CN111440814A - Insect-resistant fusion gene mCry1AbVip3A, expression vector and application thereof - Google Patents

Abstract

The invention discloses an insect-resistant fusion gene mCry1AbVip3A, wherein the nucleotide sequence of the gene mCry1AbVip3A is shown as (a), (b) or (c): (a) SEQ ID NO: 1; or (b), encodes SEQ ID NO: 2; or (c), and SEQ ID NO: 1 under stringent hybridization conditions, and the protein encoded by the nucleotide has the function of the transcription factor of mCry1AbVip 3A. In vitro toxicity test proves that the modified and synthesized fusion gene toxigenin has obvious insecticidal effect on corn borer and spodoptera littoralis, can be stably and efficiently expressed in monocotyledons, and is further used for producing insect-resistant transgenic plants.

Description

Insect-resistant fusion gene mCry1AbVip3A, expression vector and application thereof

Technical Field

The invention relates to the field of genetic engineering and biological control, in particular to an insect-resistant fusion gene, an expression vector and application thereof

Background

Pests cause losses of about 80 billion dollars per year to global agricultural production. The prevention and control of pests mainly depend on the use of chemical pesticides at present, but pesticide residues bring harm to human health. Therefore, transgenic crops capable of producing insecticidal toxins are successfully selected for insect resistance, and the transgenic insect-resistant corn and cotton are planted in large quantities at present.

Substances having strong insecticidal activity against pests such as cutworm (Agrotis ipsilon), Spodoptera exigua (Spodoptera exigua), Spodoptera frugiperda (Spodoptera rugerida) and the like are found in the fermentation supernatant of strain Bt AB88, and are named vegetative insecticidal proteins (Vip) (escherichia, 1996) in view of their expression from the middle to the spore phase of logarithmic growth. Bt genes from Bacillus thuringiensis (Bacillus thuringiensis) can also encode insecticidal protein crystals, which produce-insecticidal parasporal crystal proteins of endotoxins during spore formation, which have high insecticidal activity. The principle of action is that this insect-resistant protein is solubilized by alkaline intestinal fluid and hydrolyzed to smaller active toxin fragments, the core fragments (Hofte and Whiteley, 1989). The active fragment is resistant to further hydrolysis by proteases, and the activated protein binds to brush vesicles on the insect gut, causing perforation to affect osmotic balance, cell swelling and lysis, and target organisms stop feeding and eventually die. Studies have shown that intestinal epithelial cells of many target pests have high affinity binding sites for Bt proteins (Hofte and Whiteley, 1989). Compared with Cry proteins, the research on the insecticidal mechanism of Vip3 proteins just starts, and the initial mechanism research finds that the epithelial columnar cells expand into spherical shapes after the sensitive insect cutworm is fed with Vip3A toxin for 24 hours, the morphology of goblet cells is slightly changed, and the cell damage at the stage is not obvious; after 48h, the columnar cells continuously deteriorate, the intestinal cavity is filled with fragments of collapsed cells, the goblet cells are obviously damaged, but the goblet cells are still connected with the basement membrane; after 72h the epithelium was completely detached and the insect died, but no significant cell damage occurred in the foregut and hindgut. Ingestion of Vip3A by sensitive insects causes symptoms similar to endotoxin, but delayed in time. Meanwhile, in vivo immunolocalization experiments showed that Vip3A bound specifically to the apical microvilli and was mostly concentrated in the columnar cells, with no detectable signal in the goblet cells. The columnar cells in the midgut tissue mainly play the roles of secreting digestive enzymes and absorbing digestive products, and Vip3A is activated by protease in intestinal fluid, and is absorbed by the columnar cells, perhaps the combination of the columnar cells with certain receptor proteins on cell membranes leads to cell membrane perforation or initiates a certain signal path, and finally the insect body dies (Yu C G and Mullins M A et al, 1997).

In recent years, many studies on vegetative insecticidal proteins Vip have been carried out, and Vip-like proteins have been found to be mainly classified into 4 classes, namely Vip1, Vip2, Vip3 and Vip 4. Vip1/Vip2, which constitute binary toxins and mainly act on coleopteran and hemipteran insects, and relatively few studies have been carried out (Ellis R T and Stamp L, 2002). the university of agriculture in huazhong finds 1 Vip 4-like gene, and there are no reports on insecticidal action mode, target specificity and the like.

