CN109804832A - The purposes of insecticidal proteins - Google Patents

Abstract

The present invention relates to a kind of purposes of insecticidal proteins, comprising: at least contacts three-spotted plusia pest with Cry1A albumen.The present invention can kill the Cry1A albumen of three-spotted plusia by generation in plant to control three-spotted plusia pest；Compared with cultural control method, chemical prevention and control method, physical control method and biological control method that the prior art uses; the present invention prevents and treats the protection of the plant progress time of infertility, whole plant the infringement of three-spotted plusia pest; and pollution-free, noresidue; effect stability, thoroughly, simply, conveniently, it is economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, pass through the table in plant more particularly to a kind of Cry1A protein It reaches to control three-spotted plusia and cause harm the purposes of plant.

Background technique

Three-spotted plusia Argyrogramma agnata, belongs to Lepidoptera Noctuidae, be distributed mainly on China Yangtze river basin and Yellow River basin, in China, the main producing region of soybean is one of main Soybean Pests.Three-spotted plusia is polyphagy pest, is mainly caused harm The various crops such as the brassicaceous vegetables such as beans, rape, wild cabbage, cauliflower, Chinese cabbage, radish, harm characteristics are as follows: larva food evil Blade causes to incise and hole influences yield when occurring serious to the greatest extent by blade food.

The cultivated soybean (Glycine max (L.) Merri) is a kind of conduct vegetable oil and the vegetable protein master of grown worldwide The Important Economic crop for wanting source is the important cereal crops of China.Soybean is one of the plant that three-spotted plusia most likes feeding, often Year will cause different degrees of grain loss because of three-spotted plusia, less serious case's underproduction 1-2 at, severe one underproduction 3-4 at.In order to prevent and treat crazing Noctuid, the main method that people generally use have cultural control, chemical prevention, physical control and biological control.

Cultural control is the comprehensive coordination management that entire farmland ecosystem is multifactor, regulation crop, pest, environment because Element creates the farmland ecological environment for being conducive to plant growth and being unfavorable for three-spotted plusia generation.Such as to the last reign of a dynasty in autumn larva More field progress winter ploughing occurs to plough deeply, can directly eliminate partial wintering pupa, cannot then be sprouted wings by buried pupa unearthed, and it is sudden and violent The pupa of open country table can be preyed on or air-dried and dead by natural enemies such as birds again, thus can substantially reduce the insect population in the coming year.Because of agricultural Prevention and treatment is mostly preventive measure, using there is certain limitation, cannot function as emergency measure, is just shown in three-spotted plusia outburst It obtains helpless.

Chemical prevention, that is, chemical control is to kill pest using chemical insecticide, is the weight of three-spotted plusia comprehensive treatment Want component part, it have the characteristics that quickly, conveniently, easy and high economic benefit, especially three-spotted plusia it is big there is a situation where Under, it is essential emergency measure.Chemical prevention and control method is mainly medicine liquid spray at present, before 3 age of three-spotted phytometra larvae There is preferable control efficiency, at this moment Larva is small, and drug resistance is weak, can determine 1-2 age according to the peak period for trapping adult under lamp Larval phase, or the prevention and treatment time is determined according to first instar larvae Damage pattern.Usually select 2.5% decis, 4.5% efficient chlorine cyanogen chrysanthemum Ester, 5% avermectin, 5% 5 percent of hexaflumuron emulsifiable concentrate or 10% imidacloprid wettable powder are made into 1000-1500 times of liquid and spray.Simultaneously Chemical prevention also has its limitation, as improper use frequently can lead to crops generation phytotoxicity, pest develops drug resistance, and kills Hurt natural enemy, pollution environment, make farmland ecosystem by destroy and pesticide residue to the safety of people, animal constitute a threat to etc. it is bad after Fruit.

