CN110982829B - Gene combination for resisting insect pests of crops and carrier and application thereof - Google Patents

Abstract

The application discloses a gene combination for resisting insect pests of crops, which is characterized in that the gene combination for resisting insect pests consists of Cry1Ab, Cry2Ab and Vip3Aa genes which are sequentially arranged in any order. The application also discloses a corresponding vector, and application of the protein and the gene in pest resistance. After the gene combination is transferred into a plant, the resistance effect of the oriental armyworm and the autumn armyworm superposed by the three genes is greatly improved, the breeding efficiency is greatly improved, and the breeding cost is reduced.

Description

Gene combination for resisting insect pests of crops and carrier and application thereof

Technical Field

The application relates to the technical field of genetic engineering biological control, in particular to a method for improving the insect-resistant effect of a transformed plant by artificially modifying insect-resistant genes Cry1Ab, Cry2Ab and Vip3Aa, and also relates to a corresponding expression vector and application thereof.

Background

Biological control is to control the population quantity of pests by using some beneficial organisms or biological metabolites to achieve the purpose of reducing or eliminating the pests, such as trichogramma or beauveria bassiana to control the meadow moth. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; but the effect is often unstable and the same investment is required to be made no matter the weight of the meadow moth is light.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes for coding insecticidal proteins into plants through research.

The Bt gene encodes an insecticidal crystal protein and is derived from Bacillus thuringiensis (Bacillus thuringiensis). Insecticidal parasporal crystal proteins of delta-endotoxin are produced during sporulation thereof, and these proteins have high insecticidal activity. The principle of action is that this insect-resistant protein is solubilized by alkaline intestinal fluid and hydrolyzed to smaller active toxin fragment-core fragment (Hofte and Whiteley, 1989). The active fragment is resistant to further hydrolysis by proteases, and the activated protein binds to brush vesicles on the insect gut, causing perforation to affect osmotic balance, cell swelling and lysis, and target organisms stop feeding and eventually die. Studies have shown that intestinal epithelial cells of many target pests have high affinity binding sites for Bt proteins (Hofte and Whiteley, 1989). Over the past several decades, several tens of Bacillus thuringiensis strains and 130 or more of their encoded insecticidal crystal proteins have been identified.

The Bt gene encodes an insecticidal crystal protein and is derived from Bacillus thuringiensis (Bacillus thuringiensis). Insecticidal parasporal crystal proteins of delta-endotoxin are produced during sporulation thereof, and these proteins have high insecticidal activity. The principle of action is that this insect-resistant protein is solubilized by alkaline intestinal fluid and hydrolyzed to smaller active toxin fragment-core fragment (Hofte and Whiteley, 1989). The active fragment is resistant to further hydrolysis by proteases, and the activated protein binds to brush vesicles on the insect gut, causing perforation to affect osmotic balance, cell swelling and lysis, and target organisms stop feeding and eventually die. Studies have shown that intestinal epithelial cells of many target pests have high affinity binding sites for Bt proteins (Hofte and Whiteley, 1989). Over the past several decades, several tens of Bacillus thuringiensis strains and 130 or more of their encoded insecticidal crystal proteins have been identified.

Biological control is to control the population quantity of pests by using some beneficial organisms or biological metabolites to achieve the purpose of reducing or eliminating the pests, such as trichogramma or beauveria bassiana to control the meadow moth. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; but the effect is often unstable and the same investment is required to be made no matter the weight of the meadow moth is light.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes for coding insecticidal proteins into plants through research.

Cry2Ab insecticidal protein is one of many insecticidal proteins, and Schenpf and Whiteley cloned the first Cry gene Cry1Aa1 encoding delta-endotoxin from Bacillus thuringiensis (Bacillus thuringiensis) in 1981. In 1989, Widner W.R and Whiteley H.R cloned the Cry2Ab gene from Bacillus thuringiensis (Bacillus thuringiensis). The Cry2Ab protein is ingested by the insect into the midgut and the toxoprotein protoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane has perforation symptoms, osmotic pressure change, pH balance and the like inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies.

Cry2Ab insecticidal protein is one of many insecticidal proteins, and Schenpf and Whiteley cloned the first Cry gene Cry1Aa1 encoding delta-endotoxin from Bacillus thuringiensis (Bacillus thuringiensis) in 1981. In 1989, Widner W.R and Whiteley H.R cloned the Cry2Ab gene from Bacillus thuringiensis (Bacillus thuringiensis). The Cry2Ab protein is ingested by the insect into the midgut and the toxoprotein protoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane has perforation symptoms, osmotic pressure change, pH balance and the like inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies.