Saraswalk et al constructed a chimeric protein of Vip3Aa14 and Cry1Ac, which mainly existed in the form of inclusion body and has better stability to trypsin, but only maintained the insecticidal activity of Cry1Ac and showed no synergistic effect. Furthermore, the C-terminus of Cry1C significantly enhanced the synthesis of Vip3Aa7 and helped it form inclusion bodies in BMB171, but the biological activity was significantly reduced compared to protoxin Vip3Aa7 (Song R et al, 2008). The reduced virulence of the above fusion proteins may be due to the failure of the fusion protein to fold correctly. However, the fusion protein constructed by Dong et al fuses Vip3Aa7 and the N end of Cry9Ca to achieve 4.79 of the synergistic effect factor of diamondback moth, which is much higher than the synergistic effect of mixing 2 prototoxins. Yu et al co-express Vip3Aa29 and Cyt2Aa3, and the co-expressed protein has synergistic effect on spodoptera exigua and rice stem borer. The Vip3 and insecticidal toxins from different sources are fused or co-expressed, so that the toxicity of the Vip3 to target insects can be effectively enhanced, the insecticidal spectrum is expanded, and the generation of insect resistance is delayed. In addition, Vip3 can be integrated into the chromosome of insect virus, so that Vip3A can be effectively transmitted, and the insecticidal toxicity of the virus can be improved.

Compared with the independent Cry1Ab or VIP3A gene, the insect-resistant fusion gene can resist corn borer and spodoptera frugiperda.

Disclosure of Invention

The invention aims to provide an insect-resistant fusion gene capable of being stably and efficiently expressed in plants and an expression vector thereof.

The invention also aims to provide application of the insect-resistant fusion gene in improving insect resistance of transgenic plants.

The object of the invention can be further achieved by the following technical measures:

under the condition of keeping the amino acid composition of the Vip3A translation protein of the sequence unchanged, carrying out base substitution by using codons preferred by monocotyledons to obtain a modified DNA sequence preliminarily; eliminating AT-rich sequences and common restriction enzyme cutting sites (SacI) which are present in DNA sequences and cause unstable plant transcription, and then correcting and eliminating the AT-rich sequences by a method of replacing codons; then removing a terminator from the Cry1Ab-Ma sequence and placing the sequence at the N end of the synthesized Vip 3A; determining and chemically synthesizing the modified fusion gene mCry1AbVip3A, wherein the nucleotide sequence of the fusion gene mCry1AbVip3A is shown as SEQ ID No. 1; restriction enzyme recognition site sequences are added at two ends of the sequence according to cloning requirements and are constructed on corresponding expression vectors.

The fusion gene is operably connected with a prokaryotic expression vector, so that the toxicity of Bt gene expression products synthesized by the invention on corn borers and spodoptera littoralis can be rapidly and preliminarily detected. The fusion gene is operably connected with a plant expression vector, the expression vector is introduced into corresponding agrobacterium, and genetic transformation is carried out through an agrobacterium-mediated method to cultivate insect-resistant transgenic corn. Also can be used for genetic transformation of other crops or fruit trees and the like to ensure that the crops or fruit trees have insect-resistant activity.

The gene of the invention can be transformed into bacteria or fungi by the technicians in the field, the fusion insect-resistant protein is produced by large-scale fermentation, and the fusion insect-resistant protein is prepared into pesticides for controlling crop pests.

In order to achieve the purpose of the invention, the invention firstly provides an insect-resistant fusion gene mCry1AbVip3A, wherein the nucleotide sequence of the gene mCry1AbVip3A is shown as (a), (b) or (c):

(a) SEQ ID NO: 1; or

(b) Encoding SEQ ID NO: 2; or

(c) And SEQ ID NO: 1 under stringent hybridization conditions, and the protein encoded by the nucleotide has the function of the transcription factor of mCry1AbVip 3A.

Furthermore, the invention also provides an amino acid sequence coded by the insect-resistant fusion gene mCry1AbVip3A as shown in SEQ ID NO: 2, respectively.

Further, the invention also provides a vector containing the insect-resistant fusion gene, preferably a bivalent vector.