The physical control mainly reaction according to pest to physical factors various in environmental condition, such as using various physical factors Light, electricity, color, temperature and humidity etc. and mechanical equipment trapped and killed, the methods of steriliation by irradiation carrys out pest control.Net when adult contains hair It flutters or light trap.Using the stronger phototaxis of three-spotted plusia adult, black light lamps adult is set in emergence period, to reduce field Between fall ovum amount and larval density；But black light lamp needs daily the dirt on cleaning optical filter in time, otherwise will affect black light It issues, and then influences insecticidal effect；And higher to the stability requirement of supply voltage, operationally there are also according to eyes of hurting sb.'s feelings It is dangerous；Furthermore the disposably investment for installing lamp is larger.

Biological control is that pest population quantity is controlled using certain beneficial organisms or biological metabolic product, is reduced with reaching Or the purpose of pest is eliminated, the pesticide low to natural enemy toxicity is such as selected, and the difference of phase occurs according to pest and natural enemy field, adjusted Whole spraying time is avoided being administered when natural enemy largely occurs with Protect natural enemies；Secondly, can manually launch rice plant skipper melanoma ichneumon wasp or Spray the preparations such as Dipel SD-5, three-spotted plusia nucleopolyhedrosis virus control three-spotted plusia.Its main feature is that pacifying to people, animal Entirely, environmental pollution is few, and certain pests can reach with the purpose controlled for a long time；But effect is often unstable, no matter and crazing Noctuid occurs weight and is both needed to equally invest progress.

In order to solve the limitation of cultural control, chemical prevention, physical control and biological control in practical applications, science Family find for the anti insect gene of encoding insecticidal proteins to be transferred in plant after study, can get some insect-resistant transgenic plants with Prevent and treat insect pest of the plant.

Cry1A insecticidal proteins are one of numerous insecticidal proteins, are the insoluble companions generated by bacillus thuringiensis Spore crystalline protein.Cry1A albumen uptakes into middle intestines by insect, and toxalbumin parent toxin is dissolved in the alkaline pH ring of insect midgut Under border.The end albumen N- and C- is transformed into active fragment by basic protein enzymic digestion, by parent toxin；Active fragment and insect midgut Receptor combines on epithelial cell membrane upper surface, is inserted into goldbeater's skin, causes cell membrane perforation symptom occur, destroys the infiltration inside and outside cell membrane Saturating buckling and pH balance etc., upset the digestion process of insect, eventually lead to its death.

The plant for being proved to turn Cry1A gene can resist the squamas wings such as corn borer, bollworm, Spodopterafrugiperda (autumn armyworm) The infringement of mesh (Lepidoptera) pest, however, being there is no so far about the transgenic plant by generating expression Cry1A albumen To control the report that three-spotted plusia causes harm to plant.

Summary of the invention

The object of the present invention is to provide a kind of purposes of insecticidal proteins, provide express Cry1A albumen by generating for the first time Transgenic plant control three-spotted plusia to the method for plant hazard, and effectively overcome prior art cultural control, chemistry anti- It controls, the technological deficiencies such as physical control and biological control.

To achieve the above object, the present invention provides a kind of methods for controlling three-spotted plusia pest, including by three-spotted plusia Pest at least contacts with Cry1A albumen.

Further, the Cry1A albumen is present in the host cell at least generating the Cry1A albumen, the silver Autographa spp pest is at least contacted with the Cry1A albumen by the host cell of ingesting.

Further, the Cry1A albumen is present in the bacterium or genetically modified plants at least generating the Cry1A albumen In, the three-spotted plusia pest is at least contacted with the Cry1A albumen by the tissue of the ingest bacterium or genetically modified plants, The three-spotted plusia pest growth is suppressed and/or causes death after contact, to realize the control for endangering three-spotted plusia plant System.

The tissue of the genetically modified plants is root, blade, stalk, fruit, tassel, female fringe, anther or filigree.

The plant is soybean, mung bean, cowpea, rape, wild cabbage, cauliflower, Chinese cabbage, radish.