The Vip3A insecticidal protein is one of a plurality of insecticidal proteins, and is a specific protein produced by Bacillus cereus. The Vip3A protein is ingested by the insect into the midgut and the toxoprotoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane generates perforation focus, the osmotic pressure change and the pH balance inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies. The existing transgenic plants prove that the Vip3A gene-transferred plants can resist the invasion of Lepidoptera (Lepidotera) pests such as black cutworms, spodoptera frugiperda, corn armyworm and the like. Chinese patent applications with application numbers of 201210528162.3 and 201610080690.5 respectively provide a technical scheme for transferring a Vip3A coding gene into a plant to achieve an insect-resistant effect, and the gene is also modified in 201210528162.3 to improve the insect-resistant effect.

Although there are procedures for transforming the above three genes into plants to achieve the purpose of insect resistance, there is no description in the literature of using a combination of multiple insect-resistant genes because the insect-resistant effects of the genes are different.

Disclosure of Invention

In view of the above technical problems, the present application aims to provide a gene combination formed by multiple insect-resistant gene combinations, specifically, genes mCry1Ab, mCry2Ab and mVip3Aa are combined in the same vector and transferred into a plant, and the obtained transgenic plant has a greatly improved resistance effect of oriental armyworm and autumn armyworm due to the superposition of the three genes.

The invention discloses a gene combination for resisting insect pests of crops, which consists of mCry1Ab, mCry2Ab and mVip3Aa genes which are sequentially arranged in any order. According to the invention, the resistance effect of the transgenic plant to oriental armyworm and autumn armyworm is greatly improved by overlapping three insect-resistant genes. Preferably, the three genes are connected in the order of mCry2Ab + mVip3Aa + mCry1Ab (RB to LB), which has the highest expression efficiency and the best insect-resistant effect.

In one embodiment according to the present invention, the nucleotide sequence of the mCry1Ab gene is SEQ ID NO. 1. The modified Cry1Ab gene solves the problems of easy breakage of Cry1Ab gene and poor recombination and resistance, and has more stability, higher expression efficiency and more efficient insect-resistant and insecticidal effect in application.

In one embodiment according to the present invention, the nucleotide sequence of the mCry2Ab gene is SEQ ID NO. 2. After the modified mCry2Ab gene provided by the invention is transferred into a plant, the obtained transgenic plant has better resistance to beet armyworm and prodenia litura.

In one embodiment according to the invention, the nucleotide sequence of the mVip3Aa gene is SEQ ID NO 3. The transgenic plant introduced by the modified mVip3Aa gene has less agronomic characters, the ratio of high-quality transformants is increased, and the influence on pollen is less.

The invention also provides an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the insect-resistant gene.

The invention further provides an expression vector, which comprises the insect-resistant gene combination.

The invention further provides the gene combination, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the insect-resistant gene, or an application of the expression vector in insect resistance of plants, wherein the application is selected from one or two of the following: a) preparing a medicament having an anti-insect effect; b) cultivating a transgenic plant having or having an increased ability to resist insects.

In one embodiment according to the present invention, the pest controlled in the application is selected from one or more of beet armyworm, prodenia litura and oriental armyworm.

The present invention further provides a method of growing a plant having or having improved insect resistance, said method comprising the steps of: and (3) introducing the gene combination into a receptor plant to obtain a transgenic plant.

According to one embodiment of the invention, the plant is selected from one or more of monocotyledons, dicotyledons, gramineae; preferably corn.

The invention has the following beneficial effects:

after the combination of the insect-resistant genes provided by the invention is transferred into plants, the problems of few insect-resistant mechanisms, narrow insect-resistant spectrum and easy generation of resistance by insects in the prior art are solved, and the insect-resistant genes have faster and more effective insect-resistant effect and are difficult to generate resistance. According to the invention, the three insect-resistant genes are superposed, so that the resistance effect of the transgenic plant to oriental armyworm and autumn armyworm is greatly improved, the breeding efficiency is also greatly improved, and the breeding cost is reduced.

Drawings

FIG. 1 shows a vector map for accessing mCry1Ab gene;

FIG. 2 shows a vector map for accessing the mCry2Ab gene;

FIG. 3 shows a map of a vector for accessing mVip3Aa gene;

FIG. 4 shows the vector map for accessing mCry1Ab and mCry2Ab genes;

FIG. 5 shows a vector map for accessing mCry1Ab and mVip3Aa genes;

FIG. 6 shows the vector maps for the access genes mCry1Ab, mCry2Ab and mVip3 Aa;

FIG. 7 shows a PCR detection map of the mCry1Ab gene for 12 samples;

FIG. 8 shows a PCR detection map of the mCry2Ab gene for 12 samples;

FIG. 9 is a PCR map of mVip3Aa gene from 12 samples.

