) may be genetically engineered to express a Vip3Aa protein and a second plant (the 2 nd parent) may be genetically engineered to express a Cry-like insecticidal protein and/or a Vip-like insecticidal protein. Progeny plants expressing all the genes introduced into the 1 st and 2 nd parents are obtained by crossing the 1 st and 2 nd parents.

Preferably, the second nucleotide encodes a Cry1Ab or Cry2Ab protein.

Furthermore, the amino acid sequence of the Cry1Ab protein has an amino acid sequence shown as SEQ ID NO. 9. The nucleotide sequence of the Cry1Ab protein has a nucleotide sequence shown as SEQ ID NO. 10. The amino acid sequence of the Cry2Ab protein has an amino acid sequence shown as SEQ ID NO. 11. The nucleotide sequence of the Cry2Ab protein has a nucleotide sequence shown as SEQ ID NO. 12.

Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the target insect pest.

In order to achieve the above object, the present invention also provides a use of Vip3Aa protein for controlling Nanmei cotton bollworm pests.

To achieve the above objects, the present invention also provides a method for producing a plant for controlling a bollworm pest in south america, comprising introducing into the genome of said plant a polynucleotide sequence encoding a Vip3Aa protein.

To achieve the above objects, the present invention also provides a method for producing a plant propagule for controlling a Nanomelas cotton bollworm pest, comprising crossing a first plant obtained by said method with a second plant, and/or removing reproductive tissue from the plant obtained by said method for culture, thereby producing a plant propagule comprising a polynucleotide sequence encoding a Vip3Aa protein.

To achieve the above objects, the present invention also provides a method of growing a plant for controlling bollworm pests in south america, comprising:

growing at least one plant propagule comprising in its genome a polynucleotide sequence encoding a Vip3Aa protein;

growing the plant propagule into a plant;

growing the plant under conditions wherein the Nanomea gossypii insect pest is artificially inoculated and/or wherein the Nanomea gossypii insect pest is naturally harmed, and harvesting the plant with reduced plant damage and/or increased plant yield as compared to other plants not having the polynucleotide sequence encoding the Vip3Aa protein.

"plant propagules" as used herein include, but are not limited to, vegetative propagules and vegetative propagules. The plant sexual propagules include, but are not limited to, plant seeds; the vegetative propagation body of the plant refers to a vegetative organ or a special tissue of the plant body, and can generate a new plant under the condition of in vitro; the vegetative organ or a specific tissue includes, but is not limited to, roots, stems and leaves, such as: plants with roots as vegetative propagules include strawberry, sweet potato, and the like; plants with stems as vegetative propagules include sugarcane and potato (tubers); the plant with leaves as asexual propagules includes aloe, begonia, etc.

The term "contact" as used herein means touching, staying and/or feeding, in particular, insect and/or pest touching, staying and/or feeding, to a plant, plant organ, plant tissue or plant cell, which may be either a plant, plant organ, plant tissue or plant cell expressing an insecticidal protein in vivo, or a plant, plant organ, plant tissue or plant cell having an insecticidal protein on the surface and/or a microorganism producing an insecticidal protein.

The term "control" and/or "control" as used herein means that the Nanomelia gossypii insect pest is at least contacted with Vip3Aa protein, and growth of the Nanomelia gossypii insect pest is inhibited and/or caused to die after the contact. Further, the Nanomelas cotton bollworm pest is at least contacted with Vip3Aa protein by feeding plant tissue, and after contact, all or part of the Nanomelas cotton bollworm pest is inhibited from growing and/or caused to die. Inhibition refers to sublethal, i.e., not yet lethal, but capable of causing some effect in growth, development, behavior, physiology, biochemistry and tissue, such as slow and/or stopped growth. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, the plant and/or plant seed for controlling the Nanomea gossypii pest containing the polynucleotide sequence for encoding the Vip3Aa protein has reduced plant damage, including but not limited to improved leaf resistance, and/or increased kernel weight, and/or yield increase, etc., compared with a non-transgenic wild type plant under the condition of natural occurrence of harm caused by artificially inoculating the Nanomea gossypii pest and/or the Nanomea gossypii pest. The "controlling" and/or "controlling" effect of the Vip3Aa protein on southern American cotton bollworm may be independently present, in particular, any tissue of a transgenic plant (containing a polynucleotide sequence encoding a Vip3Aa protein) is present and/or produced simultaneously and/or asynchronously, the Vip3Aa protein and/or another substance that controls southern American cotton bollworm pests, the presence of said another substance being such that Vip3Aa does not result in said "controlling" and/or "controlling" effect being achieved wholly and/or in part by said another substance, independently of the Vip3Aa protein. Generally, in the field, the process of feeding plant tissues by the Nanmei cotton bollworm pests is short and difficult to observe by naked eyes, so that under the condition of artificially inoculating the Nanmei cotton bollworm pests and/or the naturally occurring harm of the Nanmei cotton bollworm pests, dead Nanmei cotton bollworm pests exist in any tissues of transgenic plants (containing a polynucleotide sequence for encoding Vip3Aa protein), and/or the Nanmei cotton bollworm pests with inhibited growth stay on the tissues, and/or the tissues have reduced plant damage compared with non-transgenic wild-type plants, namely, the method and/or the application of the invention are realized, namely, the method and/or the application for controlling the Nanmei cotton bollworm pests are realized by contacting the Nanmei cotton bollworm pests with at least Vip3Aa protein.

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA (dsRNA) -induced, highly efficient and specific degradation of homologous mrnas during evolution. RNAi techniques can thus be used in the present invention to specifically knock out or turn off the expression of particular genes in target insect pests, particularly genes associated with the growth and development of the target insect pests.

The wingspan of the adult Nanmei cotton bollworm can reach 30-40 mm; with an elongated wire antenna. The first pair of wings had a color that changed from light brown to dark brown with a clear kidney-shaped spot near the center. The marginal band of the wing is light brown and the minor marginal band is wider and darker in color than the rest of the wing. The second pair of wings was light brown with a clear tendency to darken towards the outer edges. The eggs were hemispherical, pearl white, and striped at the apex. The mature larvae were about 35 mm in length and varied in body color, and could be green, pink, yellow, brown or even black, with a jagged white band on each side of the body, and bright black bristle protrusions.

The Nanmei Helicoverpa is widely distributed in the countries and regions of south America, such as Brazil, Argentina, Boravia, Paraguay and Uguay. In argentina, 3-5 generations occur each year, lasting from 11 months of the last year to 4 months of the next year, each generation for 30-40 days. The worm overwinter by pupa, egg laying on flower bud and leaf after eclosion of adult worm, and single female yield reaches 300-1000 grains. The eggs and the larvae take 5-10 days, and the larvae begin to eat mesophyll after hatching, and the epidermis is left. The food intake is greatly increased at 3-5 years old, which causes a great amount of incised and holed leaves. The larva has a course of 12-20 days. The aged larva enters the ground to make cocoon and pupate. The damage degree of the Nanmei cotton bollworms is mainly influenced by the origin number and the temperature and humidity, the higher humidity and the lower temperature are beneficial to the occurrence in summer, but the heavy rain in the egg period and the early larva period is not beneficial to the occurrence.

