CN109804832B - Use of insecticidal proteins - Google Patents

Abstract

The invention relates to an application of insecticidal protein, which comprises the following steps: the silver looper pest is contacted with at least Cry1A protein. According to the invention, Cry1A protein capable of killing the Trichoplusia agnata is generated in the plant body to control the Trichoplusia agnata pests; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the method protects the whole plant in the whole growth period so as to control the invasion of the silver looper pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Description

Use of insecticidal proteins

Technical Field

The invention relates to application of an insecticidal protein, in particular to application of Cry1A protein in controlling a Heliothis virescens to be a pest plant through expression in the plant.

Background

Argyrogramma agnata belongs to Lepidoptera Noctuidae, is mainly distributed in Yangtze river watershed and yellow river watershed of China, and is one of main soybean pests in main soybean production areas of China. The silver pattern noctuid is a multi-feeding pest, mainly harmful to beans, rapes, cabbages, cauliflowers, cabbages, radishes and other cruciferous vegetables, and is characterized in that: the larvae eat and damage the leaves, so that nicks and holes are caused, and the leaves are completely eaten when serious occurrence occurs, so that the yield is influenced.

Cultivated soybean (Glycine max (L.) Merri), an important commercial crop grown worldwide as a major source of vegetable oil and vegetable protein, is an important food crop in china. Soybean is one of the most favorite plants of the Trichoplusia agnata, and because of the Trichoplusia agnata, grain loss is caused to different degrees every year, yield is reduced by 1-2 for light people and 3-4 for heavy people. In order to control the silver looper, the main methods generally adopted by people are agricultural control, chemical control, physical control and biological control.

The agricultural control is to comprehensively coordinate and manage multiple factors of the whole farmland ecosystem, regulate and control crop, pest and environmental factors and create a farmland ecological environment which is beneficial to crop growth and not beneficial to generation of the silver loopers. If the field with more larvae in the later generation of autumn is ploughed deeply, part of overwintering pupae can be directly killed, the deeply buried pupae can not emerge, and the pupae exposed on the ground surface can be predated or air-dried to die by natural enemies such as birds, so that the population base number of the next year can be greatly reduced. Because the agricultural prevention and control is mostly preventive measures, the application has certain limitation, the agricultural prevention and control can not be used as emergency measures, and the agricultural prevention and control method is useless when the Argyroma punctatus explodes.

The chemical control, namely the pesticide control, is to utilize chemical insecticide to kill pests, is an important component of the comprehensive control of the silver looper, has the characteristics of rapidness, convenience, simplicity and high economic benefit, and is an essential emergency measure especially under the condition that the silver looper is large in occurrence. The existing chemical prevention and control method mainly adopts liquid medicine spraying, has better prevention and control effect before the 3 rd larva of the Trichoplusia ni, has small food consumption and weak drug resistance of the larva, and can determine the larva stage of 1-2 th larva according to the peak period of trapping and collecting insects under a lamp or determine the prevention and control time according to the damage state of the early larva. 2.5 percent of deltamethrin, 4.5 percent of beta-cypermethrin, 5 percent of abamectin, 5 percent of chlorfluazuron missible oil or 10 percent of imidacloprid wettable powder are usually selected to prepare 1000-fold liquid for spraying. Meanwhile, chemical control also has limitations, such as pesticide damage to crops, drug resistance of pests, natural enemy killing and environmental pollution caused by improper use, damage to farmland ecosystems, threat to safety of pesticide residues to people and livestock and other adverse effects.

Physical control mainly utilizes various physical factors such as light, electricity, color, temperature and humidity and mechanical equipment for trapping, radiation sterilization and the like to control pests according to the reaction of the pests on various physical factors in environmental conditions. When the adult insects are sent out, the adult insects are trapped and killed by a net puff or light. The strong phototaxis of the imagoes of the cotton bollworms is utilized, and black lights are arranged in the eclosion period to trap and kill the imagoes so as to reduce the egg falling amount and the larva density in the field; however, the black light lamp needs to clean up dirt on the optical filter in time every day, otherwise the black light can be influenced to emit, and further the insect killing effect is influenced; the requirement on the stability of the power supply voltage is high, and the operation of the device also has the danger of hurting eyes of people; furthermore, the lamp is installed in a relatively large investment.

Biological control is to control the population quantity of pests by using certain beneficial organisms or biological metabolites so as to achieve the purpose of reducing or eliminating the pests, such as selecting pesticides with low toxicity to natural enemies, adjusting the pesticide application time according to the difference of the occurrence periods of the pests and the natural enemies in the field, and avoiding pesticide application when a large number of natural enemies occur so as to protect the natural enemies; and secondly, the cabbage worm melanoma ichneumon fly can be manually put in or preparations such as bacillus thuringiensis SD-5, silverlooper nucleopolyhedrosis virus and the like are sprayed to control the silverlooper. It is characterized by safety to human and livestock, little pollution to environment and long-term control of certain pests; however, the effect is often unstable and the same investment is required to make the weight of the silver looper light and heavy.

In order to solve the limitation of agricultural control, chemical control, physical control and biological control in practical application, scientists find that some insect-resistant transgenic plants can be obtained to prevent and control plant pests by transferring insect-resistant genes for coding insecticidal proteins into plants through research.

The Cry1A insecticidal protein is one of a plurality of insecticidal proteins and is an insoluble parasporal crystal protein produced by Bacillus thuringiensis. The Cry1A protein is ingested by the insect into the midgut and the toxoprotein protoxin is solubilized in the alkaline pH environment of the insect midgut. The N-and C-termini of the protein are digested by alkaline protease to convert the protoxin to an active fragment; the active fragment is combined with a receptor on the upper surface of the insect midgut epithelial cell membrane and is inserted into the intestinal membrane, so that the cell membrane has perforation symptoms, osmotic pressure change, pH balance and the like inside and outside the cell membrane are damaged, the digestion process of the insect is disturbed, and the insect finally dies.

The transgenic Cry1A plant is proved to be capable of resisting the invasion of Lepidoptera (Lepidoptera) pests such as corn borer, cotton bollworm, spodoptera frugiperda (fall armyworm) and the like, however, no report about controlling the plant damage of the cotton bollworm moth by generating a transgenic plant expressing Cry1A protein is available so far.

Disclosure of Invention

The invention aims to provide the application of insecticidal protein, provides a method for controlling the harm of the spodoptera littoralis to plants by generating transgenic plants expressing Cry1A protein for the first time, and effectively overcomes the technical defects of agricultural control, chemical control, physical control, biological control and the like in the prior art.

To achieve the above object, the present invention provides a method for controlling a helicoverpa zealand pest, comprising contacting a helicoverpa zealand pest with at least Cry1A protein.

Further, said Cry1A protein is present in a host cell that produces at least said Cry1A protein, and said helicoverpa virescens pest is at least in contact with said Cry1A protein by feeding said host cell.

Still further, said Cry1A protein is present in a bacterium or transgenic plant that produces at least said Cry1A protein, said helicoverpa zealand pest is contacted at least with said Cry1A protein by feeding tissue of said bacterium or transgenic plant, upon contact said helicoverpa zealand pest growth is inhibited and/or caused to die, to achieve control of helicoverpa zealand pest damage to the plant.

The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, female ear, anther or filament.

The plant is semen glycines, semen Phaseoli Radiati, semen Vignae sinensis, caulis et folium Brassicae campestris, caulis et folium Brassicae Capitatae, cauliflower, Chinese cabbage, and radix Raphani.

The transgenic plant may be at any stage of growth.

The control of the Trichoplusia ni-hazardous plants is not changed by changing the planting place and/or planting time.

The step preceding the contacting step is planting a plant comprising a polynucleotide encoding the Cry1A protein.

Preferably, the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein or a Cry1A.105 protein.

More preferably, the Cry1A protein has an amino acid sequence shown as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 and SEQ ID NO. 9. The Cry1A protein has nucleotide sequences shown in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 and SEQ ID NO. 10.

On the basis of the above technical solution, said plant may also comprise at least one second nucleotide different from the nucleotide encoding said Cry1A protein.

Further, the second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In the present invention, expression of a Cry1A protein in a transgenic plant can be accompanied by expression of one or more Cry-class insecticidal proteins and/or Vip-class insecticidal proteins. Co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering the plant to contain and express the desired genes. Alternatively, one plant (the 1 st parent) may be genetically engineered to express a Cry1A protein and a second plant (the 2 nd parent) may be genetically engineered to express a Cry-like insecticidal protein and/or a Vip-like insecticidal protein. Progeny plants expressing all the genes introduced into the 1 st and 2 nd parents are obtained by crossing the 1 st and 2 nd parents.

Preferably, the second nucleotide encodes a Vip3A protein, a Cry2Ab protein, or a Cry1Fa protein.

More preferably, the second nucleotide codes for the amino acid sequence shown in SEQ ID NO. 11 and SEQ ID NO. 13. The second nucleotide has the nucleotide sequence shown in SEQ ID NO. 12 and SEQ ID NO. 14.

Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the target insect pest.

In order to realize the purpose, the invention also provides application of the Cry1A protein in controlling the insect pest of the Trichoplusia agnata.

The present invention also provides a method of producing a plant that controls a helicoverpa zealand pest comprising introducing into the genome of the plant a polynucleotide sequence encoding a Cry1A protein.

The invention also provides a method of producing a plant propagule for controlling a Trichoplusia ni pest, comprising crossing a first plant obtained by said method with a second plant, and/or removing reproductive tissue from the plant obtained by said method for culture, thereby producing a plant propagule comprising a polynucleotide sequence encoding a Cry1A protein.

The invention also provides a method for culturing a plant for controlling the silver looper pests, which comprises the following steps:

planting at least one plant propagule comprising in its genome a polynucleotide sequence encoding a Cry1A protein;

growing the plant propagule into a plant;

growing the plant under conditions that artificially inoculate the Trichoplusia ni pest and/or the Trichoplusia ni pest naturally occurs to harm, harvesting plants having reduced plant damage and/or increased plant yield as compared to other plants not having a polynucleotide sequence encoding a Cry1A protein.

"plant propagules" as used herein include, but are not limited to, vegetative propagules and vegetative propagules. The plant sexual propagules include, but are not limited to, plant seeds; the vegetative propagation body of the plant refers to a vegetative organ or a special tissue of the plant body, and can generate a new plant under the condition of in vitro; the vegetative organ or a specific tissue includes, but is not limited to, roots, stems and leaves, such as: plants with roots as vegetative propagules include strawberry, sweet potato, and the like; plants with stems as vegetative propagules include sugarcane and potato (tubers); the plant with leaves as asexual propagules includes aloe, begonia, etc.

The term "contact" as used herein means touching, staying and/or feeding, in particular, an insect and/or pest touching, staying and/or feeding, to a plant, plant organ, plant tissue or plant cell, which may be either a plant, plant organ, plant tissue or plant cell expressing an insecticidal protein in vivo, or a plant, plant organ, plant tissue or plant cell having an insecticidal protein on the surface and/or a microorganism producing an insecticidal protein.

The 'control' and/or 'control' of the invention means that the silver looper pests are at least contacted with Cry1A protein, and the growth of the silver looper pests is inhibited and/or the silver looper pests die after the contact. Further, the Trichoplusia agnostii pest is at least contacted with the Cry1A protein by feeding plant tissue, upon which all or a portion of the Trichoplusia agnostii pest is inhibited from growing and/or caused to die. Inhibition refers to sublethal, i.e., not yet lethal, but capable of causing some effect in growth, development, behavior, physiology, biochemistry and tissue, such as slow and/or stopped growth. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, the plant and/or plant propagules for controlling the Trichoplusia ni pest containing the polynucleotide sequence for encoding the Cry1A protein have reduced plant damage, including but not limited to improved leaf resistance, and/or increased kernel weight, and/or yield increase, and the like, compared with non-transgenic wild type plants under the condition of natural harm of the Trichoplusia ni pest and/or the Trichoplusia ni pest inoculated artificially. The "controlling" and/or "controlling" effect of the Cry1A protein on argyrogramma was that it could exist independently, in particular that any tissue of the transgenic plant (containing the polynucleotide sequence encoding the Cry1A protein) was present and/or produced simultaneously and/or asynchronously, the Cry1A protein and/or another substance that could control argyrogramma pest, then the presence of said another substance did not affect, nor could it lead to said "controlling" and/or "controlling" effect of Cry1A on argyro being achieved wholly and/or partially by said another substance, regardless of the Cry1A protein. Generally, in the field, the process of feeding plant tissues by the Trichoplusia ni pests is short and difficult to observe visually, so that under the condition of artificially inoculating Trichoplusia ni pests and/or naturally occurring harm to the Trichoplusia ni pests, such as any tissues of transgenic plants (containing a polynucleotide sequence encoding Cry1A protein), dead Trichoplusia ni pests exist, and/or Trichoplusia ni pests with inhibited growth stay thereon, and/or have reduced plant damage compared with non-transgenic wild type plants, namely, the method and/or the use of the invention are realized, namely, the method and/or the use of controlling the Trichoplusia ni pests are realized by contacting the Trichoplusia ni pests with at least Cry1A protein.

RNA interference (RNAi) refers to a highly conserved, double-stranded RNA (dsRNA) -induced, highly efficient and specific degradation of homologous mrnas during evolution. RNAi techniques can thus be used in the present invention to specifically knock out or turn off the expression of particular genes in target insect pests, particularly genes associated with the growth and development of the target insect pests.

The adult Heliothis virescens has gray brown color, body length of 15-17mm, dark brown front wing, 2 silver transverse striations, and 1 silver triangular patch and a horseshoe-shaped silver white patch in the center. The back wing is dark brown and has metallic luster. The back of the chest has two clusters of upright longer tan scale hair. The eggs are hemispherical, have a length of 0.4-0.5mm, are milky white at first birth, are light yellow green, and have reticulate patterns on the surface of the egg shells. The larvae are 5 years old, the aged larvae are 25-32mm, the body is light green, the front part is thin, the back part is thick, the back part is provided with 6 longitudinal white thin lines, the valve line is black, the No. 1 and No. 2 abdomens are degenerated, and the larvae are bent and stretched when walking. The pupa has a length of 18-20mm, a thin body, a green abdominal surface at the early stage, a black brown color at the later stage, obviously protruded throttle holes at 1 and 2 of the abdominal part, a pair of tail spines and thin cocoons.