The genetically modified plants may be at any breeding time.

The control for endangering plant to three-spotted plusia does not change because of the change of planting site and/or implantation time.

The step of before the contact procedure, contains the plant for encoding the polynucleotides of the Cry1A albumen for plantation.

Preferably, the Cry1A albumen is Cry1Ab albumen, Cry1Ac albumen or Cry1A.105 albumen.

It is highly preferred that the Cry1A albumen has SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID Amino acid sequence shown in NO:7 and SEQ ID NO:9.The Cry1A albumen have SEQ ID NO:2, SEQ ID NO:4, Nucleotide sequence shown in SEQ ID NO:6, SEQ ID NO:8 and SEQ ID NO:10.

Based on the above technical solution, the plant can also include at least one different from encoding the Cry1A Second of nucleotide of the nucleotide of albumen.

Further, second of nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease suppression Preparation, agglutinin, alpha-amylase or peroxidase.

In the present invention, a kind of expression of the Cry1A albumen in genetically modified plants can be along with one or more Cry classes The expression of insect-killing protein and/or Vip class insect-killing protein.This is more than a kind of Pesticidal toxins in same strain genetically modified plants Middle co-expression can make plant include and express required gene to realize by genetic engineering.In addition, a kind of plant the (the 1st Parent) Cry1A protein can be expressed by genetic engineering procedure, second of plant (the 2nd parent) can pass through genetic engineering Operation expression Cry class insect-killing protein and/or Vip class insect-killing protein.It is expressed by the 1st parent and the 2nd parents Introduce the progeny plants of all genes of the 1st parent and the 2nd parent.

Preferably, second of nucleotide coding Vip3A albumen, Cry2Ab albumen or Cry1Fa albumen.

It is highly preferred that second of nucleotide coding has amino shown in SEQ ID NO:11, SEQ ID NO:13 Acid sequence.Second of the nucleotide has nucleotide sequence shown in SEQ ID NO:12, SEQ ID NO:14.

Selectively, second of the nucleotide is the dsRNA for inhibiting important gene in target insect pests.

To achieve the above object, the present invention also provides a kind of purposes of Cry1A protein control three-spotted plusia pest.

The present invention also provides a kind of methods of plant for generating control three-spotted plusia pest, including the base to the plant Because introducing the polynucleotide sequence of coding Cry1A albumen in group.

The present invention also provides a kind of methods of propagulum for generating control three-spotted plusia pest, including will be by described The first plant that method obtains hybridizes with the second plant, and/or removes on the plant obtained by the method with fertility Tissue cultivated, thus generate containing coding Cry1A albumen polynucleotide sequence propagulum.

The present invention also provides a kind of methods of the plant of culture control three-spotted plusia pest, comprising:

At least one propagulum is planted, includes the more of coding Cry1A albumen in the genome of the propagulum Nucleotide sequence；

The propagulum is set to grow up to plant；

Make the plant under conditions of artificial infection three-spotted plusia pest and/or three-spotted plusia pest naturally-occurring endanger Growth, harvesting has the plant injury weakened compared with the plant of other polynucleotide sequences for not having coding Cry1A albumen And/or the plant with increased plant products.

Heretofore described " propagulum " includes but is not limited to plant tannins and plant vegetative propagule. The plant tannins include but is not limited to vegetable seeds；The plant vegetative propagule refers to the nutrition organs of plant Or certain particular tissues, new plant can be generated in vitro；The nutrition organs or certain particular tissues include but It is not limited to root, stem and leaf, such as: it include strawberry and sweet potato etc. by the plant of vegetative propagule of root；Using stem as vegetative propagule Plant include sugarcane and potato (stem tuber) etc.；It include aloe and begonia etc. by the plant of vegetative propagule of leaf.