In the classification system, lepidoptera is generally classified into suborder, superfamily, and family according to morphological characteristics such as the pulse order, linkage pattern, and the type of an antennary. The noctuidae family is the most abundant family in lepidoptera, more than 2 thousands of which are found in the world, and thousands of records are recorded in China only. Most of insects of the noctuidae family are pests of crops, and can eat leaves, eat bolls and the like, such as cotton bollworms, prodenia litura and the like. Although the cotton bollworms of China (Helicoverpa armigera), Spodoptera litura (Spodoptera litura) and the like and the Nanmei cotton bollworms belong to the Lepidoptera Noctuidae family, the cotton bollworms have great differences in morphological structures except for similarity in classification standards; as compared with the strawberry and the apple in the plant (belonging to Rosaceae of Rosales), the strawberry and apple all have the characteristics of flower amphipathy, radiation symmetry, 5 petals and the like, but the fruit and plant forms are very different. However, people are considered to be largely different in insect morphology because people are less exposed to insects, especially agricultural pests, and have less concern about differences in insect morphology. In fact, Nanmei Heliothis armigera has its unique characteristics, both in larval and adult forms. For example, the inner side of the forefeet of Chinese cotton bollworm and south American cotton bollworm larvae is provided with 1 large top-end inner thorn-shaped bristle and 1-3 thinner and gradually-reduced thorn-shaped bristles, and the outer side is provided with 2-4 gradually-reduced strong thorn-shaped bristles; the adult former wings, female bollworms of the Chinese cotton bollworm and the south American bollworm are olive yellow, and male worms are rust yellow. 3-6 fine spiny seta are arranged on the inner side of the front foot of the larva of Nanmei cotton bollworm of the noctuidae family, and 1 fine spiny seta at the top end are arranged on the outer side; the adult front wing is brown.

Insects belonging to the same genus and family of noctuidae are different in not only morphological characteristics but also feeding habits. For example, the Chinese bollworm is a cotton boll or corn ear damaged by borer, and the Nanmei bollworm prefers soybean. Differences in feeding habits also suggest that the enzymes and receptor proteins produced by the digestive system in vivo are different. Enzymes produced in the digestive tract are the key points for the Bt genes to act, and only enzymes or receptor proteins which can be combined with specific Bt genes can make certain Bt genes have insect-resistant effects on the pests. More and more studies have shown that insects from different families of the same order, and even from different species of the same family, exhibit different sensitivities to the same species of Bt proteins. For example, the Vip3Aa gene shows insect-resistant activity against Chilo suppresalis, a Chilo suppressalis, and Ostrinia furnacalis, both of the family Cyclinae, but the Vip3Aa gene has no insect-resistant effect against Plodia interpunctella, a Plumba internella, and Ostrinia nubilalis, both of the family Ostrinia. The pests belong to the lepidoptera family of snout moth, but the same Bt protein shows different resistance effects on the pests of the lepidoptera family of snout moth. In particular, European corn borer and Asian corn borer belong to Ostrinia (congeneric genus) of the family Bombycidae in classification even, but the responses to the same Bt protein are quite different, and more fully indicate that the interaction mode of the Bt protein with insect in-vivo enzymes and receptors is complex and unpredictable.

The genome of a plant, plant tissue or plant cell as defined in the present invention refers to any genetic material within a plant, plant tissue or plant cell and includes the nuclear and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene" encoding a protein or polypeptide in a desired host cell. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the present invention may be placed under the control of regulatory sequences in the host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one strand is complementary to the other strand, and vice versa. Other complementary strands of DNA are produced as the DNA replicates in plants. Thus, the present invention includes the use of the polynucleotides and their complementary strands exemplified in the sequence listing. The "coding strand" as commonly used in the art refers to the strand to which the antisense strand is joined. To express a protein in vivo, one strand of DNA is typically transcribed into the complementary strand of an mRNA, which serves as a template for translation of the protein. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, three of which at a time can yield a particular amino acid) that can be read as an Open Reading Frame (ORF) to form a protein or peptide of interest. The present invention also includes RNAs that are functional equivalent to the exemplified DNA.

The nucleic acid molecules of the invention or fragments thereof hybridize under stringent conditions to the Vip3Aa gene of the invention. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Vip3Aa gene of the invention. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present invention, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they can form an antiparallel double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one another if they exhibit complete complementarity. In the present invention, two nucleic acid molecules are said to exhibit "perfect complementarity" when each nucleotide of the two nucleic acid molecules is complementary to the corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from perfect complementarity may be tolerated as long as such deviations do not completely prevent the formation of a double-stranded structure by the two molecules. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure in the particular solvent and salt concentrations employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a compatible nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization include, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, as is well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be varied, or one may be held constant while the other is varied. Preferably, the stringent conditions of the present invention may be specific hybridization with SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8 in a 6 XSSC, 0.5% SDS solution at 65 ℃ followed by washing the membrane 1 time each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Thus, sequences having anti-insect activity and hybridizing under stringent conditions to SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 6 and SEQ ID NO 8 of the present invention are included in the present invention. These sequences are at least about 40% -50% homologous, about 60%, 65%, or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence homology to the sequences of the present invention.

The genes and proteins described in the present invention include not only the specific exemplified sequences, but also portions and/or fragments (including internal and/or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the pesticidal activity characteristics of the specific exemplified proteins. The "variant" or "variation" refers to a nucleotide sequence that encodes the same protein or encodes an equivalent protein with pesticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity against a bollworm pest in south america as the protein of claim.

"fragment" or "truncation" of a DNA molecule or protein sequence as described herein refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) or an artificially modified form thereof (e.g., a sequence suitable for plant expression) that may vary in length but is long enough to ensure that the (encoded) protein is an insect toxin.

Modification of genes and easy construction of gene variants can be achieved using standard techniques. For example, techniques for making point mutations are well known in the art. Another example is U.S. patent No. 5605793, which describes methods for generating other molecular diversity using DNA reassembly after random fragmentation. Fragments of the full-length gene can be made using commercial endonucleases, and exonucleases can be used following standard procedures. For example, nucleotides can be systematically excised from the ends of these genes using enzymes such as Bal31 or site-directed mutagenesis. A variety of restriction enzymes can also be used to obtain a gene encoding an active fragment. Active fragments of these toxins can be obtained directly using proteases.

The invention can derive equivalent proteins and/or genes encoding the equivalent proteins from Bt isolates and/or DNA libraries. There are various methods for obtaining the pesticidal proteins of the present invention. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from a mixture of proteins. In particular, antibodies may be caused by the most constant and different protein portions of the protein than other Bt proteins. These antibodies can then be used to specifically identify the equivalent proteins with characteristic activities by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins disclosed in the present invention or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. The genes encoding these proteins can then be obtained from the microorganism.

Due to the redundancy of the genetic code, a plurality of different DNA sequences may encode the same amino acid sequence. It is well within the skill of the art to generate such alternative DNA sequences encoding the same or substantially the same protein. These different DNA sequences are included in the scope of the present invention. The "substantially identical" sequence refers to a sequence having amino acid substitutions, deletions, additions or insertions which do not substantially affect pesticidal activity, and also includes fragments which retain pesticidal activity.

The substitution, deletion or addition of the amino acid sequence in the present invention is a conventional technique in the art, and it is preferable that such amino acid change is: small changes in properties, i.e., conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of about 1-30 amino acids; a small amino-or carboxy-terminal extension, e.g., one methionine residue to the amino terminus; small linker peptides, for example, about 20-25 residues in length.

Examples of conservative substitutions are those that occur within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions which do not normally alter a particular activity are well known in the art and have been described, for example, by N.Neurath and R.L.Hill in Protein, 1979, New York Academic Press. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and vice versa.

It will be apparent to those skilled in the art that such substitutions may occur outside the region which plays an important role in the function of the molecule and still result in an active polypeptide. For polypeptides of the invention whose activity is essential and therefore the choice of unsubstituted amino acid residues can be identified according to methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing mutations at each positively charged residue in the molecule and testing the resulting mutant molecules for anti-insect activity to determine amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure, which can be determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, e.g., de Vos et al, 1992, Science 255: 306-.

In the present invention, the Vip3Aa protein includes but is not limited to the amino acid sequence shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 7, which have a certain homology. These sequences typically have a similarity/identity of greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99% to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined according to more specific identity and/or similarity ranges. For example, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical and/or analogous to a sequence exemplified herein.

The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Vip3Aa protein.