The silver pattern noctuids are widely distributed in China, and are mainly distributed in Yangtze river watershed and yellow river watershed. The generation numbers of the silver print noctuids are different in different local years, 2-3 generations in Ningxia, about 3-4 generations in Hebei and Jiangsu, about 5-6 generations in Hunan and lake north, and 7 generations in Guangzhou. The insect overwinter with pupa. The eclosion of the imagoes can be seen in the next 4 months, and the imagoes enter the full egg laying period after eclosion for 4-5 days. The eggs are scattered on the leaf back. The most spawning occurs in the 2 nd to 3 rd generations, and the adult worms are prone to diurnal and nocturnal phenomena and have phototaxis and chemotaxis. The newly hatched larvae mostly eat mesophyll on the back of the leaf, the epidermis is left, tender leaves are eaten after 3 years, holes are formed, and the food consumption is greatly increased. The larvae are 5 years old, have pseudo-death, and can curl and fall to the ground after being frightened. The larval stage is about 10 days at room temperature. The mature larva spits white silk on the back of the host leaf to make cocoon and pupate. Adult insects were still visible from the end of 11 months to the beginning of 12 months. The damage degree of the cotton bollworm is mainly influenced by the insect source base number and the temperature and humidity, the higher humidity and the lower temperature are favorable for the cotton bollworm to occur in summer, but the rainstorm in the egg stage and the early larva stage is not favorable for the cotton bollworm to occur.

In the classification system, lepidoptera is generally classified into suborder, superfamily, and family according to morphological characteristics such as the pulse order, linkage pattern, and the type of an antennary. The noctuidae family is the most abundant family in lepidoptera, more than 2 thousands of which are found in the world, and thousands of records are recorded in China only. Most of insects of the noctuidae family are pests of crops, and can eat leaves, eat bolls and the like, such as cotton bollworms, prodenia litura and the like. Although cotton bollworms, prodenia litura and the like and the silver looper belong to the lepidoptera noctuidae family, the cotton bollworms, the prodenia litura and the like are greatly different in morphological structure except the similarity in classification standard; as compared with the strawberry and the apple in the plant (belonging to Rosaceae of Rosales), the strawberry and apple all have the characteristics of flower amphipathy, radiation symmetry, 5 petals and the like, but the fruit and plant forms are very different. However, people are considered to be largely different in insect morphology because people are less exposed to insects, especially agricultural pests, and have less concern about differences in insect morphology. In fact, the silver looper has its unique characteristics, both in larval and adult form. For example, the spodoptera litura larvae have black brown heads and changeable chests, and are all from yellow soil to black green; the spodoptera litura adults are dark brown, white tufts are formed on the back of the chest, the front wings are grey brown, and the patterns are multiple. The larvae of the Trichoplusia agnata which belong to the family of noctuidae are in light green; the adult Heliothis virescens is gray brown, and has two groups of long brown scale hair on the back of chest, dark brown front wing, and silvery white stripe.

Insects belonging to the same genus and family of noctuidae are different in not only morphological characteristics but also feeding habits. For example, like cotton bollworms of the noctuidae family, which damage cotton by boring, cotton bolls or corn ears, the prodenia litura is more preferable to bite leaves, only keeps the main veins, and has a very wide host range, besides corn and soybean, the prodenia litura can damage over 100 and over 300 plants including melons, eggplants, beans, shallots, leeks, spinach, cruciferous vegetables, grain crops, cash crops and the like, while the trichoplusia argentea host range is relatively concentrated on the cruciferous vegetables and bean crops and mainly has the damage of eating leaves. Differences in feeding habits also suggest that the enzymes and receptor proteins produced by the digestive system in vivo are different. Enzymes produced in the digestive tract are the key points for the Bt genes to act, and only enzymes or receptor proteins which can be combined with specific Bt genes can make certain Bt genes have insect-resistant effects on the pests. More and more studies have shown that insects from different families of the same order, and even from different species of the same family, exhibit different sensitivities to the same species of Bt proteins. For example, the Cry1Ab protein is completely different in effect on four noctuidae pests, better resistant to the cotton bollworm Helicoverpa armigera, but almost no effect can be ascribed to the beet armyworm Spodoptera exigua, and completely inactive against the Spodoptera litura and the Agrotis ipsilon. The pests belong to Lepidoptera noctuidae, but the same Bt protein has different resistance effects on the pests of the noctuidae. This is a good indication that the interaction pattern of Bt proteins with enzymes and receptors in insects is complex and unpredictable.

The genome of a plant, plant tissue or plant cell as defined in the present invention refers to any genetic material within a plant, plant tissue or plant cell and includes the nuclear and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described in the present invention form a complete "gene" encoding a protein or polypeptide in a desired host cell. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the present invention may be placed under the control of regulatory sequences in the host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one strand is complementary to the other strand, and vice versa. Other complementary strands of DNA are produced as the DNA replicates in plants. Thus, the present invention includes the use of the polynucleotides and their complementary strands exemplified in the sequence listing. The "coding strand" as commonly used in the art refers to the strand to which the antisense strand is joined. To express a protein in vivo, one strand of DNA is typically transcribed into the complementary strand of an mRNA, which serves as a template for translation of the protein. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (a codon is three nucleotides, three of which at a time can yield a particular amino acid) that can be read as an Open Reading Frame (ORF) to form a protein or peptide of interest. The present invention also includes RNAs that are functional equivalent to the exemplified DNA.

The nucleic acid molecule or fragment thereof of the invention hybridizes with the Cry1A gene of the invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry1A gene of the invention. Nucleic acid molecules or fragments thereof are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present invention, two nucleic acid molecules can be said to be capable of specifically hybridizing to each other if they can form an antiparallel double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one another if they exhibit complete complementarity. In the present invention, two nucleic acid molecules are said to exhibit "perfect complementarity" when each nucleotide of the two nucleic acid molecules is complementary to the corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability to allow them to anneal and bind to each other under conventional "highly stringent" conditions. Deviations from perfect complementarity may be tolerated as long as such deviations do not completely prevent the formation of a double-stranded structure by the two molecules. In order to allow a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure in the particular solvent and salt concentrations employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes under highly stringent conditions to the complementary strand of a compatible nucleic acid molecule. Suitable stringency conditions for promoting DNA hybridization include, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45 ℃ followed by a wash with 2.0 XSSC at 50 ℃, as is well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from the group consisting of about 2.0 XSSC for low stringency conditions, 50 ℃ to about 0.2 XSSC for high stringency conditions, 50 ℃. In addition, the temperature conditions in the washing step can be raised from about 22 ℃ at room temperature for low stringency conditions to about 65 ℃ for high stringency conditions. Both the temperature conditions and the salt concentration may be varied, or one may be held constant while the other is varied. Preferably, the stringent conditions of the present invention may be specifically hybridizing to SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14 in a 6 XSSC, 0.5% SDS solution at 65 ℃ and washing the membrane 1 times with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Thus, sequences having anti-insect activity and hybridizing under stringent conditions with the SEQ ID NO 2, SEQ ID NO 4, SEQ ID NO 6, SEQ ID NO 8, SEQ ID NO 10, SEQ ID NO 12, SEQ ID NO 14 of the present invention are included in the present invention. These sequences are at least about 40% -50% homologous, about 60%, 65%, or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence homology to the sequences of the present invention.

The genes and proteins described in the present invention include not only the specific exemplified sequences, but also portions and/or fragments (including internal and/or terminal deletions compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras and fusion proteins that preserve the pesticidal activity characteristics of the specific exemplified proteins. The "variant" or "variation" refers to a nucleotide sequence that encodes the same protein or encodes an equivalent protein with pesticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity against a Trichoplusia ni pest as the protein of claim.

"fragment" or "truncation" of a DNA molecule or protein sequence as described herein refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) or an artificially modified form thereof (e.g., a sequence suitable for plant expression) that may vary in length but is long enough to ensure that the (encoded) protein is an insect toxin.

Modification of genes and easy construction of gene variants can be achieved using standard techniques. For example, techniques for making point mutations are well known in the art. Another example is U.S. patent No. 5605793, which describes methods for generating other molecular diversity using DNA reassembly after random fragmentation. Fragments of the full-length gene can be made using commercial endonucleases, and exonucleases can be used following standard procedures. For example, nucleotides can be systematically excised from the ends of these genes using enzymes such as Bal31 or site-directed mutagenesis. A variety of restriction enzymes can also be used to obtain a gene encoding an active fragment. Active fragments of these toxins can be obtained directly using proteases.

The invention can derive equivalent proteins and/or genes encoding the equivalent proteins from Bt isolates and/or DNA libraries. There are various methods for obtaining the pesticidal proteins of the present invention. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from a mixture of proteins. In particular, antibodies may be caused by the most constant and different protein portions of the protein than other Bt proteins. These antibodies can then be used to specifically identify the equivalent proteins with characteristic activities by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins disclosed in the present invention or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. The genes encoding these proteins can then be obtained from the microorganism.

Due to the redundancy of the genetic code, a plurality of different DNA sequences may encode the same amino acid sequence. It is well within the skill of the art to generate such alternative DNA sequences encoding the same or substantially the same protein. These different DNA sequences are included in the scope of the present invention. The "substantially identical" sequence refers to a sequence having amino acid substitutions, deletions, additions or insertions which do not substantially affect pesticidal activity, and also includes fragments which retain pesticidal activity.

The substitution, deletion or addition of the amino acid sequence in the present invention is a conventional technique in the art, and it is preferable that such amino acid change is: small changes in properties, i.e., conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of about 1-30 amino acids; a small amino-or carboxy-terminal extension, e.g., one methionine residue to the amino terminus; small linker peptides, for example, about 20-25 residues in length.

Examples of conservative substitutions are those that occur within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions which do not normally alter a particular activity are well known in the art and have been described, for example, by N.Neurath and R.L.Hill in Protein, 1979, New York academic Press. The most common exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and vice versa.

It will be apparent to those skilled in the art that such substitutions may occur outside the region which plays an important role in the function of the molecule and still result in an active polypeptide. For polypeptides of the invention whose activity is essential and therefore the choice of unsubstituted amino acid residues can be identified according to methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing mutations at each positively charged residue in the molecule and testing the resulting mutant molecules for anti-insect activity to determine amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure as determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, e.g., deVos et al, 1992, Science 255: 306-.

In the present invention, Cry1A proteins include but are not limited to Cry1Ab, Cry1Ac or Cry1A.105, or have a certain homology with the amino acid sequences shown in SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 7, SEQ ID NO 9, SEQ ID NO 11, and SEQ ID NO 13. These sequences typically have a similarity/identity of greater than 78%, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99% to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined according to more specific identity and/or similarity ranges. For example 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity to a sequence exemplified herein.

In the present invention, transgenic plants producing the Cry1A protein include, but are not limited to, a MON87701 transgenic soybean event and/or plant material comprising a MON87701 transgenic soybean event (as described in CN 101861392B), a MON87751 transgenic soybean event and/or plant material comprising a MON87751 transgenic soybean event (as described in CN 105531376A), a DAS81419(9582.814.19.1) transgenic soybean event and/or plant material comprising a DAS81419(9582.814.19.1) transgenic soybean event (as described in CN103826444A, CN103826445A and/or CN 103827132B), a 9582.816.15.1 transgenic soybean event and/or plant material comprising a 9582.816.15.1 transgenic soybean event (as described in CN104583404A and/or CN 104718293A), which may carry out the methods and/or uses of the present invention, namely, the method and/or the use for controlling the silver looper pests by contacting the silver looper pests with at least Cry1A protein. It will be appreciated by those skilled in the art that the methods and/or uses of the present invention can also be achieved by expressing the Cry1A protein in the transgenic event described above in a different plant. More specifically, said Cry1A protein is present in a transgenic plant that produces at least said Cry1A protein, said helicoverpa zealand pest is contacted at least with said Cry1A protein by ingestion of tissue of said transgenic plant, and upon contact said helicoverpa zealand pest growth is inhibited and/or caused to die, to effect control of helicoverpa zealand pest damage to the plant.

The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Cry1A protein.

The promoter is a promoter capable of being expressed in a plant, and the promoter capable of being expressed in the plant is a promoter which ensures that a coding sequence connected with the promoter is expressed in a plant cell. The promoter expressible in plants may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoter derived from cauliflower mosaic virus, Arabidopsis Ubi10 promoter, maize Ubi promoter, promoter of rice GOS2 gene, and the like. Alternatively, the plant expressible promoter may be a tissue specific promoter, i.e. a promoter that directs expression of the coding sequence at a higher level in some tissues of the plant, e.g. in green tissues, than in other tissues of the plant (as can be determined by conventional RNA assays), e.g. the PEP carboxylase promoter. Alternatively, the promoter expressible in a plant may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-induced expression pattern means that when a plant is subjected to mechanical or insect feeding induced wounds, the expression of the coding sequence under the control of the promoter is significantly increased compared to under normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of potato and tomato protease-inhibitory genes (pin I and pin II) and maize protease-inhibitory gene (MPI).

The transit peptide (also known as a secretion signal sequence or targeting sequence) is intended to direct the transgene product to a specific organelle or cellular compartment, and for the receptor protein, the transit peptide may be heterologous, e.g., targeting the chloroplast using a chloroplast transit peptide sequence, or targeting the endoplasmic reticulum using a 'KDEL' retention sequence, or targeting the vacuole using the CTPP of the barley lectin gene.