Detailed Description

The following examples are intended to illustrate the present application but are not intended to limit the scope of the present application.

Specific embodiments of the present application will be described in more detail below. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.

If not specifically stated, mCry1Ab, mCry2Ab and mVip3Aa are all brand new genes obtained by respectively modifying Cry1Ab, Cry2Ab and Vip3Aa in the invention. Wherein the nucleotide sequence of mCry1Ab is SEQ ID NO. 1, the nucleotide sequence of mCry2Ab is SEQ ID NO. 2, and the nucleotide sequence of mVip3Aa is SEQ ID NO. 3; the amino acid sequence of Cry1Ab is SEQ ID NO. 4, the amino acid sequence of Cry2Ab is SEQ ID NO. 5 and the amino acid sequence of Vip3Aa is SEQ ID NO. 6.

Example 1 vector construction: the vector is constructed by adopting Gateway system

FIGS. 1 to 6 show maps of respective vectors involved in the present invention, respectively.

BP recombination loading entry carrier

1. PCR with attB linker addition: respectively taking plasmids carrying target genes mCry1Ab, mCry2Ab and mVip3Aa expression cassettes as templates, adding gene specific primers containing partial linkers, and performing first round PCR

2. Taking the PCR product of the first round as a template, adding a universal primer, carrying out the second round of PCR, and purifying the PCR product

BP recombination reaction

Incubating for 1-16 h at 25 ℃, but not more than 18h, and stopping the reaction.

Reaction product transformed into escherichia coli

1-5 mul of BP reaction solution is taken to transform Escherichia coli T1 competent cells (Transgen, Beijing, China; Cat. No: CD501) by a heat shock method, and the heat shock conditions are as follows: 50. mu.l of E.coli T1 competent cells, 10. mu.l of plasmid DNA (recombinant cloning vector LP01-T), water bath at 42 ℃ for 30 seconds; the ampicillin (100 mg/L) coated LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) were grown overnight in a water bath at 37 ℃ for 45 minutes (shaking table at 200 rpm). White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ l ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 150. mu.l of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ l ice-cold solution III (4M potassium acetate, 2M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol, and air drying; the precipitate was dissolved by adding 30. mu.l of RNase (20. mu.g/ml) in TE (10mM Tris-HCl, 1mM EDTA, pH 8.0); bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use. The 1Abo, 2Ab and Vip3Aa expression cassettes were all identified as having been correctly ligated to the entry vector using appropriate enzymatic cleavage.

Recombinant LR incorporation into expression vectors

Carrying out warm bath for 1-16 h at 25 ℃, and stopping the reaction.

Reaction product transformed into escherichia coli

1-5 mul of BP reaction solution is taken to transform Escherichia coli T1 competent cells (Transgen, Beijing, China; Cat. No: CD501) by a heat shock method, and the heat shock conditions are as follows: 50. mu.l of E.coli T1 competent cells, 10. mu.l of plasmid DNA (recombinant cloning vector LP01-T), water bath at 42 ℃ for 30 seconds; the ampicillin (100 mg/L) coated LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) were grown overnight in a water bath at 37 ℃ for 45 minutes (shaking table at 200 rpm). White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ l ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 150. mu.l of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ l ice-cold solution III (4M potassium acetate, 2M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol, and air drying; the precipitate was dissolved by adding 30. mu.l of RNase (20. mu.g/ml) in TE (10mM Tris-HCl, 1mM EDTA, pH 8.0); bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use. Digestion with BamHI and SbfI identified that the 1Ab, 2Ab and Vip3Aa expression cassettes were all properly ligated into the final vector.

Example 2

The conversion comprises the following specific steps:

1. preparation of young maize embryos

The maize inbred line AX808 in a company is planted in a field or a greenhouse, and maize 8-10 days (summer) to 10-13 days (autumn) after artificial pollination is taken as a source of immature embryos.

2. Preparation of Agrobacterium

(1) Marking the transformed and identified agrobacterium tumefaciens glycerol on a YEP solid culture medium added with 100mg/L kan and 12mg/L tet, and culturing in dark at 28 ℃ for 2-3 days;

(2) adding 1ml of infection culture medium into a sterilized 2ml centrifugal tube, putting the agrobacterium of the step 1 into the infection culture medium, and fully scattering and uniformly mixing the agrobacterium with a pipette gun;

(3) another sterilized 2ml centrifuge tube was used to adjust the concentration of the bacterial liquid to OD 660 of 0.5-0.7 using the infection medium.