The promoter is a promoter capable of being expressed in a plant, and the promoter capable of being expressed in the plant is a promoter which ensures that a coding sequence connected with the promoter is expressed in a plant cell. The promoter expressible in plants may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoter derived from cauliflower mosaic virus, Arabidopsis Ubi10 promoter, maize Ubi promoter, promoter of rice GOS2 gene, and the like. Alternatively, the plant expressible promoter may be a tissue specific promoter, i.e. a promoter that directs expression of the coding sequence at a higher level in some tissues of the plant, e.g. in green tissues, than in other tissues of the plant (as can be determined by conventional RNA assays), e.g. the PEP carboxylase promoter. Alternatively, the promoter expressible in a plant may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern means that when a plant is subjected to mechanical or insect feeding induced wounds, the expression of the coding sequence under the control of the promoter is significantly increased compared to under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of potato and tomato protease-inhibitory genes (pin I and pin II) and maize protease-inhibitory gene (MPI).

The transit peptide (also known as a secretion signal sequence or targeting sequence) is intended to direct the transgene product to a specific organelle or cellular compartment, and for the receptor protein, the transit peptide may be heterologous, e.g., targeting the chloroplast using a chloroplast transit peptide sequence, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence, or targeting the vacuole using the CTPP of the barley lectin gene.

The leader sequence includes, but is not limited to, a small RNA virus leader sequence, such as an EMCV leader sequence (encephalomyocarditis virus 5' non-coding region); potyvirus leaders, such as the MDMV (maize dwarf mosaic virus) leader; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequences of envelope protein mRNA of alfalfa mosaic virus (AMV RNA 4); tobacco Mosaic Virus (TMV) leader sequence.

Such enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, Figwort Mosaic Virus (FMV) enhancer, carnation weathering Circovirus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis Mosaic Virus (MMV) enhancer, midnight fragrant tree yellowing leaf curl virus (CmYLCV) enhancer, multan cotton leaf curl virus (CLCuMV), dayflower yellow mottle virus (CoYMV), and peanut chlorosis streak mosaic virus (PCLSV) enhancer.

For monocot applications, the intron includes, but is not limited to, the maize hsp70 intron, the maize ubiquitin intron, Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

As used herein, "operably linked" refers to the linkage of nucleic acid sequences such that one provides the functionality required of the linked sequence. In the present invention, the "operative linkage" may be a linkage of a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "operably linked" when the sequence of interest encodes a protein and expression of the protein is desired indicates that: the promoter is linked to the sequence in such a way that the resulting transcript is translated efficiently. If the linkage of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, such a linkage is made such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter and is linked in such a way that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to: sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 'untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and/or transcription terminators), sequences that provide DNA transfer and/or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that facilitate sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomously replicating sequences, centromeric sequences).

"pesticidal" or "pest-resistant" as used herein means toxic to crop pests, thereby achieving "control" and/or "control" of the crop pests. Preferably, the term "pesticidal" or "pest-resistant" refers to killing of a crop pest. More specifically, the target insect is a bollworm pest in south america.

The Vip3Aa protein of the invention has toxicity to Nanmei cotton bollworm pests. The plants of the invention, in particular soybean, contain in their genome exogenous DNA comprising a nucleotide sequence encoding a Vip3Aa protein with which a bollworm pest, southern American, contacts by feeding plant tissue, the growth of which is inhibited and/or caused to die after contact. Inhibition refers to lethal or sublethal. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. Furthermore, the plant may substantially eliminate the need for chemical or biological pesticides (which are pesticides against the bollworm pest targeted by Vip3Aa protein).

The expression level of Insecticidal Crystal Protein (ICP) in plant material can be detected by a variety of methods described in the art, for example by quantifying mRNA encoding an insecticidal protein produced in the tissue using specific primers, or by direct specific detection of the amount of insecticidal protein produced.

Different assays may be used to determine the pesticidal effect of ICP in plants. The target insect in the invention is mainly Nanmei cotton bollworm.

In the invention, the Vip3Aa protein can have an amino acid sequence shown by SEQ ID NO. 1 and SEQ ID NO. 3 or SEQ ID NO. 5 or SEQ ID NO. 7 in a sequence table. In addition to the coding region comprising the Vip3Aa protein, other elements may be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Vip3Aa protein of the present invention may also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including, but not limited to, a glufosinate-ammonium resistance gene (e.g., bar gene, pat gene), a phenmediphate resistance gene (e.g., pmph gene), a glyphosate resistance gene (e.g., EPSPS gene), a bromoxynil (broloxynil) resistance gene, a sulfonylurea resistance gene, a resistance gene to herbicide dalapon, a resistance gene to cyanamide, or a resistance gene to a glutamine synthetase inhibitor (e.g., PPT), thereby obtaining transgenic plants having both high pesticidal activity and herbicide resistance.

In the present invention, exogenous DNA is introduced into a plant, such as a gene or expression cassette or recombinant vector encoding the Vip3Aa protein into plant cells, and conventional transformation methods include, but are not limited to, agrobacterium-mediated transformation, microprojectile bombardment, direct uptake of DNA into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

The invention provides a method for controlling pests, which has the following advantages:

1. preventing and treating internal cause. In the prior art, the harm of the Nanmei cotton bollworm pests is mainly controlled through external action, namely external cause, such as agricultural control, chemical control, physical control and biological control; the invention controls the Nanmei cotton bollworm pests by generating Vip3Aa protein capable of inhibiting the growth of the Nanmei cotton bollworm in the plant body, namely, by internal cause.

2. No pollution and no residue. Although the chemical prevention and control method used in the prior art plays a certain role in controlling the harm of the Nanmei cotton bollworm pests, the chemical prevention and control method also causes pollution, damage and residue to human, livestock and farmland ecosystems; the adverse consequences described above can be eliminated using the method of the present invention for controlling bollworm pests in south america.

3. Preventing and treating in the whole growth period. The method for controlling the Nanmei cotton bollworm pests in the prior art is staged, but the invention protects the plants in the whole growth period, and the transgenic plants (Vip3Aa protein) can resist the damage of the Nanmei cotton bollworm from germination, growth, flowering and fruiting.

4. And (4) whole plant prevention and control. Most of the methods for controlling the Nanmei cotton bollworm pests used in the prior art are local, such as foliar spraying; the invention protects the whole plant, such as roots, leaves, stems, fruits, tassels, female ears, anthers and the like of a transgenic plant (Vip3Aa protein) which can resist the damage of the Nanmei cotton bollworm.

5. The effect is stable. The frequency vibration type insecticidal lamp used in the prior art not only needs to clean up the dirt of a high-voltage power grid in time every day, but also can not be used in a thunderstorm day; the Vip3Aa protein is expressed in the plant body, the defect that the effect of a frequency oscillation type insecticidal lamp is influenced by external factors is effectively overcome, and the control effect of the transgenic plant (Vip3Aa protein) is stable and consistent in different places, different times and different genetic backgrounds.

6. Simple, convenient and economical. The frequency oscillation type insecticidal lamp used in the prior art has large one-time investment and is in danger of hurting people by electric shock when not operated properly; according to the invention, only transgenic plants capable of expressing Vip3Aa protein need to be planted, and other measures are not needed, so that a great amount of manpower, material resources and financial resources are saved.

7. The effect is thorough. The method for controlling the Nanmei cotton bollworm pests in the prior art has incomplete effect and only plays a role in lightening; the prevention and control effect of the transgenic plant (Vip3Aa protein) on the south American cotton bollworm primarily hatched larvae is almost one hundred percent, extremely individual survival larvae basically stop developing, the larvae are basically still in the initially hatched state after 3 days, the larvae are obviously dysplastic and stop developing, the larvae cannot survive in the natural environment of the field, and the transgenic plant is slightly damaged.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a flow chart of construction of a recombinant cloning vector DBN01-T containing Vip3Aa-01 nucleotide sequence for use of the insecticidal protein of the invention;

FIG. 2 is a flow chart of construction of a recombinant expression vector DBN100002 containing a Vip3Aa-01 nucleotide sequence for use of the insecticidal protein of the invention.