Further, the present invention also provides a host cell, preferably EHA105, containing the above vector.

Further, the invention also provides a transformed plant cell containing the insect-resistant fusion gene.

Furthermore, the invention also provides application of the insect-resistant fusion gene in improving insect resistance of transgenic plants. Preferably, the plant is a crop, a fruit tree or a vegetable, such as corn, rice, potato, cotton, and the like.

The invention has at least the following advantages and beneficial effects:

compared with independent Cry1Ab-Ma and Vip3A, the insect-resistant fusion protein provided by the invention has an insecticidal effect, and can be compatible with the corn borer resistance of Cry1Ab-Ma and the Spodoptera frugiperda resistance of Vip 3A.

After the insect-resistant fusion gene is introduced into corn, a transformant with stable inheritance can be obtained. In addition, the gene can also transform crops such as cotton, rice, vegetables and the like, so that the crops have corresponding insect-resistant activity, the use amount of pesticides is reduced, the environmental pollution is reduced, and the gene has important economic value and wide application prospect.

Drawings

FIG. 1 shows a plant expression vector containing a fragment of the mCry1AbVip3A gene.

FIG. 2 shows the detection result of the transgenic maize mCry1AbVip3A colloidal gold test strip, wherein the upper part of the test strip color development band is a quality control line, and the lower part of the test strip color development band is a target protein detection line; left 1 is a negative control, others are transgenic maize samples.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 Synthesis of an insect-resistant fusion Gene

According to the original nucleotide sequence (gene ID DQ539888.1) of Vip3A gene, under the condition of keeping the amino acid composition of the protein of the gene unchanged, base substitution is carried out by using codons preferred by monocotyledons, and a modified DNA sequence is obtained preliminarily; eliminating AT-rich sequences (such as ATTTA, AATGAA, etc.) which cause plant transcription instability and common restriction enzyme cutting sites (SacI) existing in the DNA sequence, and then correcting and eliminating by a method of replacing codons; and adding a Cry1Ab-Ma sequence at the 5' end; determining and chemically synthesizing a modified insect-resistant fusion gene mCry1AbVip3A, wherein the nucleotide sequence of the insect-resistant fusion gene mCry1AbVip3A is shown as SEQ ID No. 1; restriction enzyme recognition site sequences are added at two ends of the sequence according to cloning requirements and are constructed on corresponding expression vectors.

Example 2 expression of insect-resistant fusion genes in prokaryotic systems and toxicity testing of the products

In order to detect the in vitro expression of the modified insect-resistant gene and the toxicity to corn borer, a prokaryotic expression vector pET-mCry1AbVip3A is constructed.

Primer sequences are designed (upstream primer F1: shown as SEQ ID No.3, 5'-GACGACGACAAGGCCATGGATGGACAACAACCCG-3'; F2: shown as SEQ ID No.4, 5'-ACGACGACAAGGCCATGGATGAACAAGAACAAC-3'; downstream primer R1: 5'-GGTGGTGGTGGTGCTCGAGCTTGATGCTCACGTC-3', shown as SEQ ID No. 5; R2: shown as SEQ ID No.6, 5'-GGTGGTGGTGGTGCTCGAGGTACTCCGCCTCGAA-3').

The constructed pTF101.1-mCry1AbVip3A plant expression plasmid (figure 1) is used as a template, F1 and R1 are used as primers, an insect-resistant fusion gene is amplified, and a gel recovery kit (Tiangen Biochemical technology (Beijing) Co., Ltd., DP209) is used for recovering and purifying the insect-resistant gene fragment. pET30a + was digested with restriction enzymes NcoI and XhoI, and the 4.2kb fragment was recovered and purified by gel recovery kit. The recovered fragment and the digested pET30a + fragment are subjected to ligation reaction, and the constructed prokaryotic expression plasmid is named pET-mCry1AbVip 3A. And (3) carrying out enzyme digestion identification by using different restriction enzymes, which shows that the vector construction is correct.

The constructed prokaryotic vector pET-mCry1AbVip3A is converted into B L21 (DE3) competent cells, the infected Escherichia coli B L21 bacterial liquid is induced by IPTG, Bt protein is extracted, and the corn borer and spodoptera frugiperda are used for insect test.