3. Co-culture of young maize embryos and agrobacterium

(1) Removing the infection culture medium in the immature embryo centrifuge tube, and adding 1.5ml of fresh infection culture medium to clean the embryo once;

(2) removing the infection culture medium, and adding the adjusted agrobacterium liquid;

(3) oscillating at the maximum rotating speed for 30s, and standing at room temperature for 5 min;

(4) pouring the embryos onto a co-culture medium, and blotting the liquid;

(5) placing the embryo with the plane upward and the shield surface upward;

(6) the embryos are cultured in the dark at 22 ℃ for 2-3 days.

4. Induction and selection of calli

(1) Transferring the co-cultured embryo to an induced callus culture medium, and performing dark culture in an incubator at 28 ℃ for 7-10 days;

(2) transferring the induced callus to a screening culture medium for screening culture, wherein the screening pressure is 5.0mM glyphosate, and dark culture is carried out for 2-3 weeks at 28 ℃;

(3) taking the callus survived in the first screening to carry out the second screening, wherein the screening pressure is 2.0 mM;

5. regeneration and culture of transformed strains

(1) Placing the screened embryogenic callus on a pre-differentiation culture medium, and performing dark culture at 28 deg.C for 10-14 days;

(2) taking embryo healing wound on a differentiation culture medium, and performing light culture at 28 ℃ for 10-14 days until the seedling is differentiated;

(3) transferring the differentiated seedling to a rooting culture medium, and performing light culture at 28 ℃ until the root is completely developed;

(4) transplanting the well-grown seedlings into a greenhouse matrix.

And harvesting the transgenic plants after the transgenic plants blossom and fruit. The harvested seeds are sowed in a greenhouse, and when the plants grow to 4-6 leaf stages, expression analysis and detection are carried out by adopting a PCR technology.

Example 3 transgenic molecule detection

(1) The maize plants with mCry1Ab, mCry2Ab and mVip3Aa genes were verified by the general PCR of 2 × EasyTaq PCR Supermix (China, Beijing, Cat: AS111-11) of the King Kogyo Co., Ltd

The PCR mCry1Ab primers were:

mCry1Ab-393F(SEQ ID NO:7)CATCCAGTTCAACGACATGA

mCry1Ab-930R(SEQ ID NO:8)GTGGGCATCGGTGTAGATAG

fragment size: 528bp by 528bp

The PCR mCry2Ab primers were:

mCry2Ab-128F(SEQ ID NO:9)：AGAAGAACAACCACAGCCTG

mCry2Ab-724R(SEQ ID NO:10)：TGTCGTGAAGCCTCGTATTG

fragment size 597bp

The mVip3Aa primers for PCR were:

mVip3Aa-F3(SEQ ID NO:11)：TGGAGGACTACCAGACCATC

mVip3Aa-R3：(SEQ ID NO:12)GGTTCCTGATCGATGACTGAC

fragment size 550bp

The conditions for the PCR reaction were: 30 cycles, each cycle being 95 ℃ 30 ', 58 ℃ 30 ', 72 ℃ 40 '.

(2) Verification of maize plants transformed with genes mCry1Ab, mCry2Ab, mVip3Aa, mCry1Ab + mCry2Ab, mCry1Ab + mVip3Aa mCry2Ab + mVip3A, mCry1Ab + mCry2Ab + mVip3Aa by qRT-PCR

About 100mg of leaves of corn plants with nucleotide sequences of mCry1Ab, mCry2Ab, mVip3Aa, mCry1Ab + mCry2Ab, mCry1Ab + mVip3Aa mCry2Ab + mVip3A, mCry1Ab + mCry2Ab + mVip3Aa, which are respectively transferred, are taken as samples, and the Genomic DNA of the leaves is extracted by an easy pure Plant Genomic DNA Kit (containing RNase A) of Transgen (Transgen, Beijing, China, Cat: EE111-01), and the copy number of the Ab 1 +2Ab 3Aa gene is detected by a TransStart Green fluorescent quantitative PCR method. Meanwhile, wild corn plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

(2) The specific method for detecting the copy number of the gene is as follows:

step 1, respectively taking 100mg of leaves of a corn plant and a wild corn plant which are transferred into nucleotide sequences of mCry1Ab, mCry2Ab, mVip3Aa, mCry1Ab + mCry2Ab, mCry1Ab + mVip3Aa mCry2Ab + mVip3A, mCry1Ab + mCry2Ab + mVip3Aa, respectively grinding the leaves into homogenate by liquid nitrogen in a mortar, and taking 3 samples for each repetition;

step 2, extracting the Genomic DNA of the sample by using an easy pure Plant Genomic DNA Kit (containing RNase A) of Transgen (Transgen, Beijing, China, Cat: EE111-01), and referring to the product specification of the specific method;