Heretofore described " contact ", which refers to, touches, stops and/or ingests, and specially insect and/or pest touch, stop It stays and/or feeding plant, plant organ, plant tissue or plant cell, the plant, plant organ, plant tissue or plant Cell can also be the plant, plant organ, plant tissue or plant cell either its internal expression insecticidal proteins Surface is with insecticidal proteins and/or with the microorganism for generating insecticidal proteins.

" control " and/or " prevention and treatment " of the present invention refer to that three-spotted plusia pest at least contacts with Cry1A albumen, contact Three-spotted plusia pest growth afterwards is suppressed and/or causes death.Further, three-spotted plusia pest passes through feeding plant tissue It is at least contacted with Cry1A albumen, all or part of three-spotted plusia pest growth is suppressed and/or causes death after contact.Suppression System refers to sub- lethal, i.e., not yet lethal but certain effect that can cause growth and development, behavior, physiology, biochemistry and tissue etc., As growth and development is slow and/or stops.Meanwhile plant should be morphologically normal, and can cultivate under conventional approaches with In the consumption and/or generation of product.In addition, the control three-spotted plusia pest of the polynucleotide sequence containing coding Cry1A albumen Plant and/or propagulum, in the item that artificial infection three-spotted plusia pest and/or three-spotted plusia pest naturally-occurring endanger Under part, there is the plant injury weakened compared with non-transgenic WT lines, specific manifestation includes but is not limited to improve The kernel weight, and/or volume increase etc. of blade resistance, and/or raising.Cry1A albumen is to the " control " and/or " anti-of three-spotted plusia Control " effect is can be self-existent, specifically, the genetically modified plants polynucleotide sequence of Cry1A albumen (contain coding) Any tissue simultaneously and/or asynchronously, exists and/or generates, Cry1A albumen and/or controllable three-spotted plusia pest it is another A kind of substance, then the presence of another substance neither influences Cry1A to " control " and/or " prevention and treatment " work of three-spotted plusia With, it can not cause " control " and/or " prevention and treatment " effect completely and/or part is realized by another substance, and with Cry1A albumen is unrelated.Under normal conditions, in crop field, the process of three-spotted plusia pest feeding plant tissue is of short duration and is difficult to use meat Eye observes, therefore, under conditions of artificial infection three-spotted plusia pest and/or three-spotted plusia pest naturally-occurring endanger, such as The dead three-spotted plusia pest of any tissue presence of genetically modified plants (polynucleotide sequence for containing coding Cry1A albumen), And/or three-spotted plusia pest, and/or have compared with non-transgenic WT lines that growth is suppressed are stopped on it The plant injury of decrease as realizes method and/or purposes of the invention, i.e., by three-spotted plusia pest at least with Cry1A Albumen contact is to realize the method and/or purposes that control three-spotted plusia pest.

RNA interference (RNA interference, RNAi) refer to it is being highly conserved during evolution, by double-stranded RNA (double-stranded RNA, dsRNA) induce, homologous mRNA efficient selective degradation the phenomenon that.Therefore in the present invention RNAi technology specific depletion can be used or close the expression of specific gene in target insect pests, especially and targeted insect The relevant gene of pest growth and development.

Three-spotted plusia at polypide taupe, the long 15-17mm of body, fore wing dark brown has 2 silver color bands, and center has 1 Silvery white color triangle patch and one are like horseshoe-shaped silver-colored edge margin spot.Hind wing crineous, there is metallic luster.The chest back side has two clumps Hold up longer sepia palea.Ovum is hemispherical, long 0.4-0.5mm, and milky when primiparity, is afterwards pistac, chorion table Mask reticulate pattern.Larvae underwent 5 instars, mature larva 25-32mm, body light green is front fine and rear thick, and body back has longitudinal thin white threads 6, Spiracle line black, the 1st, 2 pair of abdominal foot are degenerated, and when walking is in Qu Shenzhuan.The long 18-20mm of pupa, body is thinner, and early period, the outside of belly was green, after Phase entirety dark brown, 1,2 throttle bore of abdomen obviously protrude, and anal spine is a pair of, have thin cocoon.