① Escherichia coli B L21 single colony was inoculated in 5ml of L B (containing kanamycin) liquid medium and cultured overnight at 37 ℃.

② the bacterial liquid was inoculated into 500ml of L B (containing kanamycin) liquid medium and cultured until OD ≈ 0.5.

③ IPTG was added to a final concentration of 0.5mM and shaking induction was continued for 4 hours.

④ 4000 centrifuging at 4000rpm for 10min, and collecting thallus.

⑤ 36ml lysis buffer (2mM Tris-HCl; 0.2mM CaCl) was added₂(ii) a pH 8.0), the cells were resuspended, lysozyme was added to a final concentration of 1mg/ml and placed on ice for 30 min.

⑥ ultrasonic crushing thallus (crushing parameter: working for 10s, interval 5s, 40 times, ice bath crushing), centrifuging at 4000rpm for 10min, and collecting supernatant.

⑦ the collected supernatant is added to feed for feeding corn borer and spodoptera littoralis.

The toxicity of the corn borer is measured, 5g of Asiatic corn borer artificial feed is weighed and placed in a culture dish, the feed is cut into 1-2mm slices, 1ml of protein liquid (50ng/ul) is evenly coated on the surface of the feed, 10 corn borer larvae incubated for 24 hours are inoculated in each culture dish after 2 h.2h of soaking, the test is controlled by distilled water with the same volume, 5 times of treatment is set for each treatment, the feed is placed in an artificial climate incubator with the temperature of 28 ℃, the light cycle of 16h:8h (L: D) and the relative humidity of 80 percent for culture, and the number of the survival larvae is investigated and recorded every other day.

The toxicity of spodoptera frugiperda is measured by weighing 5g of artificial feed, placing the feed in a spodoptera frugiperda box, cutting the feed into 1-2mm slices, uniformly coating 1ml of protein liquid (50ng/ul) on the surface of the feed, soaking the feed for 2 h.2h, then inoculating 1 spodoptera frugiperda larva hatched for 24h into each spodoptera frugiperda box, using the same volume of distilled water as a control in the test, setting 30 times of repetition in each treatment, placing the box in an artificial climate incubator with the temperature of 26 ℃, the light period of 16h:8h (L: D) and the relative humidity of 60% for culture, and investigating and recording the number of the survival larva every day.

And (3) data analysis: performing preliminary arrangement on the data by using excel 2007, and calculating the survival rates of larvae of ostrinia nubilalis and spodoptera exigua at different feeding times; analysis of variance and significance of differences were performed on the data from the corn borer survey using the sps 23. The result shows that no larvae of corn borer and spodoptera littoralis fed with the protein mCry1AbVip3A survive on day 6 (Table 1 and Table 2), and the test result shows that the mCry1AbVip3A has strong insecticidal activity.

Table 1: toxicity to corn borer larvae

Table 2: toxicity to Spodoptera frugiperda larvae

Example 3 expression of the mCry1AbVip3A Gene in transgenic maize

An agrobacterium-mediated transformation method (strain EHA105) is adopted to introduce an insertion sequence of pTF101.1-mCry1AbVip3A (shown in figure 1) into a callus of a receptor corn, and the transgenic corn is obtained after screening by herbicide bialaphos. Detection of target protein mCry1AbVip3A (Bt-Cry1Ab/1Ac colloidal gold immunological detection):

① is about 1cm in length²Left and right fresh young leaves were placed in a 1.5ml Eppendorf tube, to which 500ul of SEB4 sample extraction buffer was added and ground.

② the test strip (Beijing Zhennis Biotechnology Co., Ltd., Cat. No.: STX06200/0050) was removed and the top of the test strip was held in the hand and the end of the label was inserted into the centrifuge tube and a quality control line appeared within 3-5 minutes, and if the sample was positive, a test line appeared.

The expression of mCry1AbVip3A in 6 transgenic plant leaves was determined by a colloidal gold test strip assay. The results showed that mCry1 abbip 3A protein was expressed in transgenic maize leaf tissue (fig. 2).