step 3, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 4, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu l;

step 5, identifying the copy number of the sample by adopting a TransStart Green fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild corn plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers were used to detect the nucleotide sequence of mCry1 Ab:

primer 1(CF1) (SEQ ID NO: 13): GTCCTGGATGGCACTGAGTT is shown as SEQ ID NO. 13 in the sequence list;

primer 2(CR1) (SEQ ID NO: 14): GGCACATTGTTGTTCTGTGG is shown as SEQ ID NO:14 in the sequence list;

the following primers were used to detect the nucleotide sequence of mCry2 Ab:

primer 3(CF2) (SEQ ID NO: 15): TCTCCTTCATTCGTGACGTG

Primer 4(CR2) (SEQ ID NO: 16): GCCGACTGGTAGGTGTTGAT

The following primers were used to detect the mVip3Aa nucleotide sequence:

primer 5(CF3) (SEQ ID NO: 17): GATCCAGTACACCGTGAAGG

Primer 6(CR3) (SEQ ID NO: 18): TTGGTGTCCTCGTAGTGGAT

The following primers were used to detect the 18s nucleotide sequence for internal reference leveling

18srRNA-F(SEQ ID NO:19)：CCATCCCTCCGTAGTTAGCTTCT

18srRNA-R(SEQ ID NO:20)：CCTGTCGGCCAAGGCTATATAC

The PCR reaction system is as follows:

the PCR reaction conditions are as follows:

repeating the steps 2-3 and 40 times circularly.

Data were analyzed using SDS2.3 software (Applied Biosystems).

Experimental results show that the nucleotide sequences of mCry1, mCry2, mVip3, mCry1 + mCry2, mCry1 + mVip3, mCry1 + mCry2 + mVip3 are integrated into the chromosome group of the detected corn plant, and the corn plants into which the nucleotide sequences of mCry1, mCry2, mVip3, mCry1 + mCry2, mCry1 + mVip3, mCry2 + mVip3, mCry1 + mCry2 + mVip3 are transferred all obtain transgenic corn plants containing single copies of mCry1, mCry2, mVip3, mCry1 + mCry2, mCry1 + mVip3, mCry2 + mVip3 and mCry1 + mCry2 + mVip3 genes.

The PCR detection results are shown in FIGS. 7-9, respectively, and it can be seen that each vector was successfully transferred into the plant.

Example 4 insecticidal protein detection of transgenic maize plants

1. Content detection of insecticidal protein (mCry1Ab protein) of transgenic corn plant

The solutions involved in this experiment were as follows:

extracting a buffer solution: 8g/L NaCl, 0.2g/L KH₂PO₄，2.9g/L Na₂HPO₄·12H₂O, 0.2g/L KCl, 5.5ml/L Tween 20(Tween-20), pH 7.4;

wash buffer PBST: 8g/L NaCl, 0.2g/L KH₂PO₄，2.9g/L Na₂HPO₄·12H2O, 0.2g/L KCl, 0.5ml/L Tween 20(Tween-20), pH 7.4;

stopping liquid: 1M HCl.

Taking fresh leaves of 3mg of single-copy corn plant with the mCry1Ab nucleotide sequence and single-copy corn plant with the Cry1Ab nucleotide sequence as samples, grinding by liquid nitrogen, adding 800 mu l of the extraction buffer solution, centrifuging for 10min at the rotating speed of 4000rpm, taking supernatant, diluting by 40 times by using the extraction buffer solution, and taking 80 mu l of diluted supernatant for ELISA detection. ELISA (enzyme-linked immunosorbent assay) kits (ENVIRLOGIX company, Cry1Ab/Cry1Ac, Cry2A and Vip3A kits) are used for detecting and analyzing the proportion of insecticidal proteins (mCry1Ab, mCry2Ab and mVip3Aa proteins) in a sample to the fresh weight of the leaves, and the specific method refers to the product specification thereof. Meanwhile, wild corn plants and corn plants which are identified as non-transgenic through fluorescent quantitative PCR are used as controls, and detection and analysis are carried out according to the method. 3 strains (1A1, 1A2 and 1A3) which are transferred into the nucleotide sequence of mCry1Ab, 3 strains (1A4, 1A5 and 1A6) which are transferred into the nucleotide sequence of mCry1Ab + mCry2Ab, 3 strains (1A7, 1A8 and 1A 9) which are transferred into the nucleotide sequence of mCry1Ab + mVip3Aa, 3 strains (1A10, 1A11 and 1A12) which are transferred into the nucleotide sequence of mCry1Ab + mCry2Ab + mVip3Aa are identified as1 strain of non-transgenic (NGM) by fluorescence quantitative PCR, and 1 strain of wild type CK (CK); 3 strains are selected from each strain for testing, each strain is repeated for 6 times, the protein content of mCry1Ab is 8453.2ng/g, 8591.0ng/g, 8487.3ng/g and 8744.9ng/g respectively, the protein content of mCry1Ab in transformants of each vector has no obvious difference, and the specific detection result is shown in Table 1.