Three-spotted plusia is widely distributed in China, is distributed mainly on the Yangtze river basin and Yellow River basin.Three-spotted plusia is in various regions year Generation is different, and 2-3 generation, Hebei, Jiangsu about 3-4 generation, Hunan, Hubei about 5-6 generation, 7 generation of Guangzhou occurs in Ningxia year.The worm It is overwintering with pupa.April in next year, visible adult eclosion, entered spawning period through 4-5 days after emergence.Ovum dissipates more originates in blade back.2-3 generation At most, adult is hidden by day and come out at night, and has phototaxis and chemotaxis for oviposition.Newly hatched larvae mostly in blade back feeding mesophyll, leaves epidermis, 3 ages Feeding tender leaf is at hole afterwards, and appetite increases.Larvae underwent 5 instars have seemingly-dead property, can crispatura and fall on the ground after frightened.At room temperature, larva Phase 10 days or so.Mature larva spits white silk and do cocoon in host's blade back pupates.Occur by the end of November to still visible adult at the beginning of 12 months.Crazing The degree that causes harm of noctuid is mainly influenced by worm sources cardinal sum temperature and humidity, and summer higher humidity and lower temperature are conducive to it Occur, but rain in torrents in ovum phase and first instar larvae phase, is then unfavorable for occurring.

In categorizing system, generally mainly according to morphological features such as the types of the nervuration of adult wing, linkage mode and feeler, Lepidoptera is divided into suborder, Superfamily, section etc..And Noctuidae is the most abundant section of type in Lepidoptera, the whole world has found 20,000 kinds More than, only China's record just has thousands of.Most of noctuid is the pest of crops, leaf, moth bell etc. can be eaten, such as cotton Earworm, prodenia litura etc..Although bollworm, prodenia litura etc. and three-spotted plusia belong to Lepidoptera Noctuidae, in addition to classifying There are similitudes in standard, then there is huge difference on other morphosis；Like the strawberry in plant as apple (belonging to Rosales rosaceae), they have a colored both sexes, radiation symmetric, the features such as 5, petal, but its fruit and plant Form is multifarious.But because of the less contact insect of people, especially less contact agricultural pests, on Morphology of entomology Difference less focuses on, and people is made to think that the form of insect is similar.And in fact, three-spotted plusia is either from larviform From the point of view of in state or adult form, all there is its unique feature.Such as Spodoptera litura larvae head dark brown, chest is changeable, Have from khaki to blackish green；For prodenia litura at polypide crineous, there are white feathering, fore wing taupe, decorative pattern in the chest back side It is more.And the three-spotted phytometra larvae of Noctuidae is belonged in light green；For three-spotted plusia at polypide taupe, the chest back side has two clumps to erect Longer sepia palea is played, fore wing dark brown has silvery white speckle.

Belonging to the insect of Noctuidae, not only there are larger differences in morphological feature, while on feeding habit, there is also Difference.Such as be all the bollworm of Noctuidae and caused harm the cotton boll or corn tassel of cotton with brill moth type, prodenia litura more biasing Be better than bite blade, only stay master pulse, and its host range is extremely wide, in addition to corn and soybean, can also endanger including melon, eggplant, Beans, green onion, leek, spinach and brassicaceous vegetable, grain, 100 section of industrial crops Deng Jin, 300 various plants, and three-spotted plusia Host range is relatively concentrated on brassicaceous vegetable and legume crop, and mainly food leaf harm.The difference of feeding habit, Imply enzyme caused by internal digestive system and receptor protein difference.And the enzyme generated in alimentary canal is that Bt gene works Key point, the enzyme or receptor protein that can only combine with specific b t gene are possible to so that some Bt gene pairs should Pest has insect resistant effect.More and more researches show that not equal with mesh, even equal insect not of the same race is to Bt egg of the same race White sensitive sex expression is different.Such as Cry1Ab albumen is entirely different to the effect of four kinds of noctuidae pests, to bollworm Helicoverpa armigera resistance is preferable, but can almost be classified as not imitating to beet armyworm Spodoptera exigua Fruit, prodenia litura Spodoptera litura and black cutworm Agrotis ipsilon absolutely not show activity.It is above-mentioned Several pests belong to Lepidoptera Noctuidae, but Bt albumen of the same race shows different resistances to these types of noctuidae pests and imitates Fruit.This has absolutely proved that the interaction mode of Bt albumen and enzyme in insect bodies and receptor is complicated and is difficult to expect.