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Jilin province academy of agricultural sciences of the institute of crop science of the academy of agricultural sciences of China

<120> insect-resistant fusion gene mCry1AbVip3A, and expression vector and application thereof

<130>P200143

<141>2020-04-15

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>4215

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>1

atggacaaca acccgaacat caacgagtgc atcccctaca actgcctctc gaacccggag 60

gtcgaggtcc tcggaggcga gcggatcgag acggggtata cgccgatcga tatctcgctc 120

tcgctcacgc agttcctcct gtccgaattc gtcccgggcg cgggtttcgt ccttgggctc 180

gtcgacatca tctgggggat cttcgggccg tcccagtggg acgcgttcct cgtccagatc 240

gagcaactca tcaaccagcg gatcgaggaa ttcgcgcgga atcaagcgat cagccggctc 300

gaggggctct ccaacttgta ccagatctac gcggaatcct tccgggaatg ggaggcggac 360

ccgacgaatc cggcgttgag ggaagagatg aggatccagt tcaacgacat gaactccgcg 420

ctcacgacgg cgatcccgct cttcgcggtc cagaactatc aggtcccgct actctcggtc 480

tatgtccagg cggcgaacct ccatttgtcg gtcctccggg acgtgtcggt cttcggtcag 540

cgctgggggt tcgacgcggc gacgatcaac tcgcggtaca atgacctcac gcgcctcatc 600

gggaactaca cggatcacgc ggtccggtgg tacaacacgg ggctcgagcg ggtgtggggc 660

ccggactcca gggactggat ccgctacaac caattccgtc gggagcttac gttgacggtc 720

ctcgatatcg tcagcttgtt ccctaactac gattcgagga cgtatccgat ccggacggtc 780

tcgcagctca cgagggagat ttacacgaac ccggtcctcg agaacttcga tgggtccttc 840

cgggggtccg cgcaggggat cgaggggtcg atccgctccc cgcacctcat ggatatcctc 900

aactcgatca cgatctacac ggacgcgcac cggggggagt actattggtc cgggcaccag 960

atcatggcgt cgccggtggg cttctcgggc ccggagttca cgttcccgct gtacgggacg 1020

atggggaacg cggccccgca gcagcggatc gtcgcgcagc tcgggcaggg cgtgtaccgc 1080

acgctcagca gcacgctcta ccgccgcccg ttcaacatcg ggatcaacaa ccaacagctc 1140

tcggtcctcg atgggacgga gttcgcgtac gggacgagca gcaacctccc gtcggcggtc 1200

taccggaagt cagggacggt cgactcgctc gatgagatcc cgccgcagaa caataacgtc 1260

ccgccgcggc aggggttctc gcaccggctc tcgcacgtct cgatgttccg gtcggggttc 1320

tcgaactcgt cggtctcgat catccgcgcg ccgatgttct cgtggatcca ccggtcggcg 1380

gaattcaaca acatcattcc gtcgtcgcag atcacgcaga tcccgctcac gaagtcgacg 1440

aacctcgggt cggggacgtc ggtcgtcaag gggccggggt tcacgggtgg ggacatcctc 1500

cggcggacga gcccggggca gatctcgaca ttgcgggtca acatcacggc gccgctctcc 1560

cagcgctacc gggtgcgaat ccggtacgcg tcgacgacga acctccagtt ccacacgtcg 1620

atcgacggtc ggccgatcaa ccagggaaac ttctcggcga cgatgtcctc ggggtcgaac 1680

ctccagtcgg gttcgttccg gacggtaggc ttcacgacgc cgttcaactt ctccaacggc 1740

tcgtcggtct tcacgctctc ggcgcacgtc ttcaactccg ggaacgaggt ctacatcgac 1800

aggatcgagt tcgtcccggc ggaggtcacg ttcgaggcgg agtacatgaa caagaacaac 1860

accaagctga gcacccgcgc cctgccgagc ttcatcgact acttcaacgg catctacggc 1920

ttcgccaccg gcatcaagga catcatgaac atgatcttca agaccgacac cggcggcgac 1980

ctgaccctgg acgagatcct gaagaaccag cagctgctga acgacatcag cggcaagctg 2040