3 strains (2A1, 2A2 and 2A3) which are transformed into mCry2Ab nucleotide sequence, 3 strains (2A4, 2A5 and 2A6) which are transformed into mCry1Ab + mCry2Ab nucleotide sequence, 3 strains (2A7, 2A8 and 2A9) which are transformed into mCry2Ab + mVip3Aa nucleotide sequence, 3 strains (2A10, 2A11 and 2A12) which are transformed into mCry1Ab + mCry2Ab + mVip3Aa nucleotide sequence are identified as non-transgenic (NGM) strains by fluorescence quantitative PCR, and 1 strain is wild type (CK); 3 strains are selected from each strain for testing, each strain is repeated for 6 times, the protein content of mCry2Ab is 3052.8ng/g, 3045.7ng/g, 2971.9ng/g and 2956.0ng/g respectively, the protein content of mCry2Ab in transformants of each vector has no obvious difference, and the specific detection result is shown in Table 2.

3 strains (3V1, 3V2 and 3V3) with mVip3Aa nucleotide sequence, 3 strains (3V4, 3V5 and 3V6) with mCry1Ab + mVip3Aa nucleotide sequence, 3 strains (3V7, 3V8 and 3V9) with mCry2Ab + mVip3Aa nucleotide sequence, 3 strains (3V10, 3V11 and 3V12) with mCry1Ab + mCry2Ab + mVip3Aa nucleotide sequence are identified as1 strain of non-transgenic (NGM) and 1 strain of wild type (CK) by fluorescence quantitative PCR; 3 strains are selected from each strain for testing, each strain is repeated for 6 times, the mVip3Aa protein content is 3118.9ng/g, 2870.8ng/g, 3011.7ng/g and 3053.9ng/g respectively, the mVip3Aa protein content in transformants of each vector has no obvious difference, and the specific detection result is shown in Table 3.

TABLE 1 average results of mCry1Ab protein expression measurements of transgenic maize plants

TABLE 2 average results of mCry2Ab protein expression measurements of transgenic maize plants

TABLE 3 mean results of mVip3Aa protein expression measurements of transgenic maize plants

Example 5 detection of insect-resistant Effect of transgenic maize plants

And carrying out insect-resistant effect detection on athetis lepigone by using the corn plant, wild corn plant and corn plant identified as non-transgenic by PCR, which are transferred with the nucleotide sequence of mCry1Ab + mCry2Ab + mVip3 Aa.

Fresh leaves of a corn plant, a wild-type corn plant and a corn plant identified as a non-transgenic corn plant by PCR (V3-V4 period) which are transferred into mCry1Ab, mCry2Ab, mVip3Aa, mCry1Ab + mCry2Ab, mCry1Ab + mVip3Aa mCry2Ab + mVip3A, mCry1 + mCry2Ab + mVip3Aa nucleotide sequences are respectively taken, the leaves are washed clean by sterile water and the water on the leaves is sucked by filter paper, then the leaves of the corn are removed, meanwhile, about 1cm × 4cm of veins are cut, 2 cut long leaves are taken to be placed on filter paper at the bottom of a circular plastic culture dish, the filter paper is wetted by distilled water, 5 artificially-bred oriental armyworm and two-age armyworms are placed in each culture dish, and after the insect test culture dish is covered by the following culture dish, the temperature is 22-26 ℃, the relative humidity is 70% -80%, and the light period (light period/dark period) is 16%: after standing for 3 days under the condition of 8, the mortality was counted. The results are shown in tables 4 and 5.

TABLE 4 biological test results of two instars of Oriental mythimna

Note: wherein 1A refers to mCry1Ab gene, 2A refers to mCry2Ab gene, and V3 refers to mVip3Aa gene.

TABLE 5 bioassay results for two-year Spodoptera frugiperda

Note: wherein 1A refers to mCry1Ab gene, 2A refers to mCry2Ab gene, and V3 refers to mVip3Aa gene.

Although the present application has been described in detail with respect to the general description and the specific examples, it will be apparent to those skilled in the art that certain changes and modifications may be made based on the present application. Accordingly, such modifications and improvements are intended to be within the scope of this invention as claimed.