Detailed Description

The technical scheme of the application of the insecticidal protein of the invention is further illustrated by the specific examples.

First example, Gene acquisition and Synthesis

1. Obtaining nucleotide sequences

An amino acid sequence (789 amino acids) of Vip3Aa-01 insecticidal protein is shown as SEQ ID NO:1 in a sequence table; the Vip3Aa-01 nucleotide sequence (2370 nucleotides) which encodes the amino acid sequence corresponding to the Vip3Aa-01 insecticidal protein is shown as SEQ ID NO:2 in the sequence table.

An amino acid sequence (789 amino acids) of Vip3Aa-02 insecticidal protein is shown as SEQ ID NO. 3 in a sequence table; a Vip3Aa-02 nucleotide sequence (2370 nucleotides) which encodes an amino acid sequence corresponding to the Vip3Aa-02 insecticidal protein, and is shown as SEQ ID NO:4 in the sequence table.

An amino acid sequence (789 amino acids) of Vip3Aa-03 insecticidal protein is shown as SEQ ID NO:5 in a sequence table; the Vip3Aa-03 nucleotide sequence (2370 nucleotides) which encodes the amino acid sequence corresponding to the Vip3Aa-03 insecticidal protein is shown as SEQ ID NO:6 in the sequence table.

An amino acid sequence (789 amino acids) of Vip3Aa-04 insecticidal protein is shown as SEQ ID NO. 7 in a sequence table; the Vip3Aa-04 nucleotide sequence (2370 nucleotides) which encodes the amino acid sequence corresponding to the Vip3Aa-04 insecticidal protein is shown as SEQ ID NO:8 in the sequence table.

Cry1Ab insecticidal protein amino acid sequence (615 amino acids) is shown as SEQ ID NO. 9 in the sequence table; a Cry1Ab nucleotide sequence (1848 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ab insecticidal protein, and is shown as SEQ ID NO:10 in a sequence table.

The amino acid sequence (634 amino acids) of Cry2Ab insecticidal protein is shown as SEQ ID NO:11 in the sequence table; a Cry2Ab nucleotide sequence (1905 nucleotides) which encodes an amino acid sequence corresponding to the Cry2Ab insecticidal protein, and is shown as SEQ ID NO:12 in a sequence table.

2. Synthesis of the above nucleotide sequence

Synthesizing the Vip3Aa-01 nucleotide sequence (shown as SEQ ID NO:2 in the sequence table), the Vip3Aa-02 nucleotide sequence (shown as SEQ ID NO:4 in the sequence table), the Vip3Aa-03 nucleotide sequence (shown as SEQ ID NO:6 in the sequence table), the Vip3Aa-04 nucleotide sequence (shown as SEQ ID NO:8 in the sequence table), the Cry1Ab nucleotide sequence (shown as SEQ ID NO:10 in the sequence table) and the Cry2Ab nucleotide sequence (shown as SEQ ID NO:12 in the sequence table); the 5 'end of the synthesized Vip3Aa-01 nucleotide sequence (SEQ ID NO:2) is also connected with a Sca I enzyme cutting site, and the 3' end of the Vip3Aa-01 nucleotide sequence (SEQ ID NO:2) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Vip3Aa-02 nucleotide sequence (SEQ ID NO:4) is also connected with a Sca I enzyme cutting site, and the 3' end of the Vip3Aa-02 nucleotide sequence (SEQ ID NO:4) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Vip3Aa-03 nucleotide sequence (SEQ ID NO:6) is also connected with a Sca I enzyme cutting site, and the 3' end of the Vip3Aa-03 nucleotide sequence (SEQ ID NO:6) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Vip3Aa-04 nucleotide sequence (SEQ ID NO:8) is also connected with a Sca I enzyme cutting site, and the 3' end of the Vip3Aa-04 nucleotide sequence (SEQ ID NO:8) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Cry1Ab nucleotide sequence (SEQ ID NO:10) is also connected with a Kas I enzyme cutting site, and the 3' end of the Cry1Ab nucleotide sequence (SEQ ID NO:10) is also connected with a BamH I enzyme cutting site; the 5 'end of the synthesized Cry2Ab nucleotide sequence (SEQ ID NO:12) is also connected with a Nco I enzyme cutting site, and the 3' end of the Cry2Ab nucleotide sequence (SEQ ID NO:12) is also connected with a Spe I enzyme cutting site.

Second embodiment, construction of recombinant expression vector and Agrobacterium transformation with recombinant expression vector

1. Construction of a recombinant cloning vector containing Vip3Aa Gene

The synthetic Vip3Aa-01 nucleotide sequence is connected to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), the operation steps are carried out according to the pGEM-T vector instruction of Promega company, and the construction process of the inverted recombinant cloning vector DBN01-T is shown in figure 1 (wherein Amp represents ampicillin resistance gene, f1ori represents replication origin of phage f1, LacZ is real codon of LacZ, SP6 is SP6 RNA polymerase promoter, T7 is T7 RNA polymerase promoter, Vip3Aa-01 is Vip3Aa-01 nucleotide sequence (SEQ ID NO:2), and MCS is multiple cloning site).

The recombinant cloning vector DBN01-T was then used to transform E.coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method under the following heat shock conditions: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42 ℃ for 30 s; the cells were cultured with shaking at 37 ℃ for 1h (shaking table at 100 rpm), and grown overnight on LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) coated with IPTG (isopropylthio-. beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) ampicillin (100mg/L) on their surfaces. White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ L ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 200. mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ L ice-cold solution III (3M potassium acetate, 5M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol (V/V), and air drying; adding 30. mu.L of TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20. mu.g/ml) to dissolve the precipitate; bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use.

After the extracted plasmid is subjected to enzyme digestion identification by Sca I and Spe I, sequencing verification is carried out on positive clones, and the result shows that the Vip3Aa-01 nucleotide sequence inserted into the DBN01-T recombinant cloning vector is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely the Vip3Aa-01 nucleotide sequence is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3Aa-02 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Vip3Aa-02 is the Vip3Aa-02 nucleotide sequence (SEQ ID NO: 4). And (4) verifying the correct insertion of the Vip3Aa-02 nucleotide sequence in the recombinant cloning vector DBN02-T by enzyme digestion and sequencing.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3Aa-03 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein the Vip3Aa-03 is the Vip3Aa-03 nucleotide sequence (SEQ ID NO: 6). And (4) verifying the correct insertion of the Vip3Aa-03 nucleotide sequence in the recombinant cloning vector DBN03-T by enzyme digestion and sequencing.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3Aa-04 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, wherein the Vip3Aa-04 is the Vip3Aa-04 nucleotide sequence (SEQ ID NO: 8). And (4) verifying the correct insertion of the Vip3Aa-04 nucleotide sequence in the recombinant cloning vector DBN04-T by enzyme digestion and sequencing.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN05-T, wherein Cry1Ab is Cry1Ab nucleotide sequence (SEQ ID NO: 10). Enzyme cutting and sequencing verify that the Cry1Ab nucleotide sequence in the recombinant cloning vector DBN05-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry2Ab nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN06-T, wherein Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO: 12). Enzyme cutting and sequencing verify that the Cry2Ab nucleotide sequence in the recombinant cloning vector DBN06-T is correctly inserted.

2. Construction of recombinant expression vector containing Vip3Aa Gene

The construction of a recombinant expression vector DBN100002, which is a well-known vector constructed by inserting a cut Vip3Aa-01 nucleotide sequence fragment between Sca I and Spe I sites of an expression vector DBNBC-01, is well known to those skilled in the art by cleaving the recombinant cloning vector DBN01-T and the expression vector DBNBC-01 with restriction enzymes Sca I and Spe I, respectively, and constructing a recombinant expression vector DBN100002 by a conventional cleavage method, and is shown in FIG. 2 (Kan: kanamycin gene; RB: right border; prAtUbi 10: Arabidopsis Ubiquitin gene promoter (SEQ ID NO:13), Vip3 Aa-01: Vip3Aa-01 nucleotide sequence (SEQ ID NO:2), tNos: nopaline synthase gene terminator (SEQ ID NO:14), prc 35S: cauliflower mosaic virus 35S promoter (SEQ ID NO:15), acetyltransferase gene (PAT ID NO: 8535: 16: nopaline synthase gene; cauliflower mosaic virus gene: 35S; SEQ ID NO: 8516: 8514) The toxin 35S terminator (SEQ ID NO: 17); LB: left border).