gacggcgtga acggcagcct gaacgacctg atcgcccagg gcaacctgaa caccgagctg 2100

agcaaggaga tcctcaagat cgccaacgag cagaaccagg tgctgaacga cgtgaacaac 2160

aagctggacg ccatcaacac catgctgcgc gtgtacctgc cgaagatcac cagcatgctg 2220

agcgacgtga tcaagcagaa ctacgccctg agcctgcaga tcgagtacct gagcaagcag 2280

ctgcaggaga tcagcgacaa gctggacatc atcaacgtga acgtcctgat caacagcacc 2340

ctgaccgaga tcaccccggc ctaccagcgc atcaagtacg tgaacgagaa gttcgaagag 2400

ctgaccttcg ccaccgagac cagcagcaag gtgaagaagg acggcagccc ggccgacatc 2460

ctggacgagc tgaccgagct gaccgagctg gcgaagagcg tgaccaagaa cgacgtggac 2520

ggcttcgagt tctacctgaa caccttccac gacgtgatgg tgggcaacaa cctgttcggc 2580

cgcagcgccc tgaagaccgc cagcgagctg atcaccaagg agaacgtgaa gaccagcggc 2640

agcgaggtgg gcaacgtgta caacttcctg atcgtgctga ccgccctgca ggcccaggcc 2700

ttcctgaccc tgaccacctg ccgcaagctg ctgggcctgg ccgacatcga ctacaccagc 2760

atcatgaacg agcacctgaa caaggagaag gaggagttcc gcgtgaacat cctgccgacc 2820

ctgagcaaca ccttcagcaa cccgaactac gccaaggtga agggcagcga cgaggacgcc 2880

aagatgatcg tggaggccaa gccgggccac gcgctgatcg gcttcgagat cagcaacgac 2940

agcatcaccg tgctgaaggt gtacgaggcc aagctgaagc agaactacca ggtggacaag 3000

gacagcctga gcgaggtgat ctacggcgac atggacaagc tgctgtgccc ggaccagagc 3060

gagcagatct actacaccaa caacatcgtg ttcccgaacg agtacgtgat caccaagatc 3120

gacttcacca agaagatgaa gaccctgcgc tacgaggtga ccgccaactt ctacgacagc 3180

agcaccggcg agatcgacct gaacaagaag aaggtggaga gcagcgaggc cgagtaccgc 3240

accctgagcg cgaacgacga cggcgtctac atgccactgggcgtgatcag cgagaccttc 3300

ctgaccccga tcaacggctt cggcctgcag gccgacgaga acagccgcct gatcaccctg 3360

acctgtaaga gctacctgcg cgagctgctg ctagccaccg acctgagcaa caaggagacc 3420

aagctgatcg tgccaccgag cggcttcatc agcaacatcg tggagaacgg cagcatcgag 3480

gaggacaacc tggagccgtg gaaggccaac aacaagaacg cctacgtcga ccacaccggc 3540

ggcgtgaacg gcaccaaggc cctgtacgtg cacaaggacg gcggcatcag ccagttcatc 3600

ggcgacaagc tgaagccgaa gaccgagtac gtgatccagt acaccgtgaa gggcaagcca 3660

tcgatccacc tgaaggacga gaacaccggc tacatccact acgaggacac caacaacaac 3720

ctggaggact accagaccat caacaagcgc ttcaccaccg gcaccgacct gaagggcgtg 3780

tacctgatcc tgaagagcca gaacggcgac gaggcctggg gcgacaactt catcatcctg 3840

gagatcagcc cgagcgagaa gctgctgagc ccggagctga tcaacaccaa caactggacc 3900

agcaccggca gcaccaacat cagcggcaac accctgaccc tgtaccaggg cggccgcggc 3960

atcctgaagc agaacctgca gctggacagc ttcagcacct accgcgtgta cttcagcgtg 4020

agcggcgacg ccaacgtgcg catccgcaac tcccgcgagg tgctgttcga gaagaggtac 4080

atgagcggcg ccaaggacgt gagcgagatg ttcaccacca agttcgagaa ggacaacttc 4140

tacatcgagc tgagccaggg caacaacctg tacggcggcc cgatcgtgca cttctacgac 4200

gtgagcatca agtag 4215

<210>2

<211>1404

<212>PRT

<213> Protein Artificial sequence (Artificial sequence)

<400>2

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr Met Asn Lys Asn Asn Thr Lys Leu Ser