The leader sequence includes, but is not limited to, a small RNA virus leader sequence, such as an EMCV leader sequence (encephalomyocarditis virus 5' non-coding region); potyvirus leaders, such as the MDMV (maize dwarf mosaic virus) leader; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequences of envelope protein mRNA of alfalfa mosaic virus (AMV RNA 4); tobacco Mosaic Virus (TMV) leader sequence.

Such enhancers include, but are not limited to, cauliflower mosaic virus (CaMV) enhancer, Figwort Mosaic Virus (FMV) enhancer, carnation weathering Circovirus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis Mosaic Virus (MMV) enhancer, midnight fragrant tree yellowing leaf curl virus (CmYLCV) enhancer, multan cotton leaf curl virus (CLCuMV), dayflower yellow mottle virus (CoYMV), and peanut chlorosis streak mosaic virus (PCLSV) enhancer.

For monocot applications, the intron includes, but is not limited to, the maize hsp70 intron, the maize ubiquitin intron, Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including, but not limited to, polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene, polyadenylation signal sequence derived from the protease inhibitor II (PIN II) gene, polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

As used herein, "operably linked" refers to the linkage of nucleic acid sequences such that one provides the functionality required of the linked sequence. In the present invention, the "operative linkage" may be a linkage of a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "operably linked" when the sequence of interest encodes a protein and expression of the protein is desired indicates that: the promoter is linked to the sequence in such a way that the resulting transcript is translated efficiently. If the linkage of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, such a linkage is made such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter and is linked in such a way that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to: sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 'untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites, and/or transcription terminators), sequences that provide DNA transfer and/or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that facilitate sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomously replicating sequences, centromeric sequences).

"pesticidal" or "pest-resistant" as used herein means toxic to crop pests, thereby achieving "control" and/or "control" of the crop pests. Preferably, the term "pesticidal" or "pest-resistant" refers to killing of a crop pest. More specifically, the target insect is a silver looper pest.

The Cry1A protein has toxicity to the silver looper pests. Plants of the invention, particularly soybeans, contain within their genome exogenous DNA comprising a nucleotide sequence encoding a Cry1A protein with which a spodoptera litura pest is contacted by feeding plant tissue, upon which the growth of the spodoptera litura pest is inhibited and/or caused to die. Inhibition refers to lethal or sublethal. At the same time, the plant should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, the plant may substantially eliminate the need for chemical or biological pesticides (which are pesticides against the silver earworm pest targeted by the Cry1A protein).

The expression level of Insecticidal Crystal Protein (ICP) in plant material can be detected by a variety of methods described in the art, for example by quantifying mRNA encoding an insecticidal protein produced in the tissue using specific primers, or by direct specific detection of the amount of insecticidal protein produced.

Different assays may be used to determine the pesticidal effect of ICP in plants. The target insect in the invention is mainly the silver looper.

In the invention, the Cry1A protein can have an amino acid sequence shown by SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9. In addition to comprising the coding region for the Cry1A protein, other elements may also be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Cry1A protein of the invention can also be expressed in plants together with at least one protein encoding a herbicide resistance gene, including, but not limited to, a glufosinate resistance gene (e.g., bar gene, pat gene), a benfop resistance gene (e.g., pmph gene), a glyphosate resistance gene (e.g., EPSPS gene), a bromoxynil (bromoxynil) resistance gene, a sulfonylurea resistance gene, a resistance gene to herbicide dalapon, a resistance gene to cyanamide, or a resistance gene to a glutamine synthetase inhibitor (e.g., PPT), thereby obtaining transgenic plants having both high pesticidal activity and herbicide resistance.

In the present invention, an exogenous DNA is introduced into a plant, such as a gene or an expression cassette or a recombinant vector encoding the Cry1A protein into a plant cell, and conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker silicon-mediated DNA introduction.

The invention provides an application of insecticidal protein, which has the following advantages:

1. preventing and treating internal cause. In the prior art, the harm of the silver noctuid pests is mainly controlled by external action, namely external cause, such as agricultural control, chemical control, physical control and biological control; the invention controls the insect pests of the silver looper by generating Cry1A protein capable of killing the silver looper in plants, namely, by internal cause.

2. No pollution and no residue. Chemical control methods used in the prior art have a certain effect on controlling the harm of the silver looper pests, but also bring pollution, damage and residue to human, livestock and farmland ecosystems; the method for controlling the silver looper pests can eliminate the adverse consequences.

3. Preventing and treating in the whole growth period. The method for controlling the silver print moth pests in the prior art is staged, but the invention protects the plants in the whole growth period, and the transgenic plants (Cry1A protein) can be prevented from being damaged by the silver print moth from germination, growth, flowering and fruiting.

4. And (4) whole plant prevention and control. The method for controlling the silver noctuid pests used in the prior art is mostly local, such as foliage spraying; the invention protects the whole plant, such as roots, leaves, stems, fruits, tassels, female ears, anthers or filaments of a transgenic plant (Cry1A protein) which can resist the invasion of the Trichoplusia ni.

5. The effect is stable. In the prior art, both agricultural control methods and physical control methods need to utilize environmental conditions to control pests, and have more variable factors; the Cry1A protein is expressed in the plant body, the defect of unstable environmental conditions is effectively overcome, and the control effect of the transgenic plant (Cry1A protein) is stable and consistent in different places, different time and different genetic backgrounds.

6. Simple, convenient and economical. The frequency oscillation type insecticidal lamp used in the prior art has large one-time investment and is in danger of hurting people by electric shock when not operated properly; the invention only needs to plant the transgenic plant capable of expressing the Cry1A protein without adopting other measures, thereby saving a great deal of manpower, material resources and financial resources.

7. The effect is thorough. The method for controlling the silver looper pests in the prior art has incomplete effect and only plays a role in lightening; the control effect of the transgenic plant (Cry1A protein) on the silver print armyworm first-hatched larvae is almost one hundred percent, extremely individual survival larvae basically stop developing, the larvae are basically in the first-hatched state after 3 days, the larvae are obviously dysplastic and stop developing, and cannot survive in the natural environment of the field, but the transgenic plant is slightly damaged.

The technical solution of the present invention is further described in detail by the accompanying drawings and embodiments.

Drawings

FIG. 1 is a flow chart of construction of a recombinant cloning vector DBN01-T containing Cry1A nucleotide sequence for use of the insecticidal protein of the invention;

FIG. 2 is a flow chart of construction of a soybean recombinant expression vector DBN100125 containing Cry1A nucleotide sequence for use of the insecticidal protein of the invention.

Detailed Description

The technical scheme of the application of the insecticidal protein of the invention is further illustrated by the specific examples.

First example, Gene acquisition and Synthesis

1. Obtaining nucleotide sequences

An amino acid sequence (818 amino acids) of Cry1Ab-01 insecticidal protein is shown as SEQ ID NO:1 in a sequence table; a Cry1Ab-01 nucleotide sequence (2457 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ab-01 insecticidal protein and is shown as SEQ ID NO:2 in a sequence table. An amino acid sequence (615 amino acids) of Cry1Ab-02 insecticidal protein is shown as SEQ ID NO. 3 in a sequence table; a Cry1Ab-02 nucleotide sequence (1848 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ab-02 insecticidal protein, and is shown as SEQ ID NO:4 in a sequence table.

An amino acid sequence (1178 amino acids) of Cry1Ac-01 insecticidal protein is shown as SEQ ID NO. 5 in a sequence table; a Cry1Ac-01 nucleotide sequence (3537 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ac-01 insecticidal protein and is shown as SEQ ID NO:6 in a sequence table. An amino acid sequence (1156 amino acids) of Cry1Ac-02 insecticidal protein is shown as SEQ ID NO. 7 in a sequence table; a Cry1Ac-02 nucleotide sequence (3471 nucleotides) which encodes an amino acid sequence corresponding to the Cry1Ac-02 insecticidal protein, and is shown as SEQ ID NO:8 in a sequence table.

The amino acid sequence (1177 amino acids) of Cry1A.105 insecticidal protein is shown as SEQ ID NO. 9 in the sequence table; a Cry1A.105 nucleotide sequence (3534 nucleotides) which encodes an amino acid sequence corresponding to the Cry1A.105 insecticidal protein, and is shown as SEQ ID NO:10 in a sequence table.

The amino acid sequence (634 amino acids) of Cry2Ab insecticidal protein is shown as SEQ ID NO:11 in the sequence table; a Cry2Ab nucleotide sequence (1905 nucleotides) which encodes an amino acid sequence corresponding to the Cry2Ab insecticidal protein, and is shown as SEQ ID NO:12 in a sequence table.

Cry1Fa insecticidal protein (1148 amino acids) as shown in SEQ ID NO:13 in the sequence table; a Cry1Fa nucleotide sequence (3447 nucleotides) which encodes the amino acid sequence of the Cry1Fa insecticidal protein, and is shown as SEQ ID NO:14 in the sequence table.

2. Synthesis of the above nucleotide sequence

Synthesizing the Cry1Ab-01 nucleotide sequence (shown as SEQ ID NO:2 in a sequence table), the Cry1Ab-02 nucleotide sequence (shown as SEQ ID NO:4 in the sequence table), the Cry1Ac-01 nucleotide sequence (shown as SEQ ID NO:6 in the sequence table), the Cry1Ac-02 nucleotide sequence (shown as SEQ ID NO:8 in the sequence table), the Cry1A.105 nucleotide sequence (shown as SEQ ID NO:10 in the sequence table), the Cry2Ab nucleotide sequence (shown as SEQ ID NO:12 in the sequence table), and the Cry1Fa nucleotide sequence (shown as SEQ ID NO:14 in the sequence table). The 5 'end of the synthesized Cry1Ab-01 nucleotide sequence (SEQ ID NO:2) is also connected with a Spe I enzyme cutting site, and the 3' end of the Cry1Ab-01 nucleotide sequence (SEQ ID NO:2) is also connected with a BamH I enzyme cutting site; the 5 'end of the synthesized Cry1Ab-02 nucleotide sequence (SEQ ID NO:4) is also connected with a Kas I enzyme cutting site, and the 3' end of the Cry1Ab-02 nucleotide sequence (SEQ ID NO:4) is also connected with a BamH I enzyme cutting site; the 5 'end of the synthesized Cry1Ac-01 nucleotide sequence (SEQ ID NO:6) is also connected with a BamH I enzyme cutting site, and the 3' end of the Cry1Ac-01 nucleotide sequence (SEQ ID NO:6) is also connected with a Kas I enzyme cutting site; the 5 'end of the synthesized Cry1Ac-02 nucleotide sequence (SEQ ID NO:8) is also connected with a BamH I enzyme cutting site, and the 3' end of the Cry1Ac-02 nucleotide sequence (SEQ ID NO:8) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Cry1A.105 nucleotide sequence (SEQ ID NO:10) is also connected with an Nco I enzyme cutting site, and the 3' end of the Cry1A.105 nucleotide sequence (SEQ ID NO:10) is also connected with a Hind III enzyme cutting site; the 5 'end of the synthesized Cry2Ab nucleotide sequence (SEQ ID NO:12) is also connected with an Nco I enzyme cutting site, and the 3' end of the Cry2Ab nucleotide sequence (SEQ ID NO:12) is also connected with a Spe I enzyme cutting site; the 5 'end of the synthesized Cry1Fa nucleotide sequence (SEQ ID NO:14) is also connected with an Asc I enzyme cutting site, and the 3' end of the Cry1Fa nucleotide sequence (SEQ ID NO:14) is also connected with a BamH I enzyme cutting site.

Second embodiment, construction of recombinant expression vector and Agrobacterium transformation with recombinant expression vector

1. Construction of recombinant cloning vector containing Cry1A Gene

The synthetic Cry1Ab-01 nucleotide sequence is connected to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), the operation steps are carried out according to the pGEM-T vector instruction of Promega company, and a recombinant cloning vector DBN01-T is obtained, and the construction process is shown in figure 1 (wherein Amp represents ampicillin resistance gene, fiori represents replication origin of phage f1, LacZ is LacZ initiation codon, SP6 is SP6RNA polymerase promoter, T7 is T7RNA polymerase promoter, Cry1Ab-01 is Cry1Ab-01 nucleotide sequence (SEQ ID NO:2), and MCS is multiple cloning site).

The recombinant cloning vector DBN01-T was then used to transform E.coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method under the following heat shock conditions: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant cloning vector DBN01-T), water bath at 42 ℃ for 30 s; the cells were cultured with shaking at 37 ℃ for 1h (shaking table at 100 rpm), and grown overnight on LB plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) coated with IPTG (isopropylthio-. beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. beta. -D-galactoside) ampicillin (100mg/L) on their surfaces. White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial solution with 100 μ L ice-precooled solution I (25mM Tris-HCl, 10mM EDTA (ethylene diamine tetraacetic acid), 50mM glucose, pH 8.0); add 200. mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, and place on ice for 3-5 min; adding 150 μ L ice-cold solution III (3M potassium acetate, 5M acetic acid), mixing well immediately, and standing on ice for 5-10 min; centrifuging at 4 deg.C and 12000rpm for 5min, adding 2 times volume of anhydrous ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 4 deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol (V/V), and air drying; adding 30. mu.L of TE (10mM Tris-HCl, 1mM EDTA, pH8.0) containing RNase (20. mu.g/ml) to dissolve the precipitate; bathing in water at 37 deg.C for 30min to digest RNA; storing at-20 deg.C for use.