Sequence listing

<110> Longping Biotechnology (Hainan) Co., Ltd

<120> gene combination for crop pest resistance, and vector and application thereof

<130> 201904

<141> 2019-12-19

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2457

<212> DNA

<213> Artificial Sequence

<400> 1

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cctggattca tcgcagcgcg 1380

gagttcaaca atatcattcc gtcctcccaa atcacccaaa tccccctcac caagtccacc 1440

aacctgggca gcggcacctc cgtggtgaag ggcccaggct tcacgggcgg cgacatcctg 1500

cgcaggacct ccccgggcca gatcagcacc ctccgcgtca acatcaccgc tcccctgtcc 1560

cagaggtacc gcgtcaggat tcgctacgct agcaccacca acctgcaatt ccacacctcc 1620

atcgacggca ggccgatcaa tcagggtaac ttctccgcca ccatgtccag cggcagcaac 1680

ctccaatccg gcagcttccg caccgtgggt ttcaccaccc ccttcaactt ctccaacggc 1740

tccagcgttt tcaccctgag cgcccacgtg ttcaattccg gcaatgaggt gtacattgac 1800

cgcattgagt tcgtgccagc cgaggtcacc ttcgaagccg agtacgacct ggagagagcc 1860

cagaaggctg tcaatgagct cttcacgtcc agcaatcaga tcggcctgaa gaccgacgtc 1920

actgactacc acatcgacca agtctccaac ctcgtggagt gcctctccga tgagttctgc 1980

ctcgacgaga agaaggagct gtccgagaag gtgaagcatg ccaagcgtct cagcgacgag 2040

aggaatctcc tccaggaccc caatttccgc ggcatcaaca ggcagctcga ccgcggctgg 2100

cgcggcagca ccgacatcac gatccagggc ggcgacgatg tgttcaagga gaactacgtg 2160

actctcctgg gcactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaagctca aggcttacac tcgctaccag ctccgcggct acatcgaaga cagccaagac 2280

ctcgagattt acctgatccg ctacaacgcc aagcacgaga ccgtcaacgt gcccggtact 2340

ggttccctct ggccgctgag cgcccccagc ccgatcggca agtgtgccca ccacagccac 2400

cacttctcct tggacatcga tgtgggctgc accgacctga acgaggacct gggctag 2457

<210> 2

<211> 1905

<212> DNA

<213> Artificial Sequence

<400> 2

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac gtggaccccg tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 3