The genome of heretofore described plant, plant tissue or plant cell, refers to plant, plant tissue or plant Intracellular any inhereditary material, and including nucleus and plastid and mitochondrial genomes.

Heretofore described polynucleotides and/or nucleotide form complete " gene ", encode in required host cell Protein or polypeptide.Those skilled in the art are it is readily appreciated that polynucleotides and/or nucleotide of the invention can be placed in Under regulating and controlling sequence control in purpose host.

Well-known to those skilled in the art, DNA typically exists with double-stranded form.In this arrangement, chain with Another chain complementation, vice versa.Other complementary strands of DNA are produced since DNA is replicated in plant.In this way, packet of the present invention Include the use to polynucleotides exemplary in sequence table and its complementary strand." coding strand " that this field is often used refers to be chained with antisense The chain of conjunction.In order to express protein in vivo, a chain of DNA is transcribed into the complementary strand of a mRNA by typical case, it is as mould Plate translates protein.MRNA is actually to transcribe from " antisense " chain of DNA." ariyoshi " or " coding " chain has a series of passwords Son (codon is three nucleotide, and primary reading three can produce specific amino acids), can be used as open reading frame (ORF) and reads It reads to form target protein or peptide.The invention also includes the RNA for having suitable function with exemplary DNA.

Nucleic acid molecule of the present invention or its segment under strict conditions with Cry1A gene recombination of the present invention.It is any conventional Nucleic acid hybridization or amplification method may be used to identify the presence of Cry1A gene of the present invention.Nucleic acid molecules or its segment are certain In the case of can with other nucleic acid molecules carry out specific hybrid.In the present invention, if two nucleic acid molecules can be formed it is antiparallel Double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out specific hybrid to each other.If two nucleic acid point Son shows complete complementarity, then claiming one of nucleic acid molecules is another nucleic acid molecules " complement ".In the present invention, When each nucleotide and the corresponding nucleotide mutual added time of another nucleic acid molecules of a nucleic acid molecules, then claim the two cores Acid molecule shows " complete complementarity ".If two nucleic acid molecules can be with enough stability phase mutual crosses to make them It anneals and is bonded to each other under the conditions of at least conventional " low stringent ", then the two nucleic acid molecules are referred to as that " minimum level is mutual It mends ".Similarly, if two nucleic acid molecules can be with enough stability phase mutual crosses to make them in conventional " height It anneals and is bonded to each other under the conditions of strictly ", then claim the two nucleic acid molecules that there is " complementarity ".Deviateing from complete complementarity is It can permit, as long as this deviation not exclusively prevents two molecules from forming duplex structure.In order to enable a nucleic acid molecules As primer or probe, it is only necessary to it is adequately complementary to guarantee that it has in sequence so that in used specific solvent and Stable duplex structure can be formed under salinity.

In the present invention, substantially homologous sequence is one section of nucleic acid molecules, which can under high stringency Specific hybrid occurs with the complementary strand of another section of nucleic acid molecules to match.Promote the suitable stringent condition of DNA hybridization, example Such as, it is about handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC), then with 2.0 × SSC under the conditions of 50 DEG C Washing, these conditions are well known to those skilled in the art.For example, the salinity in washing step can be selected from low tight About 2.0 × SSC of glazing bar part, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C.In addition, the temperature in washing step Condition can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature condition and salt are dense Degree can all change, can also one of them remain unchanged and another variable changes.Preferably, of the present invention Stringent condition can in 6 × SSC, 0.5%SDS solution, at 65 DEG C with SEQ ID NO:2, SEQ ID NO:4, SEQ ID Specific hybrid occurs for NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, then with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS are respectively washed film 1 time.