After the extracted plasmid is subjected to SpeI and BamH I enzyme digestion identification, sequencing verification is carried out on positive clones, and the result shows that the Cry1Ab-01 nucleotide sequence inserted into the DBN01-T recombinant cloning vector is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely the Cry1Ab-01 nucleotide sequence is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab-02 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Cry1Ab-02 is Cry1Ab-02 nucleotide sequence (SEQ ID NO: 4). Enzyme cutting and sequencing verify that the Cry1Ab-02 nucleotide sequence in the recombinant cloning vector DBN02-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ac-01 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein Cry1Ac-01 is Cry1Ac-01 nucleotide sequence (SEQ ID NO: 6). Enzyme cutting and sequencing verify that the Cry1Ac-01 nucleotide sequence in the recombinant cloning vector DBN03-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ac-02 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, wherein Cry1Ac-02 is Cry1Ac-02 nucleotide sequence (SEQ ID NO: 8). Enzyme cutting and sequencing verify that the Cry1Ac-02 nucleotide sequence in the recombinant cloning vector DBN04-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1A.105 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN05-T, wherein the Cry1A.105 is the Cry1A.105 nucleotide sequence (SEQ ID NO: 10). The correct insertion of the Cry1A.105 nucleotide sequence in the recombinant cloning vector DBN05-T is verified by enzyme digestion and sequencing.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry2Ab nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN06-T, wherein Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO: 12). Enzyme cutting and sequencing verify that the Cry2Ab nucleotide sequence in the recombinant cloning vector DBN06-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Fa nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN07-T, wherein Cry1Fa is Cry1Fa nucleotide sequence (SEQ ID NO: 14). Enzyme cutting and sequencing verify that the Cry1Fa nucleotide sequence in the recombinant cloning vector DBN07-T is correctly inserted.

2. Construction of recombinant expression vector of soybean containing Cry1A gene

The construction of a recombinant expression vector DBN100125 by inserting the excised Cry1Ab-01 nucleotide sequence fragment between the SpeI and BamH I sites of the expression vector DBNBC-01 is well known to those skilled in the art by using restriction enzymes SpeI and BamH I to cleave the recombinant cloning vector DBN01-T and the expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from the CAMBIA group)), respectively, and the construction process is shown in FIG. 2 (Kan: kanamycin gene; RB: right border; prAtUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15), Cry1 Ab-01: Cry1Ab-01 nucleotide sequence (SEQ ID NO:2), tNos: nopaline synthase gene terminator (SEQ ID NO:16), prCauliflower 35S: cauliflower mosaic virus 35S promoter (SEQ ID NO:17), Pat transfer enzyme gene: acetylphosphinothricin 35S: 18T gene (SEQ ID NO: 8518) of nopaline synthase gene, and the construction process of a recombinant expression vector DBNBC-01 The toxin 35S terminator (SEQ ID NO: 19); LB: left border).

The recombinant expression vector DBN100125 is used for transforming the competent cells of the escherichia coli T1 by a heat shock method, wherein the heat shock condition is as follows: 50 μ L of Escherichia coli T1 competent cells, 10 μ L of plasmid DNA (recombinant expression vector DBN100125), water bath at 42 ℃ for 30 s; shaking at 37 deg.C for 1h (shaking table at 100 rpm); then, the cells were cultured for 12 hours at 37 ℃ on LB solid plates (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, pH adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin (Kanamycin), white colonies were picked up, and the cells were cultured overnight at 37 ℃ in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, Kanamycin 50mg/L, pH adjusted to 7.5 with NaOH). The plasmid is extracted by an alkaline method. The extracted plasmid is cut by restriction enzymes Spe I and BamH I and then identified, and the positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100125 between Spe I and BamH I sites is the nucleotide sequence shown by SEQ ID NO. 2 in the sequence table, namely Cry1Ab-01 nucleotide sequence.

According to the method for constructing the recombinant expression vector DBN100125, the Cry1Ab-02 nucleotide sequence cut by Kas I and BamH I enzyme digestion recombinant cloning vector DBN02-T is inserted into an expression vector DBNBC-01 to obtain the recombinant expression vector DBN 100744. The nucleotide sequence in the recombinant expression vector DBN100744 is verified to contain a nucleotide sequence shown as SEQ ID NO. 4 in the sequence table, namely Cry1Ab-02 nucleotide sequence, and the Cry1Ab-02 nucleotide sequence can be connected with the prAtUbi10 promoter and the tNos terminator.

According to the above method for constructing recombinant expression vector DBN100125, Cry1Ac-01 nucleotide sequence cut by BamH I and Kas I enzyme digestion recombinant cloning vector DBN03-T is inserted into expression vector DBNBC-01 to obtain recombinant expression vector DBN100645 (Kan: kanamycin gene; RB: right border; prAtRbcS 4: Arabidopsis thaliana ribulose 1, 5-bisphosphate carboxylase small subunit gene promoter (SEQ ID NO:20), Cry1 Ac-01: Cry1Ac-01 nucleotide sequence (SEQ ID NO:6), tNos: terminator of nopaline synthase gene (SEQ ID NO:16), pr 35S: cauliflower virus 35S promoter (SEQ ID NO:17), PAT: glufosinate acetyltransferase gene (SEQ ID NO:18), T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19), LB: left border). The nucleotide sequence in the recombinant expression vector DBN100645 is verified by enzyme digestion and sequencing to contain the nucleotide sequence shown as SEQ ID NO. 6 in the sequence table, namely Cry1Ac-01 nucleotide sequence.

According to the above-mentioned method for constructing recombinant expression vector DBN100125, the nucleotide sequence Cry1Ac-01 and Cry2Ab cut out by BamH I and Kas I, Nco I and Spe I, respectively, digesting recombinant cloning vector DBN03-T and DBN06-T are inserted into expression vector DBNBC-01 to obtain recombinant expression vector DBN100175 (Kan: kanamycin gene; RB: right border; pratUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO: 15); 2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO: 12); tNos: terminator of nopaline synthase gene (SEQ ID NO: 16); pratRbcS 4: Arabidopsis thaliana nucleotid 1, 5-bisphosphate carboxylase small subunit gene promoter (SEQ ID NO: 20); Cry1 Ac-01: Cry1Ac-01 nucleotide sequence (SEQ ID NO: 6); Cryptotaenia asiatica terminator of nopaline synthase gene (SEQ ID NO: 35S: nopaline synthase gene: SEQ ID NO: 35): 17) (ii) a PAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 18); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 19); LB: left border). The nucleotide sequence in the recombinant expression vector DBN100175 is verified by enzyme digestion and sequencing to contain nucleotide sequences shown by SEQ ID NO. 6 and SEQ ID NO. 12 in the sequence table, namely Cry1Ac-01 nucleotide sequence and Cry2Ab nucleotide sequence.

According to the above method for constructing recombinant expression vector DBN100125, inserting the Cry1Ac-02 nucleotide sequence and Cry1Fa nucleotide sequence cut by BamH I and Spe I, Asc I and BamH I respectively enzyme-cutting recombinant cloning vector DBN04-T and DBN07-T into expression vector DBNBC-01 to obtain recombinant expression vector DBN100656 (Kan: kanamycin gene; RB: right border; praatUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15), Cry1 Fa: Cry1Fa nucleotide sequence (SEQ ID NO:14), terminator of tNos: nopaline synthase gene (SEQ ID NO:16), prCsVMV: cassava vein mosaic virus promoter (SEQ ID NO:21), Cry1 Ac-02: Cry1Ac-02 nucleotide sequence (SEQ ID NO:8), terminator of tNos: nopaline synthase gene (SEQ ID NO:16), promoter of Cryptotaenia japonica virus gene promoter (SEQ ID NO: 35S: Cryptotaenia purpurea promoter (PAT 1) and Cryptotaenia purpurea 1 NO: 8625-02 nucleotide sequence (SEQ ID NO:8) (SEQ ID NO: 18); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 19); LB: left border). The nucleotide sequence in the recombinant expression vector DBN100656 contains nucleotide sequences shown by SEQ ID NO:8 and SEQ ID NO:14 in the sequence table, namely Cry1Ac-02 nucleotide sequence and Cry1Fa nucleotide sequence.

According to the above method for constructing recombinant expression vector DBN100125, the nucleotide sequence of Cry1A.105 cut by Nco I and Hind III enzyme digestion recombinant cloning vector DBN05-T is inserted into expression vector DBNBC-01 to obtain recombinant expression vector DBN 100757. The nucleotide sequence in the recombinant expression vector DBN100757 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 10 in the sequence table, namely a Cry1A.105 nucleotide sequence, and the Cry1A.105 nucleotide sequence can be connected with the prAtUbi10 promoter and the tNos terminator.

According to the above-mentioned method for constructing recombinant expression vector DBN100125, the nucleotide sequence of Cry1A.105 and the nucleotide sequence of Cry2Ab cut out from Nco I, Hind III, Nco I and Spe I respectively digested by recombinant cloning vector DBN05-T and DBN06-T are inserted into expression vector DBNBC-01 to obtain recombinant expression vector DBN100176 (Kan: kanamycin gene; RB: right border; pratUbi 10: Arabidopsis Ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15), Cry2 Ab: Cry2Ab nucleotide sequence (SEQ ID NO:12), terminator of tNos: nopaline synthase gene (SEQ ID NO:16), pratRbcS 4: Arabidopsis thaliana ribulose 1, 5-bisphosphate carboxylase small subunit gene promoter (SEQ ID NO:20), Cry 1A.105: Cry1A.105 nucleotide sequence (SEQ ID NO:10), terminator of tpye synthase gene (SEQ ID NO: nopaline synthase gene: SEQ ID NO: 35: nopaline synthase gene) (SEQ ID NO: PAT NO: 35: 16), terminator of nopaline synthase gene (SEQ ID NO: 35S: nopaline promoter (SEQ ID NO: 35) and promoter (SEQ ID NO:16) of nopaline II Enzyme gene (SEQ ID NO: 18); t 35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 19); LB: left border). The nucleotide sequence in the recombinant expression vector DBN100176 is verified by enzyme digestion and sequencing to contain nucleotide sequences shown by SEQ ID NO 10 and SEQ ID NO 12 in the sequence table, namely a Cry1A.105 nucleotide sequence and a Cry2Ab nucleotide sequence.

3. Recombinant expression vector transformation agrobacterium tumefaciens

The correctly constructed soybean recombinant expression vectors DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176 are transformed into Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-: 100. mu.L Agrobacterium LBA4404, 3. mu.L plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and heating in 37 deg.C water bath for 10 min; the transformed agrobacterium LBA4404 is inoculated in an LB test tube and cultured for 2h under the conditions of the temperature of 28 ℃ and the rotating speed of 200rpm, the transformed agrobacterium LBA4404 is smeared on an LB plate containing 50mg/L Rifampicin (Rifampicin) and 100mg/L kanamycin until positive monoclonals grow out, the monoclonals are picked up and cultured, plasmids of the monoclonals are extracted, restriction enzymes are used for enzyme digestion verification of soybean recombinant expression vectors DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176, and the result shows that the structures of the soybean recombinant expression vectors DBN100125, DBN100645 744, DBN100175, DBN100656, DBN100757 and DBN100176 are completely correct.

Third example, obtaining transgenic plants

1. Obtaining transgenic soybean plants

The cotyledonary node tissue of yellow 13 in the aseptically cultured soybean variety was co-cultured with the Agrobacterium of example 3 according to the conventionally employed Agrobacterium invasion method to transfer the T-DNAs (including Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ac-01 nucleotide sequence, Cry1Ac-02 nucleotide sequence, Cry1A.105 nucleotide sequence, Cry2 Cry 4 nucleotide sequence, Cry1 3635-01 nucleotide sequence and PAT 865 gene) of the soybean recombinant expression vectors DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176 constructed in example 2 into the soybean chromosome group, to obtain the soybean plant with the Cry1Ab-01 nucleotide sequence, the soybean plant with the Cry1Ab-02 nucleotide sequence, the soybean plant with the Cry1Ac-01 nucleotide sequence, the soybean plant with the Cry Ac-01-1 Cry 1-364 nucleotide sequence, the soybean plant with the Cry 1-Ac-Ab nucleotide sequence, the soybean plant with the Cry 1-Ab nucleotide sequence, Soybean plants with a Cry1A.105 nucleotide sequence and soybean plants with a Cry1A.105-Cry2Ab nucleotide sequence, and wild soybean plants are used as controls.

For Agrobacterium-mediated transformation of soybean, briefly, matureThe soybean seeds are germinated in a soybean germination culture medium (B5 salt 3.1g/L, B5 g vitamin, sucrose 20g/L, agar 8g/L, pH5.6), the seeds are inoculated on the germination culture medium, and the seeds are cultured according to the following conditions: the temperature is 25 +/-1 ℃; the photoperiod (light/dark) was 16/8 h. Taking the soybean aseptic seedling expanded at the fresh green cotyledonary node after germinating for 4-6 days, cutting off hypocotyl at 3-4mm position below the cotyledonary node, longitudinally cutting cotyledon, and removing terminal bud, side bud and seed root. Wounding at the cotyledonary node with the back of a scalpel, contacting the wounded cotyledonary node tissue with an Agrobacterium suspension, wherein the Agrobacterium is capable of delivering the Cry1A nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step) in this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD)₆₆₀0.5-0.8, medium (MS salts 2.15g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS)40mg/L, 2-morpholinoethanesulfonic acid (MES)4g/L, Zeatin (ZT)2mg/L, pH5.3) was infected to initiate inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culture step). Preferably, the cotyledonary node tissue is cultured on solid medium (MS salts 4.3g/L, B5 vitamins, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) after the infection step. After this co-cultivation phase, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (cephamycin) is present in the recovery medium (B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) without the addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the regenerated tissue mass of cotyledonary nodes is cultured on solid medium with antibiotics but without a selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the regenerated tissue mass of cotyledonary node was cultured on a medium containing a selection agent (glufosinate) and the growing transformed callus was selected (step 4: selection step). Preferably, the regenerated tissue mass of the cotyledonary node is cultured in selective solid medium (B5 salt 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP)1mg/L, agar 8g/L, cephamycin 150mg/L, glutamic acid100mg/L, 100mg/L aspartic acid, 6mg/L glufosinate, pH5.6), results in selective growth of the transformed cells. Then, the transformed cells are regenerated into plants (step 5: regeneration step), and preferably, the cotyledonary node regenerated tissue pieces grown on a medium containing a selection agent are cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate the plants.