Transforming the recombinant expression vector DBN100002 into an Escherichia coli T1 competent cell by a heat shock method, wherein the heat shock condition is as follows: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100002), and 42 deg.C water bath for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Sca I and Spe I and then identified, and the positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100002 between the Sca I site and the Spe I site is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely the Vip3Aa-01 nucleotide sequence.

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-02 nucleotide sequence cut by the Sca I and Spe I enzyme digestion recombinant cloning vector DBN02-T is inserted into an expression vector DBNBC-01 to obtain the recombinant vector DBN 100741. The nucleotide sequence in the recombinant expression vector DBN100741 is verified to contain a nucleotide sequence shown as SEQ ID NO 4 in the sequence table, namely a Vip3Aa-02 nucleotide sequence, and the Vip3Aa-02 nucleotide sequence can be connected with the prAtUbi10 promoter and the tNos terminator.

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-03 nucleotide sequence cut by the Sca I and Spe I enzyme digestion recombinant cloning vector DBN03-T is inserted into an expression vector DBNBC-01 to obtain the recombinant vector DBN 100742. The nucleotide sequence in the recombinant expression vector DBN100742 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 6 in the sequence table, namely a Vip3Aa-03 nucleotide sequence, and the Vip3Aa-03 nucleotide sequence can be connected with the prAtUbi10 promoter and the tNos terminator.

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-04 nucleotide sequence cut by the Sca I and Spe I enzyme digestion recombinant cloning vector DBN04-T is inserted into an expression vector DBNBC-01 to obtain a recombinant vector DBN 100743. The nucleotide sequence in the recombinant expression vector DBN100743 is verified to contain a nucleotide sequence shown as SEQ ID NO 8 in the sequence table, namely a Vip3Aa-04 nucleotide sequence, and the Vip3Aa-04 nucleotide sequence can be connected with the prAtUbi10 promoter and the tNos terminator.

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-02 nucleotide sequence and the Cry1Ab nucleotide sequence cut by the recombinant cloning vector DBN02-T and the DBN05-T are inserted into the expression vector DBNBC-01 by enzyme digestion of Sca I, Spe I, Kas I and BamH I respectively, so that the recombinant expression vector DBN100003 is obtained. The nucleotide sequence in the recombinant expression vector DBN100003 is verified by enzyme digestion and sequencing to contain nucleotide sequences shown by SEQ ID NO:4 and SEQ ID NO:10 in a sequence table, namely a Vip3Aa-02 nucleotide sequence and a Cry1Ab nucleotide sequence.

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-01 nucleotide sequence and the Cry2Ab nucleotide sequence cut by the recombinant cloning vector DBN01-T and DBN06-T are inserted into the expression vector DBNBC-01 through enzyme digestion of Sca I and Spe I, and enzyme digestion of Nco I and Spe I respectively, so that the recombinant expression vector DBN100370 is obtained. The nucleotide sequence in the recombinant expression vector DBN100370 is verified to contain nucleotide sequences shown by SEQ ID NO. 4 and SEQ ID NO. 12 in the sequence table, namely a Vip3Aa-01 nucleotide sequence and a Cry2Ab nucleotide sequence.

3. Recombinant expression vector transformation agrobacterium tumefaciens

The correctly constructed recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 were transformed into Agrobacterium LBA4404 (Invitron, Chicago, USA, CAT: 18313-: 100. mu.L Agrobacterium LBA4404, 3. mu.L plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and heating in 37 deg.C water bath for 10 min; the transformed agrobacterium LBA4404 is inoculated in an LB test tube and cultured for 2h at the temperature of 28 ℃ and the rotating speed of 200rpm, the transformed agrobacterium LBA4404 is smeared on an LB plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin until positive monoclonals grow out, the monoclonals are picked up and cultured, plasmids thereof are extracted, restriction enzymes are used for enzyme digestion verification after the recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 are subjected to enzyme digestion, and the result shows that the structures of the recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 are completely correct.

Third example, obtaining transgenic plants

1. Obtaining transgenic soybean plants

The cotyledonary node tissue of yellow 13 in the aseptically cultured soybean variety was co-cultured with the Agrobacterium of example 3 according to the conventionally employed Agrobacterium infection method to transfer the T-DNAs (including promoter sequence of Arabidopsis ubiquitin gene, Vip3Aa-01 nucleotide sequence, Vip3Aa-02 nucleotide sequence, Vip3Aa-03 nucleotide sequence, Vip3Aa-04 nucleotide sequence, Vip3Aa-02-Cry1Ab nucleotide sequence, Vip3Aa-01-Cry2Ab nucleotide sequence, PAT gene and tNos terminator sequence) of the recombinant expression vectors DBN100002, DBN100741, DBN100742, DBN100743, DBN100003 and DBN100370 constructed in example 2 into soybean genome to obtain soybean plants of Vip3Aa-01 nucleotide sequence, Vip3Aa-02 nucleotide sequence, Vip3Aa-01 nucleotide sequence, Vip3Aa-03 nucleotide sequence, Vip 3-3 Aa nucleotide sequence, and soybean plants of Vip 3-3604 nucleotide sequence, Soybean plants transferred with Vip3Aa-02-Cry1Ab nucleotide sequence and soybean plants transferred with Vip3Aa-01-Cry2Ab nucleotide sequence; while wild-type soybean plants were used as controls.

For Agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1g/L, B5 vitamins, sucrose 20g/L, agar 8g/L, pH5.6), the seeds were inoculated on germination medium and cultured under the following conditions: the temperature is 25 +/-1 ℃; the photoperiod (light/dark) was 16/8 h. Taking the soybean aseptic seedling expanded at the fresh green cotyledonary node after germinating for 4-6 days, cutting off hypocotyl at 3-4mm position below the cotyledonary node, longitudinally cutting cotyledon, and removing terminal bud, side bud and seed root. Wounding at the cotyledonary node with the back of a scalpel, contacting the wounded cotyledonary node tissue with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the Vip3Aa nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step). in this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.5-0.8), medium (MS salts 2.15g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS)40mg/L, 2-morpholinoethanesulfonic acid (MES)4g/L, Zeatin (ZT)2mg/L, ph5.3) was infected to initiate inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium is present in the recovery medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6)(cephamycin), no selection agent for plant transformants was added (step 3: recovery step). Preferably, the regenerated tissue mass of cotyledonary nodes is cultured on solid medium with antibiotics but without a selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the regenerated tissue mass of cotyledonary node was cultured on a medium containing a selection agent (glufosinate) and the growing transformed callus was selected (step 4: selection step). Preferably, the regenerated tissue mass of cotyledonary node is cultured on selective solid medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP)1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glufosinate 6mg/L, pH5.6) resulting in selective growth of transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), and preferably, the cotyledonary node regenerated tissue pieces grown on a medium containing a selection agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate the plants.

The resistant tissue blocks obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1g/L, B5 vitamin, MES 1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cefamycin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6), and cultured and differentiated at 25 ℃. The differentiated plantlets are transferred to the B5 rooting medium (B5 salt 3.1g/L, B5 vitamins, MES 1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L and indole-3-butyric acid (IBA)1mg/L), cultured on the rooting medium at 25 ℃ to about 10cm high, and transferred to a greenhouse for culture until fructification occurs. In the greenhouse, the culture was carried out daily at 26 ℃ for 16h and at 20 ℃ for 8 h.