Therefore, have anti-insect activity and under strict conditions with SEQ ID NO:2 of the present invention, SEQ ID NO:4, SEQ ID The sequence that NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14 hybridize is included in the present invention In.These sequences and sequence of the present invention at least about 40%-50% are homologous, and about 60%, 65% or 70% are homologous, even at least About 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or bigger Sequence homology.

Heretofore described gene and protein not only includes specific exemplary sequence, further include save it is described specific (including compared with full length protein and/or end lacks for the part of the insecticidal activity feature of exemplary protein and/segment Lose), variant, mutant, the substituent protein of amino acid (have substitution), chimera and fusion protein." variant " or " become It is different " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity." equivalent protein " refers to There is the albumen of the bioactivity of identical or essentially identical anti-three-spotted plusia pest with the albumen of claim.

The original DNA or egg that " segment " or " truncation " of heretofore described DNA molecular or protein sequence refers to A part of Bai Xulie (nucleotide or amino acid) or its artificial reconstructed form (such as the sequence for being suitble to plant expression), aforementioned sequence Variation may be present in the length of column, but length is enough to ensure that (coding) protein is insect toxins.

Gene variant can be constructed with modifier and readily using standard technique.For example, it is well known that manufacture point The technology of mutation.In another example U.S. Patent number 5605793, which describes to reassembly after random fracture using DNA, generates other molecules Multifarious method.The segment of commercialization endonuclease manufacture full-length gene can be used, and can be according to standardization program Use exonuclease.It is, for example, possible to use enzyme such as Bal31 or direct mutagenesis to cut off core from the end systems of these genes Thuja acid.A variety of restriction enzymes can also be used to obtain the gene of encoding active segment.Protease can be used to directly obtain The active fragment of these toxin.

The present invention can derive equivalent protein from Bt isolate and/or DNA library and/or encode these equivalent proteins Gene.Insecticidal proteins of the invention are obtained there are many method.It is, for example, possible to use the desinsection eggs that the present invention discloses and claims White antibody is identified and isolated from other albumen from protein mixture.Particularly, antibody may be by albumen it is most constant and and its Caused by its most different protein part of Bt albumen.May then pass through immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or Western immunoblot method exclusively identifies the equivalent protein for having activity characteristic using these antibody.This field standard journey can be used Sequence readily prepares the antibody of albumen or equivalent protein disclosed in the present invention or the segment of this albuminoid.It then can be from micro- life The gene for encoding these albumen is obtained in object.

Due to the Feng Yuxing of genetic codon, a variety of different DNA sequence dnas can encode identical amino acid sequence.It generates These encode the alternative DNA sequence dna of identical or essentially identical albumen just in the technical level of those skilled in the art.This A little different DNA sequence dnas are included within the scope of the invention." substantially the same " sequence, which refers to, to be had amino acid substitution, lacks The sequence for losing, adding or being inserted into but do not influence substantially insecticidal activity also includes the segment for retaining insecticidal activity.

Replacing, missing or adding for amino acid sequence is the ordinary skill in the art in the present invention, preferably this amino acid Variation are as follows: small characteristic changing, i.e., the folding and/or active conserved amino acid for not significantly affecting albumen replace；Small missing, The missing of normally about 1-30 amino acid；Small amino or c-terminus extend, such as aminoterminal extends a methionine residues； Small link peptide, for example, about 20-25 residue are long.