The resistant tissue blocks obtained by screening are transferred to the B5 differentiation medium (B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cefamycin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6), and cultured and differentiated at 25 ℃. The differentiated plantlets were transferred to the B5 rooting medium (B5 salts 3.1g/L, B5 vitamins, MES1g/L, sucrose 30g/L, agar 8g/L, cephamycin 150mg/L, indole-3-butyric acid (IBA)1mg/L), cultured at 25 ℃ on rooting medium to a height of about 10cm, and transferred to a greenhouse for fructification. In the greenhouse, the culture was carried out daily at 26 ℃ for 16h and at 20 ℃ for 8 h.

Fourth example, validation of transgenic plants Using TaqMan

Taking 100mg of each of a soybean Plant with a transferred Cry1Ab-01 nucleotide sequence, a soybean Plant with a transferred Cry1Ab-02 nucleotide sequence, a soybean Plant with a transferred Cry1Ac-01 nucleotide sequence, a soybean Plant with a transferred Cry1Ac-01-Cry1Fa nucleotide sequence, a soybean Plant with a transferred Cry1Ac-02-Cry2Ab nucleotide sequence, a soybean Plant with a transferred Cry1A.105 nucleotide sequence and a soybean Plant with a transferred Cry1A.105-Cry2Ab nucleotide sequence as samples, extracting genomic DNA of the samples by using a DNeasy Plant Maxi Kit of Qiagen, and detecting the copy number of the PAT gene by a Taqman probe fluorescence quantitative PCR method to determine the copy number of the Cry1A gene. Meanwhile, wild soybean plants are used as a control, and detection and analysis are carried out according to the method. The experiment was repeated 3 times and the average was taken.

The specific method for detecting the copy number of the PAT gene comprises the following steps:

step 11, respectively taking 100mg of leaves of a soybean plant transferred with a Cry1Ab-01 nucleotide sequence, a soybean plant transferred with a Cry1Ab-02 nucleotide sequence, a soybean plant transferred with a Cry1Ac-01 nucleotide sequence, a soybean plant transferred with a Cry1Ac-01-Cry1Fa nucleotide sequence, a soybean plant transferred with a Cry1Ac-02-Cry2Ab nucleotide sequence, a soybean plant transferred with a Cry1A.105 nucleotide sequence and a soybean plant transferred with a Cry1A.105-Cry2Ab nucleotide sequence, respectively grinding the leaves into homogenate by liquid nitrogen in a mortar, and taking 3 repeats of each sample;

step 12, extracting the genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, and referring to the product specification of the specific method;

step 13, measuring the genomic DNA concentration of the sample by using NanoDrop 2000(Thermo Scientific);

step 14, adjusting the genomic DNA concentration of the sample to the same concentration value, wherein the concentration value range is 80-100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with known copy number after identification as a standard substance, taking the sample of a wild soybean plant as a control, repeating each sample for 3 times, and taking the average value; the fluorescent quantitative PCR primer and the probe sequence are respectively as follows:

the following primers and probes were used to detect the PAT gene:

primer 1: gagggtgttgtggctggtattg is shown as SEQ ID NO. 22 in the sequence table;

primer 2: tctcaactgtccaatcgtaagcg is shown as SEQ ID NO. 23 in the sequence list;

1, probe 1: cttacgctgggccctggaaggctag is shown as SEQ ID NO:24 in the sequence list;

the PCR reaction system is as follows:

the 50 × primer/probe mixture contained 45 μ L of each primer at a concentration of 1mM, 50 μ L of probe at a concentration of 100 μ M and 860 μ L of 1 × TE buffer and was stored in amber tubes at 4 ℃.

The PCR reaction conditions are as follows:

data were analyzed using SDS2.3 software (Applied Biosystems).

The experimental result shows that Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ac-01 nucleotide sequence, Cry1Ac-01-Cry2Ab nucleotide sequence, Cry1Ac-02-Cry1Fa nucleotide sequence, Cry1A.105 nucleotide sequence and Cry1A.105-Cry2Ab nucleotide sequence are all integrated into the chromosome group of the detected soybean plant, and the soybean plants transferred with the Cry1Ab-01 nucleotide sequence, the soybean plants transferred with the Cry1Ab-02 nucleotide sequence, the soybean plants transferred with the Cry1Ac-01 nucleotide sequence, the soybean plants transferred with the Cry1Ac-01-Cry2Ab nucleotide sequence, the soybean plants transferred with the Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plants transferred with the Cry1A.105 nucleotide sequence and the soybean plants transferred with the Cry1A.105-Cry2Ab nucleotide sequence all obtain single-copy transgenic soybean plants.

Fifth example, detection of insect-resistant Effect of transgenic Soybean plants

Carrying out insect-resistant effect detection on the cotton leafworm through a soybean plant with a transferred Cry1Ab-01 nucleotide sequence, a soybean plant with a transferred Cry1Ab-02 nucleotide sequence, a soybean plant with a transferred Cry1Ac-01 nucleotide sequence, a soybean plant with a transferred Cry1Ac-01-Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1Ac-02-Cry1Fa nucleotide sequence, a soybean plant with a transferred Cry1A.105-Cry2Ab nucleotide sequence, a wild type soybean plant and a soybean plant identified as non-transgenic by Taqman.

Respectively taking a soybean plant with a transferred Cry1Ab-01 nucleotide sequence, a soybean plant with a transferred Cry1Ab-02 nucleotide sequence, a soybean plant with a transferred Cry1Ac-01 nucleotide sequence, a soybean plant with a transferred Cry1Ac-01-Cry2Ab nucleotide sequence, a soybean plant with a transferred Cry1Ac-02-Cry1Fa nucleotide sequence, a soybean plant with a transferred Cry1A.105-Cry2Ab nucleotide sequence, a wild type soybean plant and fresh leaves of the soybean plant (trefoil stage) identified as a non-transgenic soybean plant by Taqman, washing the fresh leaves with sterile water, draining the water on the leaves with gauze, removing veins from the leaves, shearing the leaves into long strips with the length of about 2cm multiplied by 3.5cm, putting 1 sheared long strip leaf into a round plastic culture dish, putting 10-headed silver leaf moths (initial larvae) into each culture dish, and covering the culture dish, after the plant is placed for 3 days under the conditions that the temperature is 25-28 ℃, the relative humidity is 70-80% and the photoperiod (light/dark) is 16:8, the total resistance score (full score of 300) is obtained according to three indexes of the development progress, the death rate and the leaf damage rate of the larvae of the helicoverpa agnata: the total resistance score is 100 × mortality + [100 × mortality +90 × (number of first hatched insects/total number of inoculated insects) +60 × (number of first hatched-negative control insects/total number of inoculated insects) +10 × (number of negative control insects/total number of inoculated insects) ] +100 × (1-leaf damage rate). A total of 3 transformation event strains (S1, S2 and S3) transformed with a Cry1Ab-01 nucleotide sequence, a total of 3 transformation event strains (S4, S5 and S6) transformed with a Cry1Ab-02 nucleotide sequence, a total of 3 transformation event strains (S7, S8 and S9) transformed with a Cry1Ac-01 nucleotide sequence, a total of 3 transformation event strains (S10, S11 and S12) transformed with a Cry1Ac-01-Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S13, S14 and S15) transformed with a Cry1Ac-02-Cry1Fa nucleotide sequence, a total of 3 transformation event strains (S16, S17 and S18) transformed with a Cry1A.105-Cry2Ab nucleotide sequence, a total of 3 transformation event strains (S19, S20 and S21) transformed with a Cry A.105-Ab nucleotide sequence, a total of 3 transformation event strains (S16, S19, a total of negative strains (S6851, Taq man) and a wild type, non-negative control strains (CK 1, non-negative strains; from each line, 3 plants were selected for testing, each replicated 1 time. The results are shown in Table 1.

TABLE 1 insect resistance test results of transgenic soybean plants inoculated with Trichoplusia agnata

The results in table 1 show that: the soybean plant with the transferred Cry1Ab-01 nucleotide sequence, the soybean plant with the transferred Cry1Ab-02 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01-Cry2Ab nucleotide sequence, the soybean plant with the transferred Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant with the transferred Cry1A.105 nucleotide sequence and the soybean plant with the transferred Cry1A.105-Cry2Ab nucleotide sequence have good insecticidal effect on the Trichoplusia ni, the average death rate of the Trichoplusia ni is almost 100 percent, the total resistance score of the Trichoplusia ni is basically close to 300 full score, the non-transgenic soybean plant and the wild soybean plant identified by Taqman have no lethal or inhibiting effect on the Trichoplusia ni, and the total resistance score is generally about 60.

Compared with wild soybean plants, the prevention and control effects of soybean plants transferred with Cry1Ab-01 nucleotide sequence, soybean plants transferred with Cry1Ab-02 nucleotide sequence, soybean plants transferred with Cry1Ac-01 nucleotide sequence, soybean plants transferred with Cry1Ac-01-Cry2Ab nucleotide sequence, soybean plants transferred with Cry1Ac-02-Cry1Fa nucleotide sequence, soybean plants transferred with Cry1A.105 nucleotide sequence and soybean plants transferred with Cry1A.105-Cry2Ab nucleotide sequence on the initial hatching larvae of the Trichoplusia ni are almost hundred percent, the extremely individual survival larvae basically stop developing, and the larvae are still in the initial hatching state after 3 days, are all obvious dysplasia, stop developing and cannot survive in the natural environment of the field; and the soybean plant transferred with Cry1Ab-01 nucleotide sequence, the soybean plant transferred with Cry1Ab-02 nucleotide sequence, the soybean plant transferred with Cry1Ac-01 nucleotide sequence, the soybean plant transferred with Cry1Ac-01-Cry2Ab nucleotide sequence, the soybean plant transferred with Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant transferred with Cry1A.105 nucleotide sequence and the soybean plant transferred with Cry1A.105-Cry2Ab nucleotide sequence are only slightly damaged on the whole, and the damage rate of the leaves is about 1%.

Therefore, the soybean plant with the transferred Cry1Ab-01 nucleotide sequence, the soybean plant with the transferred Cry1Ab-02 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01-Cry2Ab nucleotide sequence, the soybean plant with the transferred Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant with the transferred Cry1A.105 nucleotide sequence and the soybean plant with the transferred Cry1A.105-Cry2Ab nucleotide sequence show high anti-Trichoplusia virgata activity, and the activity is enough to generate adverse effect on the growth of the Trichoplusia virgata to control the Trichoplusia virgata in the field.

The above experimental results also show that: the control/prevention of the silverworm moth by the soybean plant with the transferred Cry1Ab-01 nucleotide sequence, the soybean plant with the transferred Cry1Ab-02 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01 nucleotide sequence, the soybean plant with the transferred Cry1Ac-01-Cry2Ab nucleotide sequence, the soybean plant with the transferred Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant with the transferred Cry1A.105 nucleotide sequence and the soybean plant with the transferred Cry1A.105-Cry2Ab nucleotide sequence obviously because the plants can generate Cry1A proteins, such as Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein, therefore, the technicians in the field are familiar with the fact that the Cry1A protein can also generate at least one second insecticidal protein different from the Cry1A protein, such as Vip proteins or Cry proteins and the like, according to the poisoning effect of the Cry1A protein on the silverworm moth.

In conclusion, the application of the insecticidal protein disclosed by the invention is to control the insect pest of the silver looper by generating Cry1A protein capable of killing the silver looper in a plant body; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the method protects the whole plant in the whole growth period so as to control the invasion of the silver looper pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Finally, it should be noted that the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Sequence listing

<110> Beijing Dabei agricultural Biotechnology Co., Ltd

<120> use of insecticidal proteins

<130> DBNBC141

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 818

<212> PRT

<213> Artificial Sequence-Cry 1Ab-01 amino acid Sequence (Artificial Sequence)

<400> 1

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Glu Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Glu Cys Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn

675 680 685

Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser Thr

690 695 700

Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser His

785 790 795 800

His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp

805 810 815

Phe Arg

<210> 2

<211> 2457

<212> DNA

<213> Artificial Sequence-Cry 1Ab-01 nucleotide Sequence (Artificial Sequence)

<400> 2

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cctggattca tcgcagcgcg 1380

gagttcaaca atatcattcc gtcctcccaa atcacccaaa tccccctcac caagtccacc 1440

aacctgggca gcggcacctc cgtggtgaag ggcccaggct tcacgggcgg cgacatcctg 1500

cgcaggacct ccccgggcca gatcagcacc ctccgcgtca acatcaccgc tcccctgtcc 1560

cagaggtacc gcgtcaggat tcgctacgct agcaccacca acctgcaatt ccacacctcc 1620

atcgacggca ggccgatcaa tcagggtaac ttctccgcca ccatgtccag cggcagcaac 1680

ctccaatccg gcagcttccg caccgtgggt ttcaccaccc ccttcaactt ctccaacggc 1740

tccagcgttt tcaccctgag cgcccacgtg ttcaattccg gcaatgaggt gtacattgac 1800

cgcattgagt tcgtgccagc cgaggtcacc ttcgaagccg agtacgacct ggagagagcc 1860

cagaaggctg tcaatgagct cttcacgtcc agcaatcaga tcggcctgaa gaccgacgtc 1920

actgactacc acatcgacca agtctccaac ctcgtggagt gcctctccga tgagttctgc 1980

ctcgacgaga agaaggagct gtccgagaag gtgaagcatg ccaagcgtct cagcgacgag 2040

aggaatctcc tccaggaccc caatttccgc ggcatcaaca ggcagctcga ccgcggctgg 2100

cgcggcagca ccgacatcac gatccagggc ggcgacgatg tgttcaagga gaactacgtg 2160

actctcctgg gcactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaagctca aggcttacac tcgctaccag ctccgcggct acatcgaaga cagccaagac 2280

ctcgagattt acctgatccg ctacaacgcc aagcacgaga ccgtcaacgt gcccggtact 2340

ggttccctct ggccgctgag cgcccccagc ccgatcggca agtgtgccca ccacagccac 2400

cacttctcct tggacatcga tgtgggctgc accgacctga acgaggactt tcggtag 2457

<210> 3

<211> 615

<212> PRT

<213> Artificial Sequence-Cry 1Ab-02 amino acid Sequence (Artificial Sequence)