Fourth example, validation of transgenic plants Using TaqMan

Taking about 100mg of leaves of a soybean Plant with a Vip3Aa-01 nucleotide sequence, a soybean Plant with a Vip3Aa-02 nucleotide sequence, a soybean Plant with a Vip3Aa-03 nucleotide sequence, a soybean Plant with a Vip3Aa-04 nucleotide sequence, a soybean Plant with a Vip3Aa-02-Cry1Ab nucleotide sequence and a soybean Plant with a Vip3Aa-01-Cry2Ab nucleotide sequence as samples, extracting genomic DNA of the samples by using a DNeasy Plant Maxi Kit of Qiagen, and detecting the copy number of the PAT gene by a Taqman probe fluorescent quantitative PCR method to determine the copy number of the Vip3Aa gene. Meanwhile, wild soybean plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method for detecting the copy number of the PAT gene comprises the following steps:

step 11, respectively taking 100mg of leaves of a soybean plant transferred with a Vip3Aa-01 nucleotide sequence, a soybean plant transferred with a Vip3Aa-02 nucleotide sequence, a soybean plant transferred with a Vip3Aa-03 nucleotide sequence, a soybean plant transferred with a Vip3Aa-04 nucleotide sequence, a soybean plant transferred with a Vip3Aa-02-Cry1Ab nucleotide sequence, a soybean plant transferred with a Vip3Aa-01-Cry2Ab nucleotide sequence and a wild soybean plant, respectively grinding the leaves into homogenate by liquid nitrogen in a mortar, and taking 3 repeats of each sample;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild soybean plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the PAT nucleotide sequence:

primer 1: gagggtgttgtggctggtattg is shown as SEQ ID NO:18 in the sequence list;

primer 2: tctcaactgtccaatcgtaagcg is shown as SEQ ID NO:19 in the sequence list;

1, probe 1: cttacgctgggccctggaaggctag is shown as SEQ ID NO:20 in the sequence list;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at 4 ℃.

The PCR reaction conditions are as follows:

data were analyzed using SDS2.3 software (Applied Biosystems).

Experimental results show that Vip3A-01 nucleotide sequence, Vip3Aa-02 nucleotide sequence, Vip3A-03 nucleotide sequence, Vip3A-04 nucleotide sequence, Vip3Aa-02-Cry1Ab nucleotide sequence and Vip3Aa-01-Cry2Ab nucleotide sequence are integrated into the chromosome group of the detected soybean plant, and the soybean plant transferred with the Vip3Aa-01 nucleotide sequence, the soybean plant transferred with the Vip3Aa-02 nucleotide sequence, the soybean plant transferred with the Vip3Aa-03 nucleotide sequence, the soybean plant transferred with the Vip3Aa-04 nucleotide sequence, the soybean plant transferred with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plant transferred with the Vip3Aa-01-Cry2Ab nucleotide sequence all obtain single-copy transgenic soybean plants.

Fifth example, detection of insect-resistant Effect of transgenic plants

Carrying out insect-resistant effect detection on Nanmei cotton bollworms and Chinese cotton bollworms by using soybean plants with transferred Vip3Aa-01 nucleotide sequences, soybean plants with transferred Vip3Aa-02 nucleotide sequences, soybean plants with transferred Vip3Aa-03 nucleotide sequences, soybean plants with transferred Vip3Aa-04 nucleotide sequences, soybean plants with transferred Vip3Aa-02-Cry1Ab nucleotide sequences, soybean plants with transferred Vip3Aa-01-Cry2Ab nucleotide sequences, wild type soybean plants and soybean plants identified as non-transgenic by Taqman.

Respectively taking a soybean plant with a transferred Vip3Aa-01 nucleotide sequence, a soybean plant with a transferred Vip3Aa-02 nucleotide sequence, a soybean plant with a transferred Vip3Aa-03 nucleotide sequence, a soybean plant with a transferred Vip3Aa-04 nucleotide sequence, a soybean plant with a transferred Vip3Aa-02-Cry1Ab nucleotide sequence, a soybean plant with a transferred Vip3Aa-01-Cry2Ab nucleotide sequence, a wild type soybean plant and fresh leaves of a soybean plant (V3 stage inverted two leaves) identified as a non-transgenic soybean plant by Taqman, washing the leaves with sterile water, sucking the water on the leaves with gauze, removing the leaves, cutting into a circle with the diameter of about 1cm, taking 1-3 round leaves (the number of the leaves is determined according to the insect appetite), putting the round leaves into filter paper in raw plate holes, wetting the filter paper with distilled water, putting 1 head in each hole for initial incubation, and covering each hole, after the cotton bollworm and the Chinese cotton bollworm are placed for 5 days under the conditions that the temperature is 26-28 ℃, the relative humidity is 70-80% and the photoperiod (light/dark) is 16:8, indexes of the death rate and the leaf damage rate (the leaf damage rate refers to the proportion of the leaf area eaten by pests to the total area of the leaves) of the south American cotton bollworm and the Chinese cotton bollworm are counted. 2 strains in total (S1, S2) are transferred into Vip3Aa-01 nucleotide sequence, 2 strains in total (S3, S4) are transferred into Vip3Aa-02 nucleotide sequence, 2 strains in total (S5, S6) are transferred into Vip3Aa-03 nucleotide sequence, 2 strains in total (S7, S8) are transferred into Vip3Aa-04 nucleotide sequence, 2 strains in total (S9, S10) are transferred into Vip3Aa-02-Cry1Ab nucleotide sequence, 2 strains in total (S11, S12) are transferred into Vip3Aa-01-Cry2Ab nucleotide sequence, 1 strain in total is identified as non-transgenic (NGM) by Taqman, and 1 strain in wild type (negative control, CK); 6 strains were selected from each line and tested, repeating 32 bioassay wells per strain. Among the experiments of the insect-resistant effect of transgenic plants, the experiments of Nanmei cotton bollworm were completed in Nanmei Argentina. The results are shown in tables 1 to 4.

TABLE 1 mortality of Nanmei Cotton bollworm after transgenic Soybean plant inoculation

TABLE 2 mortality of Cotton bollworm in China after inoculation of transgenic Soybean plants

TABLE 3 leaf damage of transgenic Soybean plants inoculated with Nanmei Cotton bollworm

TABLE 4 leaf damage of transgenic Soybean plants inoculated with Helicoverpa sinensis

The results in tables 1 and 3 show that: the soybean plant with the Vip3Aa-01 nucleotide sequence, the soybean plant with the Vip3Aa-02 nucleotide sequence, the soybean plant with the Vip3Aa-03 nucleotide sequence, the soybean plant with the Vip3Aa-04 nucleotide sequence, the soybean plant with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plant with the Vip3Aa-01-Cry2Ab nucleotide sequence have good insecticidal effect on Nanmei cotton bollworms, and the average death rate of the Nanmei cotton bollworms is more than 90 percent; meanwhile, the soybean plants are only slightly damaged by Nanmei cotton bollworms, and the damage rate of leaves is about 10 percent; the killing rate and the leaf damage rate of the Nanmei cotton bollworm of the soybean plant identified as non-transgenic by Taqman and the wild soybean plant are respectively about 7 percent and 47 percent.

The results in tables 2 and 4 show that: the insecticidal effect of the soybean plant with the Vip3Aa-01 nucleotide sequence, the soybean plant with the Vip3Aa-02 nucleotide sequence, the soybean plant with the Vip3Aa-03 nucleotide sequence, the soybean plant with the Vip3Aa-04 nucleotide sequence, the soybean plant with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plant with the Vip3Aa-01-Cry2Ab nucleotide sequence on the cotton bollworm in China belongs to medium resistance, and the average death rate of the cotton bollworm in China is about 78%; meanwhile, the soybean plants are generally slightly damaged by the Chinese cotton bollworms, and the damage rate of the leaves is about 18 percent; the death rate and the leaf damage rate of the Chinese cotton bollworm of the non-transgenic soybean plant and the wild soybean plant identified by Taqman are respectively about 6 percent and 46 percent.