610 615 620

Thr Arg Ala Leu Pro Ser Phe Ile Asp Tyr Phe Asn Gly Ile Tyr Gly

625 630635 640

Phe Ala Thr Gly Ile Lys Asp Ile Met Asn Met Ile Phe Lys Thr Asp

645 650 655

Thr Gly Gly Asp Leu Thr Leu Asp Glu Ile Leu Lys Asn Gln Gln Leu

660 665 670

Leu Asn Asp Ile Ser Gly Lys Leu Asp Gly Val Asn Gly Ser Leu Asn

675 680 685

Asp Leu Ile Ala Gln Gly Asn Leu Asn Thr Glu Leu Ser Lys Glu Ile

690 695 700

Leu Lys Ile Ala Asn Glu Gln Asn Gln Val Leu Asn Asp Val Asn Asn

705 710 715 720

Lys Leu Asp Ala Ile Asn Thr Met Leu Arg Val Tyr Leu Pro Lys Ile

725 730 735

Thr Ser Met Leu Ser Asp Val Ile Lys Gln Asn Tyr Ala Leu Ser Leu

740 745 750

Gln Ile Glu Tyr Leu Ser Lys Gln Leu Gln Glu Ile Ser Asp Lys Leu

755 760 765

Asp Ile Ile Asn Val Asn Val Leu Ile Asn Ser Thr Leu Thr Glu Ile

770 775 780

Thr Pro Ala Tyr Gln Arg Ile Lys Tyr Val Asn Glu Lys Phe Glu Glu

785 790 795800

Leu Thr Phe Ala Thr Glu Thr Ser Ser Lys Val Lys Lys Asp Gly Ser

805 810 815

Pro Ala Asp Ile Leu Asp Glu Leu Thr Glu Leu Thr Glu Leu Ala Lys

820 825 830

Ser Val Thr Lys Asn Asp Val Asp Gly Phe Glu Phe Tyr Leu Asn Thr

835 840 845

Phe His Asp Val Met Val Gly Asn Asn Leu Phe Gly Arg Ser Ala Leu

850 855 860

Lys Thr Ala Ser Glu Leu Ile Thr Lys Glu Asn Val Lys Thr Ser Gly

865 870 875 880

Ser Glu Val Gly Asn Val Tyr Asn Phe Leu Ile Val Leu Thr Ala Leu

885 890 895

Gln Ala Gln Ala Phe Leu Thr Leu Thr Thr Cys Arg Lys Leu Leu Gly

900 905 910

Leu Ala Asp Ile Asp Tyr Thr Ser Ile Met Asn Glu His Leu Asn Lys

915 920 925

Glu Lys Glu Glu Phe Arg Val Asn Ile Leu Pro Thr Leu Ser Asn Thr

930 935 940

Phe Ser Asn Pro Asn Tyr Ala Lys Val Lys Gly Ser Asp Glu Asp Ala

945 950 955960

Lys Met Ile Val Glu Ala Lys Pro Gly His Ala Leu Ile Gly Phe Glu

965 970 975

Ile Ser Asn Asp Ser Ile Thr Val Leu Lys Val Tyr Glu Ala Lys Leu

980 985 990

Lys Gln Asn Tyr Gln Val Asp Lys Asp Ser Leu Ser Glu Val Ile Tyr

995 1000 1005

Gly Asp Met Asp Lys Leu Leu Cys Pro Asp Gln Ser Glu Gln Ile Tyr

1010 1015 1020

Tyr Thr Asn Asn Ile Val Phe Pro Asn Glu Tyr Val Ile Thr Lys Ile

1025 1030 1035 1040

Asp Phe Thr Lys Lys Met Lys Thr Leu Arg Tyr Glu Val Thr Ala Asn

1045 1050 1055

Phe Tyr Asp Ser Ser Thr Gly Glu Ile Asp Leu Asn Lys Lys Lys Val

1060 1065 1070

Glu Ser Ser Glu Ala Glu Tyr Arg Thr Leu Ser Ala Asn Asp Asp Gly

1075 1080 1085

Val Tyr Met Pro Leu Gly Val Ile Ser Glu Thr Phe Leu Thr Pro Ile

1090 1095 1100

Asn Gly Phe Gly Leu Gln Ala Asp Glu Asn Ser Arg Leu Ile Thr Leu

1105 1110 11151120

Thr Cys Lys Ser Tyr Leu Arg Glu Leu Leu Leu Ala Thr Asp Leu Ser

1125 1130 1135

Asn Lys Glu Thr Lys Leu Ile Val Pro Pro Ser Gly Phe Ile Ser Asn

1140 1145 1150

Ile Val Glu Asn Gly Ser Ile Glu Glu Asp Asn Leu Glu Pro Trp Lys

1155 1160 1165