<400> 3

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr

610 615

<210> 4

<211> 1848

<212> DNA

<213> Artificial Sequence-Cry 1Ab-02 nucleotide Sequence (Artificial Sequence)

<400> 4

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga 1848

<210> 5

<211> 1178

<212> PRT

<213> Artificial Sequence-Cry 1Ac-01 amino acid Sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn

625 630 635 640

Val Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser

675 680 685

Asn Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser

690 695 700

Thr Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn

785 790 795 800

Arg Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys

805 810 815

Arg Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp

820 825 830

Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val

835 840 845

Ile Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu

850 855 860

Glu Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val

865 870 875 880

Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp

885 890 895

Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu

900 905 910

Phe Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala

915 920 925

Met Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr

930 935 940

Leu Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu

945 950 955 960

Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg

965 970 975

Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn

980 985 990

Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val

995 1000 1005

Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val

1010 1015 1020

Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly

1025 1030 1035 1040

Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp

1045 1050 1055

Glu Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn

1060 1065 1070

Thr Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly

1075 1080 1085

Ala Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro

1090 1095 1100

Ala Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg

1105 1110 1115 1120

Arg Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro

1125 1130 1135

Leu Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr

1140 1145 1150

Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val

1155 1160 1165

Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 6

<211> 3537

<212> DNA

<213> Artificial Sequence-Cry 1Ac-01 nucleotide Sequence (Artificial Sequence)

<400> 6

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct cttggataca tcgtagtgct 1380

gagttcaaca acatcatcgc atccgatagt attactcaaa tccctgcagt gaagggaaac 1440

tttctcttca acggttctgt catttcagga ccaggattca ctggtggaga cctcgttaga 1500

ctcaacagca gtggaaataa cattcagaat agagggtata ttgaagttcc aattcacttc 1560

ccatccacat ctaccagata tagagttcgt gtgaggtatg cttctgtgac ccctattcac 1620

ctcaacgtta attggggtaa ttcatccatc ttctccaata cagttccagc tacagctacc 1680

tccttggata atctccaatc cagcgatttc ggttactttg aaagtgccaa tgcttttaca 1740

tcttcactcg gtaacatcgt gggtgttaga aactttagtg ggactgcagg agtgattatc 1800

gacagattcg agttcattcc agttactgca acactcgagg ctgagtacaa ccttgagaga 1860

gcccagaagg ctgtgaacgc cctctttacc tccaccaatc agcttggctt gaaaactaac 1920

gttactgact atcacattga ccaagtgtcc aacttggtca cctaccttag cgatgagttc 1980

tgcctcgacg agaagcgtga actctccgag aaagttaaac acgccaagcg tctcagcgac 2040

gagaggaatc tcttgcaaga ctccaacttc aaagacatca acaggcagcc agaacgtggt 2100

tggggtggaa gcaccgggat caccatccaa ggaggcgacg atgtgttcaa ggagaactac 2160

gtcaccctct ccggaacttt cgacgagtgc taccctacct acttgtacca gaagatcgat 2220

gagtccaaac tcaaagcctt caccaggtat caacttagag gctacatcga agacagccaa 2280

gaccttgaaa tctactcgat caggtacaat gccaagcacg agaccgtgaa tgtcccaggt 2340

actggttccc tctggccact ttctgcccaa tctcccattg ggaagtgtgg agagcctaac 2400

agatgcgctc cacaccttga gtggaatcct gacttggact gctcctgcag ggatggcgag 2460

aagtgtgccc accattctca tcacttctcc ttggacatcg atgtgggatg tactgacctg 2520

aatgaggacc tcggagtctg ggtcatcttc aagatcaaga cccaagacgg acacgcaaga 2580

cttggcaacc ttgagtttct cgaagagaaa ccattggtcg gtgaagctct cgctcgtgtg 2640

aagagagcag agaagaagtg gagggacaaa cgtgagaaac tcgaatggga aactaacatc 2700

gtttacaagg aggccaaaga gtccgtggat gctttgttcg tgaactccca atatgatcag 2760

ttgcaagccg acaccaacat cgccatgatc cacgccgcag acaaacgtgt gcacagcatt 2820

cgtgaggctt acttgcctga gttgtccgtg atccctggtg tgaacgctgc catcttcgag 2880

gaacttgagg gacgtatctt taccgcattc tccttgtacg atgccagaaa cgtcatcaag 2940

aacggtgact tcaacaatgg cctcagctgc tggaatgtga aaggtcatgt ggacgtggag 3000

gaacagaaca atcagcgttc cgtcctggtt gtgcctgagt gggaagctga agtgtcccaa 3060

gaggttagag tctgtccagg tagaggctac attctccgtg tgaccgctta caaggaggga 3120

tacggtgagg gttgcgtgac catccacgag atcgagaaca acaccgacga gcttaagttc 3180

tccaactgcg tcgaggaaga aatctatccc aacaacaccg ttacttgcaa cgactacact 3240

gtgaatcagg aagagtacgg aggtgcctac actagccgta acagaggtta caacgaagct 3300

ccttccgttc ctgctgacta tgcctccgtg tacgaggaga aatcctacac agatggcaga 3360

cgtgagaacc cttgcgagtt caacagaggt tacagggact acacaccact tccagttggc 3420

tatgttacca aggagcttga gtactttcct gagaccgaca aagtgtggat cgagatcggt 3480

gaaaccgagg gaaccttcat cgtggacagc gtggagcttc tcttgatgga ggaataa 3537

<210> 7

<211> 1156

<212> PRT

<213> Artificial Sequence-Cry 1Ac-02 amino acid Sequence (Artificial Sequence)

<400> 7

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp Tyr Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ala Leu Phe Pro Asn Tyr Asp Ser Arg Arg Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Arg Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Ser Asp Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp

625 630 635 640

Val Thr Asp Tyr His Ile Asp Arg Val Ser Asn Leu Val Glu Cys Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro

675 680 685

Asn Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser

690 695 700

Thr Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser

785 790 795 800

His His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu

805 810 815

Asp Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp Gly His

820 825 830

Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu Val Gly

835 840 845

Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys

850 855 860

Arg Glu Lys Leu Glu Trp Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys

865 870 875 880

Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln Tyr Asp Arg Leu Gln

885 890 895

Ala Asp Thr Asn Ile Ala Met Ile His Ala Ala Asp Lys Arg Val His

900 905 910

Ser Ile Arg Glu Ala Tyr Leu Pro Glu Leu Ser Val Ile Pro Gly Val

915 920 925

Asn Ala Ala Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe

930 935 940

Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe Asn Asn

945 950 955 960

Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Glu Glu Gln

965 970 975

Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val

980 985 990

Ser Gln Glu Val Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val

995 1000 1005

Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu

1010 1015 1020

Ile Glu Asn Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu

1025 1030 1035 1040

Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala Thr

1045 1050 1055

Gln Glu Glu Tyr Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr Asp

1060 1065 1070

Gly Ala Tyr Glu Ser Asn Ser Ser Val Pro Ala Asp Tyr Ala Ser Ala

1075 1080 1085

Tyr Glu Glu Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn Pro Cys Glu

1090 1095 1100

Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala Gly Tyr Val

1105 1110 1115 1120

Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu

1125 1130 1135

Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp Ser Val Glu Leu Leu

1140 1145 1150

Leu Met Glu Glu

1155

<210> 8

<211> 3471

<212> DNA

<213> Artificial Sequence-Cry 1Ac-02 nucleotide Sequence (Artificial Sequence)

<400> 8

atggacaaca atcccaacat caacgagtgc attccttaca actgcctgag caaccctgag 60

gttgaggtgc tgggtggaga acggattgag actggttaca cacctatcga catctcgttg 120

tcacttaccc aattcctttt gtcagagttc gtgcccggtg ctggattcgt gcttggactt 180

gtcgatatca tttggggaat ctttggtccc tctcaatggg acgcctttct tgtacagata 240

gagcagttaa ttaaccaaag aatagaagaa ttcgctagga accaagccat ctcaaggtta 300

gaaggcctca gcaaccttta ccagatttac gcagaatctt ttcgagagtg ggaagcagac 360

ccgaccaatc ctgccttaag agaggagatg cgcattcaat tcaatgacat gaacagcgcg 420

ctgacgaccg caattccgct cttcgccgtt cagaattacc aagttcctct tttatccgtg 480

tacgtgcagg ctgccaacct gcacttgtcg gtgctccgcg atgtctccgt gttcggacaa 540

cggtggggct ttgatgccgc aactatcaat agtcgttata atgatctgac taggcttatt 600

ggcaactata ccgattatgc tgttcgctgg tacaacacgg gtctcgaacg tgtctgggga 660

ccggattcta gagattgggt caggtacaac cagttcaggc gagagttgac actaactgtc 720

ctagacattg tcgctctctt tcccaactac gactctaggc gctacccaat ccgtactgtg 780

tcacaattga cccgggaaat ctacacaaac ccagtcctcg agaacttcga cggtagcttt 840

cgaggctcgg ctcagggcat agagagaagc atcaggtctc cacacctgat ggacatattg 900

aacagtatca cgatctacac cgatgcgcac cgcggttatt actactggtc agggcatcag 960

atcatggcat cacccgttgg gttctctgga ccagaattca ctttcccact ttacgggact 1020

atgggcaatg cagctccaca acaacgtatt gttgctcaac tcggtcaggg cgtgtataga 1080

accttgtcca gcactctata taggagacct ttcaacatcg gcatcaacaa tcaacaattg 1140

tctgtgcttg acgggacaga atttgcctat ggaacctcct caaatctgcc atccgctgtc 1200

tacagaaaga gcggaacagt tgatagcttg gatgagatcc ctccacagaa caacaacgtt 1260

ccacctaggc aagggtttag ccatcgcctt agccatgtgt ccatgttccg ttcaggcttt 1320

agtaatagca gcgttagtat catcagagct ccgatgttct cttggataca tcgtagtgct 1380

gagtttaaca acataattgc atccgatagc attactcaga tcccagctgt caaggggaac 1440

tttctcttta atggttctgt catttcagga ccaggattca ctggaggcga cttggttagg 1500

ctgaattctt ccggcaacaa catccagaat agagggtata ttgaagtgcc cattcacttc 1560

ccatcgacat ctaccagata tcgtgttcgt gtaaggtatg cctctgttac ccctattcac 1620

ctcaacgtca attggggtaa ttcctccatc ttttccaata cagtaccagc gacagctaca 1680

tccttggata atctccaatc tagcgatttc ggttacttcg aaagtgccaa tgccttcacc 1740

tcttccctag gtaacatagt aggtgttaga aatttctccg gaaccgccgg agtgataatc 1800

gaccgcttcg aattcattcc cgttactgca acgctcgagg cagagtctga cttggaaaga 1860

gcacagaagg cggtgaatgc tctgttcact tcgtccaatc agattgggct caagacagat 1920

gtgactgact atcacatcga tcgcgtttcc aaccttgttg agtgcctctc tgatgagttc 1980

tgtttggatg agaagaagga gttgtccgag aaggtcaaac atgctaagcg acttagtgat 2040

gagcggaact tgcttcaaga tcccaacttt cgcgggatca acaggcaact agatcgtgga 2100

tggaggggaa gtacggacat caccattcaa ggaggtgatg atgtgttcaa ggagaactat 2160

gttacgctct tgggtacctt tgatgagtgc tatccaacat acctgtacca gaagatagat 2220

gaatcgaaac tcaaagccta cacaagatac cagttgagag gttacatcga ggacagtcaa 2280

gaccttgaga tctacctcat cagatacaac gccaaacatg agacagtcaa tgtgcctggg 2340

acgggttcac tctggccact ttcagcccca agtcccatcg gcaagtgtgc ccatcactca 2400

caccacttct ccttggacat agacgttggc tgtaccgacc tgaacgaaga cctcggtgtg 2460

tgggtgatct tcaagatcaa gactcaagat ggccatgcca ggctaggcaa tctggagttt 2520

ctagaagaga aaccacttgt tggagaagcc ctcgctagag tgaagagggc tgagaagaag 2580

tggagggaca agagagagaa gttggaatgg gaaacaaaca ttgtgtacaa agaagccaaa 2640

gaaagcgttg acgctctgtt tgtgaactct cagtatgata ggctccaagc tgataccaac 2700

atagctatga ttcatgctgc agacaaacgc gttcatagca ttcgggaagc ttaccttcct 2760

gaacttagcg tgattccggg tgtcaatgct gctatctttg aagagttaga agggcgcatc 2820

ttcactgcat tctccttgta tgatgcgagg aatgtcatca agaatggtga cttcaacaat 2880

ggcctatcct gctggaatgt gaaagggcac gtagatgtag aagaacagaa caatcaccgc 2940

tctgtccttg ttgttcctga gtgggaagca gaagtttcac aagaagttcg tgtctgtcct 3000

ggtcgtggct acattcttcg tgttaccgcg tacaaagaag gatacggaga aggttgcgtc 3060

accatacacg agattgagaa caacaccgac gagctgaagt tcagcaactg cgtcgaggag 3120

gaagtctacc caaacaacac cgtaacttgc aatgactaca ctgcgactca agaggagtat 3180

gagggtactt acacttctcg caatcgagga tacgatggag cctatgagag caactcttct 3240

gtacccgctg actatgcatc agcctatgag gagaaggctt acaccgatgg acgtagggac 3300

aatccttgcg aatctaacag aggctatggg gactacacac cgttaccagc cggctatgtc 3360

accaaagagt tagagtactt tccagaaacc gacaaggttt ggattgagat tggagaaacg 3420

gaaggaacat tcattgttga tagcgtggag ttacttctga tggaggaatg a 3471

<210> 9

<211> 1177

<212> PRT

<213> Artificial Sequence-Cry1A.105 amino acid Sequence (Artificial Sequence)