Meanwhile, the results in tables 1-4 also show that compared with the cotton bollworm in China, the mortality rate of soybean plants with transferred Vip3Aa-01 nucleotide sequence, soybean plants with transferred Vip3Aa-02 nucleotide sequence, soybean plants with transferred Vip3Aa-03 nucleotide sequence, soybean plants with transferred Vip3Aa-04 nucleotide sequence, soybean plants with transferred Vip3Aa-02-Cry1Ab nucleotide sequence and soybean plants with transferred Vip3Aa-01-Cry2Ab nucleotide sequence to the larvae of the cotton bollworm in south America is obviously higher than that of the cotton bollworm in China; and the damage rate of the soybean plants to the leaves of the Nanmei cotton bollworm is obviously lower than that of the Chinese cotton bollworm.

Therefore, the soybean plant with the Vip3Aa-01 nucleotide sequence, the soybean plant with the Vip3Aa-02 nucleotide sequence, the soybean plant with the Vip3Aa-03 nucleotide sequence, the soybean plant with the Vip3Aa-04 nucleotide sequence, the soybean plant with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plant with the Vip3Aa-01-Cry2Ab nucleotide sequence show the activity of inhibiting the Nanmei cotton bollworm, the activity is enough to generate adverse effect on the growth of the Nanmei cotton bollworm, so that the Nanmei cotton bollworm is controlled in the field, and the activity inhibition is unpredictably superior to the Nanmai cotton bollworm.

The above experimental results also show that the control/prevention of the southern American cotton bollworm by the soybean plant with the Vip3Aa-01 nucleotide sequence, the soybean plant with the Vip3Aa-02 nucleotide sequence, the soybean plant with the Vip3Aa-03 nucleotide sequence, the soybean plant with the Vip3Aa-04 nucleotide sequence, the soybean plant with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plant with the Vip3Aa-01-Cry2Ab nucleotide sequence are obviously that the plant can generate Vip3Aa protein, so, the technicians in the field are familiar with the technology, and the plant with the Vip3Aa protein can also generate at least one second insecticidal protein different from the Vip3Aa protein, such as Cry-type protein, according to the poisoning effect of the Vip3Aa protein on the southern American cotton bollworm.

In conclusion, the application of the insecticidal protein disclosed by the invention is used for controlling the Nanmei cotton bollworm pests by generating Vip3Aa protein capable of killing the Nanmei cotton bollworms in plants; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the whole plant in the whole growth period to control the damage of the Nanmei cotton bollworm pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Beijing Dabei agricultural Biotechnology Co., Ltd

<120> use of insecticidal proteins

<130> CP1190645P-CN/CB

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3Aa-01 amino acid Sequence (Artificial Sequence)

<400> 1

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Ile Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 2

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3Aa-01 nucleotide Sequence (Artificial Sequence)

<400> 2

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcattaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 3

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3Aa-02 amino acid Sequence (Artificial Sequence)

<400> 3

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 4

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3Aa-02 nucleotide Sequence (Artificial Sequence)

<400> 4

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 5

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3Aa-03 amino acid Sequence (Artificial Sequence)

<400> 5

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Leu Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 6

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3Aa-03 nucleotide Sequence (Artificial Sequence)

<400> 6

atgaacaaga acaacaccaa gctgagcacc cgcgccctgc cgagcttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcgacctgac cctggacgag atcctgaaga accagcagct gctgaacgac 180

atcagcggca agctggacgg cgtgaacggc agcctgaacg acctgatcgc ccagggcaac 240

ctgaacaccg agctgagcaa ggagatcctt aagatcgcca acgagcagaa ccaggtgctg 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcgcgtgta cctgccgaag 360

atcaccagca tgctgagcga cgtgctcaag cagaactacg ccctgagcct gcagatcgag 420

tacctgagca agcagctgca ggagatcagc gacaagctgg acatcatcaa cgtgaacgtc 480

ctgatcaaca gcaccctgac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aagagctgac cttcgccacc gagaccagca gcaaggtgaa gaaggacggc 600

agcccggccg acatcctgga cgagctgacc gagctgaccg agctggcgaa gagcgtgacc 660

aagaacgacg tggacggctt cgagttctac ctgaacacct tccacgacgt gatggtgggc 720

aacaacctgt tcggccgcag cgccctgaag accgccagcg agctgatcac caaggagaac 780

gtgaagacca gcggcagcga ggtgggcaac gtgtacaact tcctgatcgt gctgaccgcc 840

ctgcaggccc aggccttcct gaccctgacc acctgtcgca agctgctggg cctggccgac 900

atcgactaca ccagcatcat gaacgagcac ttgaacaagg agaaggagga gttccgcgtg 960

aacatcctgc cgaccctgag caacaccttc agcaacccga actacgccaa ggtgaagggc 1020

agcgacgagg acgccaagat gatcgtggag gctaagccgg gccacgcgtt gatcggcttc 1080

gagatcagca acgacagcat caccgtgctg aaggtgtacg aggccaagct gaagcagaac 1140

taccaggtgg acaaggacag cttgagcgag gtgatctacg gcgacatgga caagctgctg 1200

tgtccggacc agagcgagca aatctactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tgcgctacga ggtgaccgcc 1320

aacttctacg acagcagcac cggcgagatc gacctgaaca agaagaaggt ggagagcagc 1380

gaggccgagt accgcaccct gagcgcgaac gacgacggcg tctacatgcc actgggcgtg 1440

atcagcgaga ccttcctgac cccgatcaac ggctttggcc tgcaggccga cgagaacagc 1500

cgcctgatca ccctgacctg taagagctac ctgcgcgagc tgctgctagc caccgacctg 1560

agcaacaagg agaccaagct gatcgtgcca ccgagcggct tcatcagcaa catcgtggag 1620

aacggcagca tcgaggagga caacctggag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtcgaccaca ccggcggcgt gaacggcacc aaggccctgt acgtgcacaa ggacggcggc 1740

atcagccagt tcatcggcga caagctgaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca agccatcgat tcacctgaag gacgagaaca ccggctacat ccactacgag 1860

gacaccaaca acaacctgga ggactaccag accatcaaca agcgcttcac caccggcacc 1920

gacctgaagg gcgtgtacct gatcctgaag agccagaacg gcgacgaggc ctggggcgac 1980

aacttcatca tcctggagat cagcccgagc gagaagctgc tgagcccgga gctgatcaac 2040

accaacaact ggaccagcac cggcagcacc aacatcagcg gcaacaccct gaccctgtac 2100

cagggcggcc gcggcatcct gaagcagaac ctgcagctgg acagcttcag cacctaccgc 2160

gtgtacttca gcgtgagcgg cgacgccaac gtgcgcatcc gcaactcccg cgaggtgctg 2220

ttcgagaaga ggtacatgag cggcgccaag gacgtgagcg agatgttcac caccaagttc 2280

gagaaggaca acttctacat cgagctgagc cagggcaaca acctgtacgg cggcccgatc 2340

gtgcacttct acgacgtgag catcaagtag 2370

<210> 7

<211> 789

<212> PRT

<213> Artificial Sequence-Vip 3Aa-04 amino acid Sequence (Artificial Sequence)

<400> 7

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Ile Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 8

<211> 2370

<212> DNA

<213> Artificial Sequence-Vip 3Aa-04 nucleotide Sequence (Artificial Sequence)