Ala Asn Asn Lys Asn Ala Tyr Val Asp His Thr Gly Gly Val Asn Gly

1170 1175 1180

Thr Lys Ala Leu Tyr Val His Lys Asp Gly Gly Ile Ser Gln Phe Ile

1185 1190 1195 1200

Gly Asp Lys Leu Lys Pro Lys Thr Glu Tyr Val Ile Gln Tyr Thr Val

1205 1210 1215

Lys Gly Lys Pro Ser Ile His Leu Lys Asp Glu Asn Thr Gly Tyr Ile

1220 1225 1230

His Tyr Glu Asp Thr Asn Asn Asn Leu Glu Asp Tyr Gln Thr Ile Asn

1235 1240 1245

Lys Arg Phe Thr Thr Gly Thr Asp Leu Lys Gly Val Tyr Leu Ile Leu

1250 1255 1260

Lys Ser Gln Asn Gly Asp Glu Ala Trp Gly Asp Asn Phe Ile Ile Leu

1265 1270 12751280

Glu Ile Ser Pro Ser Glu Lys Leu Leu Ser Pro Glu Leu Ile Asn Thr

1285 1290 1295

Asn Asn Trp Thr Ser Thr Gly Ser Thr Asn Ile Ser Gly Asn Thr Leu

1300 1305 1310

Thr Leu Tyr Gln Gly Gly Arg Gly Ile Leu Lys Gln Asn Leu Gln Leu

1315 1320 1325

Asp Ser Phe Ser Thr Tyr Arg Val Tyr Phe Ser Val Ser Gly Asp Ala

1330 1335 1340

Asn Val Arg Ile Arg Asn Ser Arg Glu Val Leu Phe Glu Lys Arg Tyr

1345 1350 1355 1360

Met Ser Gly Ala Lys Asp Val Ser Glu Met Phe Thr Thr Lys Phe Glu

1365 1370 1375

Lys Asp Asn Phe Tyr Ile Glu Leu Ser Gln Gly Asn Asn Leu Tyr Gly

1380 1385 1390

Gly Pro Ile Val His Phe Tyr Asp Val Ser Ile Lys

1395 1400

<210>3

<211>34

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

gacgacgaca aggccatgga tggacaacaa cccg 34

<210>4

<211>33

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

acgacgacaa ggccatggat gaacaagaac aac 33

<210>5

<211>34

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

ggtggtggtg gtgctcgagc ttgatgctca cgtc 34

<210>6

<211>34

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>6

ggtggtggtg gtgctcgagg tactccgcct cgaa 34

Claims (10)

1. An insect-resistant fusion gene mCry1AbVip3A, wherein the nucleotide sequence of the gene mCry1AbVip3A is shown as (a), (b) or (c):

(a) SEQ ID NO: 1; or

(b) Encoding SEQ ID NO: 2; or

(c) And SEQ ID NO: 1 under stringent hybridization conditions, and the protein encoded by the nucleotide has the function of the transcription factor of mCry1AbVip 3A.

2. The insect-resistant fusion gene mCry1AbVip3A of claim 1, wherein the insect-resistant fusion gene mCry1AbVip3A encodes an amino acid sequence as set forth in SEQ ID NO: 2, respectively.

3. A vector comprising the gene of claim 1.

4. The vector of claim 3, which is a bivalent vector.

5. A host cell comprising the vector of claim 4.

6. The host cell of claim 5, which is EHA 105.

7. A transformed plant cell comprising the gene of claim 1.

8. Use of the gene of claim 1 to increase insect resistance in transgenic plants.

9. The use of claim 8, wherein the plant is a crop, a fruit tree or a vegetable.

10. The use of claim 9, wherein the plant is corn, rice, potato, cotton.

Images