<400> 9

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Leu Val Lys Ala His

465 470 475 480

Thr Leu Gln Ser Gly Thr Thr Val Val Arg Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Gly Gly Pro Phe Ala Tyr Thr Ile

500 505 510

Val Asn Ile Asn Gly Gln Leu Pro Gln Arg Tyr Arg Ala Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Arg Ile Tyr Val Thr Val Ala Gly Glu

530 535 540

Arg Ile Phe Ala Gly Gln Phe Asn Lys Thr Met Asp Thr Gly Asp Pro

545 550 555 560

Leu Thr Phe Gln Ser Phe Ser Tyr Ala Thr Ile Asn Thr Ala Phe Thr

565 570 575

Phe Pro Met Ser Gln Ser Ser Phe Thr Val Gly Ala Asp Thr Phe Ser

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Phe Glu Leu Ile Pro Val Thr

595 600 605

Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser Asn

675 680 685

Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser Thr

690 695 700

Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn Arg

785 790 795 800

Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg

805 810 815

Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile

820 825 830

Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile

835 840 845

Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu

850 855 860

Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys

865 870 875 880

Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu

885 890 895

Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe

900 905 910

Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala Met

915 920 925

Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu

930 935 940

Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu

945 950 955 960

Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn

965 970 975

Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val

980 985 990

Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val Leu

995 1000 1005

Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys

1010 1015 1020

Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr

1025 1030 1035 1040

Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu

1045 1050 1055

Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn Thr

1060 1065 1070

Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly Ala

1075 1080 1085

Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro Ala

1090 1095 1100

Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg Arg

1105 1110 1115 1120

Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro Leu

1125 1130 1135

Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp

1140 1145 1150

Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp

1155 1160 1165

Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 10

<211> 3534

<212> DNA

<213> Artificial Sequence-Cry1A.105 nucleotide Sequence (Artificial Sequence)

<400> 10

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cttggataca ccgtagtgct 1380

gagttcaaca acatcattgc atccgacagc attactcaaa tacccttggt gaaagcacat 1440

acacttcagt caggtactac tgttgtcaga ggtccagggt ttacaggagg agacattctt 1500

cgtcgcacaa gtggaggacc ctttgcttac actattgtta acatcaatgg ccaattgccc 1560

caaaggtatc gtgcaagaat ccgctatgcc tctactacaa atctcaggat ctacgtgact 1620

gttgcaggtg aaaggatctt tgctggtcag ttcaacaaga ctatggatac cggtgaccct 1680

ttgacattcc aatcttttag ctacgcaact atcaacacag cttttacatt cccaatgagc 1740

cagagtagct tcacagtagg tgctgacact ttcagctcag ggaatgaagt ttacatcgac 1800

aggtttgaat tgattccagt tactgcaacc ctcgaggctg agtacaacct tgagagagcc 1860

cagaaggctg tgaacgccct ctttacctcc accaatcagc ttggcttgaa aactaacgtt 1920

actgactatc acattgacca agtgtccaac ttggtcacct accttagcga tgagttctgc 1980

ctcgacgaga agcgtgaact ctccgagaaa gttaaacacg ccaagcgtct cagcgacgag 2040

aggaatctct tgcaagactc caacttcaaa gacatcaaca ggcagccaga acgtggttgg 2100

ggtggaagca ccgggatcac catccaagga ggcgacgatg tgttcaagga gaactacgtc 2160

accctctccg gaactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaaactca aagccttcac caggtatcaa cttagaggct acatcgaaga cagccaagac 2280

cttgaaatct actcgatcag gtacaatgcc aagcacgaga ccgtgaatgt cccaggtact 2340

ggttccctct ggccactttc tgcccaatct cccattggga agtgtggaga gcctaacaga 2400

tgcgctccac accttgagtg gaatcctgac ttggactgct cctgcaggga tggcgagaag 2460

tgtgcccacc attctcatca cttctccttg gacatcgatg tgggatgtac tgacctgaat 2520

gaggacctcg gagtctgggt catcttcaag atcaagaccc aagacggaca cgcaagactt 2580

ggcaaccttg agtttctcga agagaaacca ttggtcggtg aagctctcgc tcgtgtgaag 2640

agagcagaga agaagtggag ggacaaacgt gagaaactcg aatgggaaac taacatcgtt 2700

tacaaggagg ccaaagagtc cgtggatgct ttgttcgtga actcccaata tgatcagttg 2760

caagccgaca ccaacatcgc catgatccac gccgcagaca aacgtgtgca cagcattcgt 2820

gaggcttact tgcctgagtt gtccgtgatc cctggtgtga acgctgccat cttcgaggaa 2880

cttgagggac gtatctttac cgcattctcc ttgtacgatg ccagaaacgt catcaagaac 2940

ggtgacttca acaatggcct cagctgctgg aatgtgaaag gtcatgtgga cgtggaggaa 3000

cagaacaatc agcgttccgt cctggttgtg cctgagtggg aagctgaagt gtcccaagag 3060

gttagagtct gtccaggtag aggctacatt ctccgtgtga ccgcttacaa ggagggatac 3120

ggtgagggtt gcgtgaccat ccacgagatc gagaacaaca ccgacgagct taagttctcc 3180

aactgcgtcg aggaagaaat ctatcccaac aacaccgtta cttgcaacga ctacactgtg 3240

aatcaggaag agtacggagg tgcctacact agccgtaaca gaggttacaa cgaagctcct 3300

tccgttcctg ctgactatgc ctccgtgtac gaggagaaat cctacacaga tggcagacgt 3360

gagaaccctt gcgagttcaa cagaggttac agggactaca caccacttcc agttggctat 3420

gttaccaagg agcttgagta ctttcctgag accgacaaag tgtggatcga gatcggtgaa 3480

accgagggaa ccttcatcgt ggacagcgtg gagcttctct tgatggagga ataa 3534

<210> 11

<211> 634

<212> PRT

<213> Artificial Sequence-Cry 2Ab amino acid Sequence (Artificial Sequence)

<400> 11

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 12

<211> 1905

<212> DNA

<213> Artificial Sequence-Cry 2Ab nucleotide Sequence (Artificial Sequence)

<400> 12

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 13

<211> 1148

<212> PRT

<213> Artificial Sequence-Cry 1Fa amino acid Sequence (Artificial Sequence)

<400> 13

Met Glu Asn Asn Ile Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn

1 5 10 15

Asn Pro Glu Val Glu Ile Leu Asn Glu Glu Arg Ser Thr Gly Arg Leu

20 25 30

Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Phe Leu Leu Ser Glu Phe

35 40 45

Val Pro Gly Val Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly

50 55 60

Phe Ile Thr Pro Ser Asp Trp Ser Leu Phe Leu Leu Gln Ile Glu Gln

65 70 75 80

Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu Arg Asn Arg Ala Ile Thr

85 90 95

Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Ile Tyr Ile Glu Ala Leu

100 105 110

Arg Glu Trp Glu Ala Asn Pro Asn Asn Ala Gln Leu Arg Glu Asp Val

115 120 125

Arg Ile Arg Phe Ala Asn Thr Asp Asp Ala Leu Ile Thr Ala Ile Asn

130 135 140

Asn Phe Thr Leu Thr Ser Phe Glu Ile Pro Leu Leu Ser Val Tyr Val

145 150 155 160

Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe

165 170 175

Gly Gln Gly Trp Gly Leu Asp Ile Ala Thr Val Asn Asn His Tyr Asn

180 185 190

Arg Leu Ile Asn Leu Ile His Arg Tyr Thr Lys His Cys Leu Asp Thr

195 200 205

Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn Thr Arg Gln Trp

210 215 220

Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp

225 230 235 240

Ile Val Ala Leu Phe Pro Asn Tyr Asp Val Arg Thr Tyr Pro Ile Gln

245 250 255

Thr Ser Ser Gln Leu Thr Arg Glu Ile Tyr Thr Ser Ser Val Ile Glu

260 265 270

Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn Arg Ala Glu

275 280 285

Phe Gly Val Arg Pro Pro His Leu Met Asp Phe Met Asn Ser Leu Phe

290 295 300

Val Thr Ala Glu Thr Val Arg Ser Gln Thr Val Trp Gly Gly His Leu

305 310 315 320

Val Ser Ser Arg Asn Thr Ala Gly Asn Arg Ile Asn Phe Pro Ser Tyr

325 330 335

Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu Asp Pro

340 345 350

Arg Pro Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly

355 360 365

Phe Gly Asn Pro His Tyr Val Leu Gly Leu Arg Gly Val Ala Phe Gln

370 375 380

Gln Thr Gly Thr Asn His Thr Arg Thr Phe Arg Asn Ser Gly Thr Ile

385 390 395 400

Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser Gly Ala Pro Trp

405 410 415

Asn Asp Tyr Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro

420 425 430

Gly Glu Ile Ser Gly Ser Asp Ser Trp Arg Ala Pro Met Phe Ser Trp

435 440 445

Thr His Arg Ser Ala Thr Pro Thr Asn Thr Ile Asp Pro Glu Arg Ile

450 455 460

Thr Gln Ile Pro Leu Val Lys Ala His Thr Leu Gln Ser Gly Thr Thr

465 470 475 480

Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr

485 490 495

Ser Gly Gly Pro Phe Ala Tyr Thr Ile Val Asn Ile Asn Gly Gln Leu

500 505 510

Pro Gln Arg Tyr Arg Ala Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu

515 520 525

Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly Gln Phe

530 535 540

Asn Lys Thr Met Asp Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser

545 550 555 560

Tyr Ala Thr Ile Asn Thr Ala Phe Thr Phe Pro Met Ser Gln Ser Ser

565 570 575

Phe Thr Val Gly Ala Asp Thr Phe Ser Ser Gly Asn Glu Val Tyr Ile

580 585 590

Asp Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu Ala Glu Ser

595 600 605

Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Ala Leu Phe Thr Ser Ser

610 615 620

Asn Gln Ile Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp Arg

625 630 635 640

Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu

645 650 655

Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp

660 665 670

Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln

675 680 685

Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly

690 695 700

Asp Asp Val Phe Lys Glu Asn Tyr Val Thr Leu Leu Gly Thr Phe Asp

705 710 715 720

Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu

725 730 735

Lys Ala Tyr Thr Arg Tyr Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln

740 745 750

Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala Lys His Glu Thr Val

755 760 765

Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro

770 775 780

Ile Gly Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile Asp

785 790 795 800

Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile Phe

805 810 815

Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu Phe

820 825 830

Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg

835 840 845

Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr

850 855 860

Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val

865 870 875 880

Asn Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile Ala Met Ile

885 890 895

His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu Pro

900 905 910

Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu Leu

915 920 925

Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn Val

930 935 940

Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val Lys

945 950 955 960

Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg Ser Val Leu Val

965 970 975

Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys Pro

980 985 990

Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly

995 1000 1005

Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu Leu

1010 1015 1020

Lys Phe Ser Asn Cys Val Glu Glu Glu Val Tyr Pro Asn Asn Thr Val

1025 1030 1035 1040

Thr Cys Asn Asp Tyr Thr Ala Thr Gln Glu Glu Tyr Glu Gly Thr Tyr

1045 1050 1055

Thr Ser Arg Asn Arg Gly Tyr Asp Gly Ala Tyr Glu Ser Asn Ser Ser

1060 1065 1070

Val Pro Ala Asp Tyr Ala Ser Ala Tyr Glu Glu Lys Ala Tyr Thr Asp

1075 1080 1085

Gly Arg Arg Asp Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr

1090 1095 1100

Thr Pro Leu Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro

1105 1110 1115 1120

Glu Thr Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe

1125 1130 1135

Ile Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1140 1145

<210> 14

<211> 3447

<212> DNA

<213> Artificial Sequence-Cry 1Fa nucleotide Sequence (Artificial Sequence)