<211> 2370

<212> DNA

<213> Artificial Sequence

<400> 3

atgaacatga acaacaccaa gctgaacgcc cgcgccctgc cgagcttcat cgactacttc 60

aacggcatct acggcttcgc caccggcatc aaggacatca tgaacatgat cttcaagacc 120

gacaccggcg gcgacctgac cctggacgag atcctgaaga accagcagct gctgaacgac 180

atcagcggca agctggacgg cgtgaacggc agcctgaacg acctgatcgc ccagggcaac 240

ctgaacaccg agctgagcaa ggagatcctt aagatcgcca acgagcagaa ccaggtgctg 300

aacgacgtga acaacaagct ggacgccatc aacaccatgc tgcgcgtgta cctgccgaag 360

atcaccagca tgctgagcga cgtgctcaag cagaactacg ccctgagcct gcagatcgag 420

tacctgagca agcagctgca ggagatcagc gacaagctgg acatcatcaa cgtgaacgtc 480

ctgatcaaca gcaccctgac cgagatcacc ccggcctacc agcgcatcaa gtacgtgaac 540

gagaagttcg aagagctgac cttcgccacc gagaccagca gcaaggtgaa gaaggacggc 600

agcccggccg acatcctgga cgagctgacc gagctgaccg agctggcgaa gagcgtgacc 660

aagaacgacg tggacggctt cgagttctac ctgaacacct tccacgacgt gatggtgggc 720

aacaacctgt tcggccgcag cgccctgaag accgccagcg agctgatcac caaggagaac 780

gtgaagacca gcggcagcga ggtgggcaac gtgtacaact tcctgatcgt gctgaccgcc 840

ctgcaggcca aggccttcct gaccctgacc acctgtcgca agctgctggg cctggccgac 900

atcgactaca ccagcatcat gaacgagcac ttgaacaagg agaaggagga gttccgcgtg 960

aacatcctgc cgaccctgag caacaccttc agcaacccga actacgccaa ggtgaagggc 1020

agcgacgagg acgccaagat gatcgtggag gctaagccgg gccacgcgtt gatcggcttc 1080

gagatcagca acgacagcat caccgtgctg aaggtgtacg aggccaagct gaagcagaac 1140

taccaggtgg acaaggacag cttgagcgag gtgatctacg gcgacatgga caagctgctg 1200

tgtccggacc agagcgagca aatctactac accaacaaca tcgtgttccc gaacgagtac 1260

gtgatcacca agatcgactt caccaagaag atgaagaccc tgcgctacga ggtgaccgcc 1320

aacttctacg acagcagcac cggcgagatc gacctgaaca agaagaaggt ggagagcagc 1380

gaggccgagt accgcaccct gagcgcgaac gacgacggcg tctacatgcc actgggcgtg 1440

atcagcgaga ccttcctgac cccgatcaac ggctttggcc tgcaggccga cgagaacagc 1500

cgcctgatca ccctgacctg taagagctac ctgcgcgagc tgctgctagc caccgacctg 1560

agcaacaagg agaccaagct gatcgtgcca ccgagcggct tcatcagcaa catcgtggag 1620

aacggcagca tcgaggagga caacctggag ccgtggaagg ccaacaacaa gaacgcctac 1680

gtcgaccaca ccggcggcgt gaacggcacc aaggccctgt acgtgcacaa ggacggcggc 1740

atcagccagt tcatcggcga caagctgaag ccgaagaccg agtacgtgat ccagtacacc 1800

gtgaagggca agccatcgat tcacctgaag gacgagaaca ccggctacat ccactacgag 1860

gacaccaaca acaacctgga ggactaccag accatcaaca agcgcttcac caccggcacc 1920

gacctgaagg gcgtgtacct gatcctgaag agccagaacg gcgacgaggc ctggggcgac 1980

aacttcatca tcctggagat cagcccgagc gagaagctgc tgagcccgga gctgatcaac 2040

accaacaact ggaccagcac cggcagcacc aacatcagcg gcaacaccct gaccctgtac 2100

cagggcggcc gcggcatcct gaagcagaac ctgcagctgg acagcttcag cacctaccgc 2160

gtgtacttca gcgtgagcgg cgacgccaac gtgcgcatcc gcaactcccg cgaggtgctg 2220

ttcgagaaga ggtacatgag cggcgccaag gacgtgagcg agatgttcac caccaagttc 2280

gagaaggaca acttctacat cgagctgagc cagggcaaca acctgtacgg cggcccgatc 2340

gtgcacttct acgacgtgag catcaagtag 2370

<210> 4

<211> 818

<212> PRT

<213> Artificial Sequence

<400> 4

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Glu Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Glu Cys Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn

675 680 685

Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser Thr

690 695 700

Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser His

785 790 795 800

His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp

805 810 815

Leu Gly

<210> 5

<211> 634

<212> PRT

<213> Artificial Sequence

<400> 5

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Val Asp Pro Val Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 6

<211> 789

<212> PRT

<213> Artificial Sequence

<400> 6

Met Asn Met Asn Asn Thr Lys Leu Asn Ala Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Leu Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Lys Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 7

catccagttc aacgacatga 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

gtgggcatcg gtgtagatag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

agaagaacaa ccacagcctg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tgtcgtgaag cctcgtattg 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

tggaggacta ccagaccatc 20

<210> 12

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 12

ggttcctgat cgatgactga c 21

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

gtcctggatg gcactgagtt 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

ggcacattgt tgttctgtgg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

tctccttcat tcgtgacgtg 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

gccgactggt aggtgttgat 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 17

gatccagtac accgtgaagg 20

<210> 18

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 18

ttggtgtcct cgtagtggat 20

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 19

ccatccctcc gtagttagct tct 23

<210> 20

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 20

cctgtcggcc aaggctatat ac 22

Claims (7)

1. A gene combination for resisting insect pests of crops, which is characterized in that the gene combination consists of mCry1Ab, mCry2Ab and mVip3Aa genes which are arranged in any sequence; the nucleotide sequence of the mCry1Ab gene is SEQ ID NO. 1; the nucleotide sequence of the mCry2Ab gene is SEQ ID NO. 2; the nucleotide sequence of the mVip3Aa gene is SEQ ID NO. 3.

2. An expression cassette, recombinant vector, recombinant microorganism comprising the combination of genes of claim 1.

3. An expression vector comprising the combination of genes of claim 1.

4. Use of the gene combination according to claim 1 or of an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line according to claim 2 or of an expression vector according to claim 3 for combating insects in plants, selected from the group consisting of:

a) preparing a medicament having an anti-insect effect;

b) cultivating a transgenic plant having or having increased insect resistance;

the pests to be controlled in the application are selected from spodoptera frugiperda or oriental armyworm.

5. A method of growing a plant having or having enhanced resistance to a pest, said method comprising the steps of: introducing the combination of genes of claim 1 into a recipient plant to obtain a transgenic plant.

6. The method of claim 5, wherein the plant is selected from the family Poaceae.

7. The method of claim 5 or 6, wherein the plant is maize.

Images