<400> 8

atgaacaaga acaacaccaa gctgagcacc cgcgccctgc cgagcttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcgacctgac cctggacgag atcctgaaga accagcagct gctgaacgac 180

atcagcggca agctggacgg cgtgaacggc agcctgaacg acctgatcgc ccagggcaac 240

ctgaacaccg agctgagcaa ggagatcctt aagatcgcca acgagcagaa ccaggtgctg 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcgcgtgta cctgccgaag 360

atcaccagca tgctgagcga cgtgattaag cagaactacg ccctgagcct gcagatcgag 420

tacctgagca agcagctgca ggagatcagc gacaagctgg acatcatcaa cgtgaacgtc 480

ctgatcaaca gcaccctgac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aagagctgac cttcgccacc gagaccagca gcaaggtgaa gaaggacggc 600

agcccggccg acatcctgga cgagctgacc gagctgaccg agctggcgaa gagcgtgacc 660

aagaacgacg tggacggctt cgagttctac ctgaacacct tccacgacgt gatggtgggc 720

aacaacctgt tcggccgcag cgccctgaag accgccagcg agctgatcac caaggagaac 780

gtgaagacca gcggcagcga ggtgggcaac gtgtacaact tcctgatcgt gctgaccgcc 840

ctgcaggcca aggccttcct gaccctgacc acctgtcgca agctgctggg cctggccgac 900

atcgactaca ccagcatcat gaacgagcac ttgaacaagg agaaggagga gttccgcgtg 960

aacatcctgc cgaccctgag caacaccttc agcaacccga actacgccaa ggtgaagggc 1020

agcgacgagg acgccaagat gatcgtggag gctaagccgg gccacgcgtt gatcggcttc 1080

gagatcagca acgacagcat caccgtgctg aaggtgtacg aggccaagct gaagcagaac 1140

taccaggtgg acaaggacag cttgagcgag gtgatctacg gcgacatgga caagctgctg 1200

tgtccggacc agagcgagca aatctactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tgcgctacga ggtgaccgcc 1320

aacttctacg acagcagcac cggcgagatc gacctgaaca agaagaaggt ggagagcagc 1380

gaggccgagt accgcaccct gagcgcgaac gacgacggcg tctacatgcc actgggcgtg 1440

atcagcgaga ccttcctgac cccgatcaac ggctttggcc tgcaggccga cgagaacagc 1500

cgcctgatca ccctgacctg taagagctac ctgcgcgagc tgctgctagc caccgacctg 1560

agcaacaagg agaccaagct gatcgtgcca ccgagcggct tcatcagcaa catcgtggag 1620

aacggcagca tcgaggagga caacctggag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtcgaccaca ccggcggcgt gaacggcacc aaggccctgt acgtgcacaa ggacggcggc 1740

atcagccagt tcatcggcga caagctgaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca agccatcgat tcacctgaag gacgagaaca ccggctacat ccactacgag 1860

gacaccaaca acaacctgga ggactaccag accatcaaca agcgcttcac caccggcacc 1920

gacctgaagg gcgtgtacct gatcctgaag agccagaacg gcgacgaggc ctggggcgac 1980

aacttcatca tcctggagat cagcccgagc gagaagctgc tgagcccgga gctgatcaac 2040

accaacaact ggaccagcac cggcagcacc aacatcagcg gcaacaccct gaccctgtac 2100

cagggcggcc gcggcatcct gaagcagaac ctgcagctgg acagcttcag cacctaccgc 2160

gtgtacttca gcgtgagcgg cgacgccaac gtgcgcatcc gcaactcccg cgaggtgctg 2220

ttcgagaaga ggtacatgag cggcgccaag gacgtgagcg agatgttcac caccaagttc 2280

gagaaggaca acttctacat cgagctgagc cagggcaaca acctgtacgg cggcccgatc 2340

gtgcacttct acgacgtgag catcaagtag 2370

<210> 9

<211> 615

<212> PRT

<213> Artificial Sequence-Cry 1Ab amino acid Sequence (Artificial Sequence)

<400> 9

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr

610 615

<210> 10

<211> 1848

<212> DNA

<213> Artificial Sequence-Cry 1Ab nucleotide Sequence (Artificial Sequence)

<400> 10

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga 1848

<210> 11

<211> 634

<212> PRT

<213> Artificial Sequence-Cry 2Ab amino acid Sequence (Artificial Sequence)

<400> 11

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 12

<211> 1905

<212> DNA

<213> Artificial Sequence-Cry 2Ab nucleotide Sequence (Artificial Sequence)

<400> 12

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 13

<211> 1322

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 13

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 14

<211> 530

<212> DNA

<213> terminator (Agrobacterium tumefaciens)

<400> 14

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 15

<211> 529

<212> DNA

<213> promoter (Cauliflower mosaic virus)

<400> 15

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 16

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 16

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 17

<211> 195

<212> DNA

<213> terminator (Cauliflower mosaic virus)

<400> 17

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence-primer 1(Artificial Sequence)

<400> 18

gagggtgttg tggctggtat tg 22

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence-primer 2(Artificial Sequence)

<400> 19

tctcaactgt ccaatcgtaa gcg 23

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence-Probe 1(Artificial Sequence)

<400> 20

cttacgctgg gccctggaag gctag 25

Claims

1. A method for controlling Nanmei cotton bollworm pests is characterized by comprising the step of contacting the Nanmei cotton bollworm pests with at least Vip3Aa protein, wherein the amino acid sequence of the Vip3Aa protein is shown as SEQ ID NO. 1or SEQ ID NO. 3 or SEQ ID NO. 5 or SEQ ID NO. 7.

2. A method of controlling a bollworm pest as claimed in claim 1 wherein said Vip3Aa protein is present in a host cell producing at least said Vip3Aa protein and said bollworm pest is contacted with at least said Vip3Aa protein by feeding said host cell.

3. A method of controlling a bollworm pest as claimed in claim 2 wherein said Vip3Aa protein is present in a bacterium or transgenic plant producing at least said Vip3Aa protein, said bollworm pest being contacted at least with said Vip3Aa protein by ingestion of tissue of said bacterium or transgenic plant, upon which contact said bollworm pest growth is inhibited and/or caused to die, to effect control of bollworm damage to the plant.

4. A method of controlling bollworm pests according to claim 3 characterised in that the tissue of the transgenic plant is a root, leaf, stem, fruit, tassel, ear, anther or filament; the plant is semen glycines, cotton, herba Medicaginis, sunflower, semen Ciceris Arietini, and semen Maydis.

5. The method for controlling a Nanomea gossypii pest as claimed in any one of claims 1 to 4, wherein the nucleotide sequence of the Vip3Aa protein has the nucleotide sequence shown as SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 6 or SEQ ID NO 8.

6. A method of controlling a Nanomean pest according to claim 3 or 4, wherein said plant further comprises at least one second nucleotide different from the nucleotide encoding said Vip3Aa protein.

7. A method of controlling a bollworm pest as claimed in claim 5 wherein said plant further includes at least one second nucleotide different from the nucleotide encoding said Vip3Aa protein.

8. A method of controlling a Nanomean Cotton bollworm pest as claimed in claim 6 wherein said second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

9. A method of controlling a bollworm pest as claimed in claim 7 wherein said second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase or a peroxidase.

10. A method of controlling a bollworm pest as claimed in claim 8 or claim 9 wherein the second nucleotide encodes a Cry1Ab protein or a Cry2Ab protein.

11. The method for controlling bollworm pests according to claim 10 wherein the amino acid sequence of Cry1Ab protein has the amino acid sequence shown in SEQ ID No. 9; or the amino acid sequence of the Cry2Ab protein has the amino acid sequence shown as SEQ ID NO. 11.

12. The method for controlling a Nanomean cotton bollworm pest as claimed in claim 11, characterized in that the nucleotide sequence of the Cry1Ab protein has the nucleotide sequence shown as SEQ ID NO. 10; or the nucleotide sequence of the Cry2Ab protein has a nucleotide sequence shown as SEQ ID NO. 12.

13. The method for controlling bollworm pest of south america as claimed in claim 6 wherein said second nucleotide is a dsRNA that inhibits a gene of interest in the target insect pest.

14. The method of controlling a bollworm pest as claimed in claim 7 wherein the second nucleotide is a dsRNA that inhibits a gene of interest in the target insect pest.

15. Use of a Vip3Aa protein to control the pest Nanmei Heliothis armigera.