<400> 14

atggagaaca acatacagaa tcagtgcgtc ccctacaact gcctcaacaa tcctgaagta 60

gagattctca acgaagagag gtcgactggc agattgccgt tagacatctc cctgtccctt 120

acacgtctcc tgttgtctga gtttgttcca ggtgtgggag ttgcgtttgg cctcttcgac 180

ctcatctggg gcttcatcac tccatctgat tggagcctct ttcttctcca gattgaacag 240

ttgattgaac aaaggattga gaccttggaa aggaatcggg ccatcactac ccttcgtggc 300

ttagcagaca gctatgagat ctacattgaa gcactaagag agtgggaagc caatcctaac 360

aatgcccaac tgagagaaga tgtgcgtata cgctttgcta acacagatga tgctttgatc 420

acagccatca acaacttcac ccttaccagc ttcgagatcc ctcttctctc ggtctatgtt 480

caagctgcta acctgcactt gtcactactg cgcgacgctg tgtcgtttgg gcaaggttgg 540

ggactggaca tagctactgt caacaatcac tacaacagac tcatcaatct gattcatcga 600

tacacgaaac attgtttgga tacctacaat cagggattgg agaacctgag aggtactaac 660

actcgccaat gggccaggtt caatcagttc aggagagacc ttacacttac tgtgttagac 720

atagttgctc tctttccgaa ctacgatgtt cgtacctatc cgattcaaac gtcatcccaa 780

cttacaaggg agatctacac cagttcagtc attgaagact ctccagtttc tgcgaacata 840

cccaatggtt tcaacagggc tgagtttgga gtcagaccac cccatctcat ggacttcatg 900

aactctttgt ttgtgactgc agagactgtt agatcccaaa ctgtgtgggg aggacactta 960

gttagctcac gcaacacggc tggcaatcgt atcaactttc ctagttacgg ggtcttcaat 1020

cccgggggcg ccatctggat tgcagatgaa gatccacgtc ctttctatcg gaccttgtca 1080

gatcctgtct tcgtccgagg aggctttggc aatcctcact atgtactcgg tcttagggga 1140

gtggcctttc aacaaactgg tacgaatcac acccgcacat tcaggaactc cgggaccatt 1200

gactctctag atgagatacc acctcaagac aacagcggcg caccttggaa tgactactcc 1260

catgtgctga atcatgttac ctttgtgcgc tggccaggtg agatctcagg ttccgactca 1320

tggagagcac caatgttctc ttggacgcat cgtagcgcta cccccacaaa caccattgat 1380

ccagagagaa tcactcagat tcccttggtg aaggcacaca cacttcagtc aggaactaca 1440

gttgtaagag ggccggggtt cacgggagga gacattcttc gacgcactag tggaggacca 1500

ttcgcgtaca ccattgtcaa catcaatggg caacttcccc aaaggtatcg tgccaggata 1560

cgctatgcct ctactaccaa tctaagaatc tacgttacgg ttgcaggtga acggatcttt 1620

gctggtcagt tcaacaagac aatggatacc ggtgatccac ttacattcca atctttctcc 1680

tacgccacta tcaacaccgc gttcaccttt ccaatgagcc agagcagttt cacagtaggt 1740

gctgatacct tcagttcagg caacgaagtg tacattgaca ggtttgagtt gattccagtt 1800

actgccacac tcgaggcaga gtctgacttg gaaagagcac agaaggcggt gaatgctctg 1860

ttcacttcgt ccaatcagat tgggctcaag acagatgtga ctgactatca catcgatcgc 1920

gtttccaacc ttgttgagtg cctctctgat gagttctgtt tggatgagaa gaaggagttg 1980

tccgagaagg tcaaacatgc taagcgactt agtgatgagc ggaacttgct tcaagatccc 2040

aactttcgcg ggatcaacag gcaactagat cgtggatgga ggggaagtac ggacatcacc 2100

attcaaggag gtgatgatgt gttcaaggag aactatgtta cgctcttggg tacctttgat 2160

gagtgctatc caacatacct gtaccagaag atagatgaat cgaaactcaa agcctacaca 2220

agataccagt tgagaggtta catcgaggac agtcaagacc ttgagatcta cctcatcaga 2280

tacaacgcca aacatgagac agtcaatgtg cctgggacgg gttcactctg gccactttca 2340

gccccaagtc ccatcggcaa gtgtgcccat cactcacacc acttctcctt ggacatagac 2400

gttggctgta ccgacctgaa cgaagacctc ggtgtgtggg tgatcttcaa gatcaagact 2460

caagatggcc atgccaggct aggcaatctg gagtttctag aagagaaacc acttgttgga 2520

gaagccctcg ctagagtgaa gagggctgag aagaagtgga gggacaagag agagaagttg 2580

gaatgggaaa caaacattgt gtacaaagaa gccaaagaaa gcgttgacgc tctgtttgtg 2640

aactctcagt atgataggct ccaagctgat accaacatag ctatgattca tgctgcagac 2700

aaacgcgttc atagcattcg ggaagcttac cttcctgaac ttagcgtgat tccgggtgtc 2760

aatgctgcta tctttgaaga gttagaaggg cgcatcttca ctgcattctc cttgtatgat 2820

gcgaggaatg tcatcaagaa tggtgacttc aacaatggcc tatcctgctg gaatgtgaaa 2880

gggcacgtag atgtagaaga acagaacaat caccgctctg tccttgttgt tcctgagtgg 2940

gaagcagaag tttcacaaga agttcgtgtc tgtcctggtc gtggctacat tcttcgtgtt 3000

accgcgtaca aagaaggata cggagaaggt tgcgtcacca tacacgagat tgagaacaac 3060

accgacgagc tgaagttcag caactgcgtc gaggaggaag tctacccaaa caacaccgta 3120

acttgcaatg actacactgc gactcaagag gagtatgagg gtacttacac ttctcgcaat 3180

cgaggatacg atggagccta tgagagcaac tcttctgtac ccgctgacta tgcatcagcc 3240

tatgaggaga aggcttacac cgatggacgt agggacaatc cttgcgaatc taacagaggc 3300

tatggggact acacaccgtt accagccggc tatgtcacca aagagttaga gtactttcca 3360

gaaaccgaca aggtttggat tgagattgga gaaacggaag gaacattcat tgttgatagc 3420

gtggagttac ttctgatgga ggaatga 3447

<210> 15

<211> 1322

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 15

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 16

<211> 530

<212> DNA

<213> Agrobacterium tumefaciens

<400> 16

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 17

<211> 529

<212> DNA

<213> promoter (Cauliflower mosaic virus)

<400> 17

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 18

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 18

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 19

<211> 195

<212> DNA

<213> terminator (Cauliflower mosaic virus)

<400> 19

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 20

<211> 1744

<212> DNA

<213> Arabidopsis promoter (Arabidopsis thaliana)

<400> 20

aattcaaatt tattatgtgt tttttttccg tggtcgagat tgtgtattat tctttagtta 60

ttacaagact tttagctaaa atttgaaaga atttacttta agaaaatctt aacatctgag 120

ataatttcag caatagatta tatttttcat tactctagca gtatttttgc agatcaatcg 180

caacatatat ggttgttaga aaaaatgcac tatatatata tatattattt tttcaattaa 240

aagtgcatga tatataatat atatatatat atatatgtgt gtgtgtatat ggtcaaagaa 300

attcttatac aaatatacac gaacacatat atttgacaaa atcaaagtat tacactaaac 360

aatgagttgg tgcatggcca aaacaaatat gtagattaaa aattccagcc tccaaaaaaa 420

aatccaagtg ttgtaaagca ttatatatat atagtagatc ccaaattttt gtacaattcc 480

acactgatcg aatttttaaa gttgaatatc tgacgtagga tttttttaat gtcttacctg 540

accatttact aataacattc atacgttttc atttgaaata tcctctataa ttatattgaa 600

tttggcacat aataagaaac ctaattggtg atttatttta ctagtaaatt tctggtgatg 660

ggctttctac tagaaagctc tcggaaaatc ttggaccaaa tccatattcc atgacttcga 720

ttgttaaccc tattagtttt cacaaacata ctatcaatat cattgcaacg gaaaaggtac 780

aagtaaaaca ttcaatccga tagggaagtg atgtaggagg ttgggaagac aggcccagaa 840

agagatttat ctgacttgtt ttgtgtatag ttttcaatgt tcataaagga agatggagac 900

ttgagaagtt ttttttggac tttgtttagc tttgttgggc gttttttttt ttgatcaata 960

actttgttgg gcttatgatt tgtaatattt tcgtggactc tttagtttat ttagacgtgc 1020

taactttgtt gggcttatga cttgttgtaa catattgtaa cagatgactt gatgtgcgac 1080

taatctttac acattaaaca tagttctgtt ttttgaaagt tcttattttc atttttattt 1140

gaatgttata tatttttcta tatttataat tctagtaaaa ggcaaatttt gcttttaaat 1200

gaaaaaaata tatattccac agtttcacct aatcttatgc atttagcagt acaaattcaa 1260

aaatttccca tttttattca tgaatcatac cattatatat taactaaatc caaggtaaaa 1320

aaaaggtatg aaagctctat agtaagtaaa atataaattc cccataagga aagggccaag 1380

tccaccaggc aagtaaaatg agcaagcacc actccaccat cacacaattt cactcataga 1440

taacgataag attcatggaa ttatcttcca cgtggcatta ttccagcggt tcaagccgat 1500

aagggtctca acacctctcc ttaggccttt gtggccgtta ccaagtaaaa ttaacctcac 1560

acatatccac actcaaaatc caacggtgta gatcctagtc cacttgaatc tcatgtatcc 1620

tagaccctcc gatcactcca aagcttgttc tcattgttgt tatcattata tatagatgac 1680

caaagcacta gaccaaacct cagtcacaca aagagtaaag aagaacaatg gcttcctcta 1740

tgct 1744

<210> 21

<211> 515

<212> DNA

<213> cassava vein mosaic virus promoter (Manihot esculenta)

<400> 21

ccagaaggta attatccaag atgtagcatc aagaatccaa tgtttacggg aaaaactatg 60

gaagtattat gtgagctcag caagaagcag atcaatatgc ggcacatatg caacctatgt 120

tcaaaaatga agaatgtaca gatacaagat cctatactgc cagaatacga agaagaatac 180

gtagaaattg aaaaagaaga accaggcgaa gaaaagaatc ttgaagacgt aagcactgac 240

gacaacaatg aaaagaagaa gataaggtcg gtgattgtga aagagacata gaggacacat 300

gtaaggtgga aaatgtaagg gcggaaagta accttatcac aaaggaatct tatcccccac 360

tacttatcct tttatatttt tccgtgtcat ttttgccctt gagttttcct atataaggaa 420

ccaagttcgg catttgtgaa aacaagaaaa aatttggtgt aagctatttt ctttgaagta 480

ctgaggatac aagttcagag aaatttgtaa gtttg 515

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence-primer 1(Artificial Sequence)

<400> 22

gagggtgttg tggctggtat tg 22

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence-primer 2(Artificial Sequence)

<400> 23

tctcaactgt ccaatcgtaa gcg 23

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence-Probe 1(Artificial Sequence)

<400> 24

cttacgctgg gccctggaag gctag 25

Claims (26)

1. A method for controlling a Trichoplusia agnata insect, which comprises feeding the Trichoplusia agnata insect at least with Cry1A protein, wherein the Cry1A protein is Cry1Ab protein, Cry1A.105 protein or Cry1Ac protein, and the Cry1A protein has an amino acid sequence shown as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9.

2. The method of controlling a helicoverpa zea pest according to claim 1, characterized in that said Cry1A protein is present in a host cell that produces at least said Cry1A protein, and said helicoverpa zea pest is at least in contact with said Cry1A protein by feeding said host cell.

3. A method of controlling a helicoverpa zea insect pest according to claim 2, characterized in that the Cry1A protein is present in a bacterium or transgenic plant that produces at least the Cry1A protein, said helicoverpa zea insect is contacted at least with the Cry1A protein by feeding tissue of said bacterium or transgenic plant, upon contact said helicoverpa zea insect growth is inhibited and/or caused to die, to achieve control of helicoverpa zea damage to the plant.

4. The method of controlling a silver looper pest according to claim 3, wherein the tissue of the transgenic plant is a root, a leaf, a stem, a fruit, a tassel, a female ear, an anther or a filament.

5. The method for controlling a cabbage looper pest as claimed in claim 3 or 4, wherein the plant is soybean, mung bean, cowpea, rape, cabbage, cauliflower, cabbage, radish.

6. The method for controlling the insect pest of the silverworm moth as claimed in claim 3 or 4, wherein the Cry1A protein has the nucleotide sequence shown in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10.

7. The method for controlling the silver looper pest as claimed in claim 5, characterized in that the Cry1A protein has the nucleotide sequence shown by SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10.

8. The method of controlling a helicoverpa zea pest according to any one of claims 3, 4, 7, characterized in that said plant further comprises at least one second nucleotide different from the nucleotide encoding said Cry1A protein.

9. The method of controlling a helicoverpa agnata pest according to claim 8 wherein said second nucleotide encodes a Cry-class insecticidal protein, a Vip-class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

10. A method of controlling a helicoverpa agnata pest according to claim 9 wherein said second nucleotide encodes a Vip3A protein, a Cry2Ab protein or a Cry1Fa protein.

11. The method for controlling a helicoverpa agnata pest as claimed in claim 10, wherein the second nucleotide is encoded by the amino acid sequence shown in SEQ ID No. 11 or SEQ ID No. 13.

12. The method for controlling a helicoverpa agnata pest as claimed in claim 11, wherein the second nucleotide is a nucleotide sequence shown in SEQ ID No. 12 or SEQ ID No. 14.

13. The method of controlling a helicoverpa agnata pest as claimed in claim 8, wherein the second nucleotide is dsRNA that inhibits a gene of interest in the target insect pest.

14. The method of controlling a helicoverpa agnata pest according to claim 6, wherein said plant further comprises at least one second nucleotide that is different from the nucleotide encoding said Cry1A protein.

15. A method of controlling a helicoverpa agnata pest according to claim 14 wherein said second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

16. A method of controlling a helicoverpa agnata pest according to claim 15 wherein said second nucleotide encodes a Vip3A protein, a Cry2Ab protein or a Cry1Fa protein.

17. The method of controlling a helicoverpa agnata pest as claimed in claim 16, wherein the second nucleotide encodes an amino acid sequence having the sequence shown in SEQ ID No. 11 or SEQ ID No. 13.

18. The method for controlling a helicoverpa agnata pest as claimed in claim 17, wherein the second nucleotide has a nucleotide sequence shown as SEQ ID No. 12 or SEQ ID No. 14.

19. The method of controlling a helicoverpa agnata pest as claimed in claim 14, wherein the second nucleotide is dsRNA that inhibits a gene of interest in the target insect pest.

20. The method of controlling a helicoverpa agnata pest according to claim 5, wherein said plant further comprises at least one second nucleotide that is different from the nucleotide encoding said Cry1A protein.

21. The method of controlling a helicoverpa agnata pest according to claim 20 wherein said second nucleotide encodes a Cry class insecticidal protein, a Vip class insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

22. A method of controlling a helicoverpa agnata pest according to claim 21 wherein said second nucleotide encodes a Vip3A protein, a Cry2Ab protein or a Cry1Fa protein.

23. The method of controlling a helicoverpa agnata pest as claimed in claim 22, wherein said second nucleotide encodes an amino acid sequence having the sequence shown in SEQ ID No. 11 or SEQ ID No. 13.

24. The method of controlling a helicoverpa agnata pest as claimed in claim 23, wherein said second nucleotide has the nucleotide sequence shown in SEQ ID No. 12 or SEQ ID No. 14.

25. The method of controlling a helicoverpa agnata pest as claimed in claim 20, wherein the second nucleotide is dsRNA that inhibits a gene of interest in the target insect pest.

26. The application of Cry1A protein to control of Trichoplusia ni pests is characterized in that the Cry1A protein is Cry1Ab protein, Cry1A.105 protein or Cry1Ac protein, and the Cry1A protein is an amino acid sequence shown as SEQ ID NO 1, SEQ ID NO 3, SEQ ID NO 5, SEQ ID NO 7 or SEQ ID NO 9.

Images