The example of conservative substitution is the substitution occurred in following amino acid group: basic amino acid (such as arginine, lysine And histidine), it is acidic amino acid (such as glutamic acid and aspartic acid), polar amino acid (such as glutamine, asparagine), hydrophobic Acidic amino acid (such as leucine, isoleucine and valine), ArAA (such as phenylalanine, tryptophan and tyrosine), with And small molecule amino acid (such as glycine, alanine, serine, threonine and methionine).Do not change given activity usually Those amino acid substitutions are well-known in the art, and by for example, N.Neurath and R.L.Hill are 1979 It is described in " Protein " published by year new york academic publishing house (AcademicPress).The most common exchange has Ala/ Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and their opposite exchanges.

For a person skilled in the art it should be evident that this substitution can play an important role to molecular function Region except occur, and still generate active peptides.For by polypeptide of the invention, activity is required and therefore selects not Substituted amino acid residue can reflect according to methods known in the art, such as direct mutagenesis or alanine scanning mutagenesis Determine (such as referring to Cunningham and Wells, 1989, Science244:1081-1085).Latter technique is each in the molecule At a positively charged residue introduce mutation, detection gained mutating molecule anti-insect activity, so that it is determined that the molecular activity and It overstates the amino acid residue wanted.Substrate-enzyme interacting site can also be measured by the analysis of its three-dimensional structure, and this three Dimension structure can be measured by technologies such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, such as deVos, 1992, Science255:306-312；Smith etc., 1992, J.Mol.Biol224:899-904；Wlodaver etc., 1992, FEBSLetters309:59-64).

In the present invention, Cry1A albumen include but is not limited to Cry1Ab, Cry1Ac albumen or Cry1A.105, Huo Zheyu SEQ ID NO:1、SEQ ID NO:3、SEQ ID NO:5、SEQ ID NO:7、SEQ ID NO:9、SEQ ID NO:11、SEQ Amino acid sequence shown in ID NO:13 has certain homology.These sequences and sequence similarities of the present invention/phase same sex are typical Be greater than 78%, preferably greater than 85%, more preferably greater than 90%, be even more preferably greater than 95%, and can be greater than 99%.Can also according to particularly the phase same sex and/or similarity range define preferred polynucleotides and albumen of the invention Matter.Such as have 78% with the exemplary sequence of the present invention, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, the 98% or 99% phase same sex and/or similar Property.

In the present invention, the genetically modified plants for generating the Cry1A albumen include but is not limited to that MON87701 transgenosis is big Beans event and/or vegetable material (as described in the CN101861392B) comprising MON87701 transgenic soybean event, MON87751 transgenic soybean event and/or vegetable material comprising MON87751 transgenic soybean event (such as exist Described in CN105531376A), DAS81419 (9582.814.19.1) transgenic soybean event and/or include DAS81419 (9582.814.19.1) transgenic soybean event vegetable material (such as in CN103826444A, CN103826445A and/or Described in CN103827132B), 9582.816.15.1 transgenic soybean event and/or include 9582.816.15.1 transgenosis The vegetable material (as described in the CN104583404A and/or CN104718293A) of soybean event, may be implemented this The method and/or purposes of invention are at least contacted by three-spotted plusia pest with Cry1A albumen to realize control three-spotted plusia evil The method and/or purposes of worm.It is understood by one of ordinary skill in the art, make the Cry1A albumen in above-mentioned transgenic event in difference It is expressed in plant and is also able to achieve method and/or purposes of the invention.It is at least generated more specifically, the Cry1A albumen is present in In the genetically modified plants of the Cry1A albumen, the three-spotted plusia pest by the tissues of the genetically modified plants that ingest at least It is contacted with the Cry1A albumen, the three-spotted plusia pest growth is suppressed and/or causes death after contact, with realization pair Three-spotted plusia endangers the control of plant.

Heretofore described regulating and controlling sequence include but is not limited to promoter, transit peptides, terminator, enhancer, leader sequence, Introne and other adjusting sequences for being operably connected to the Cry1A albumen.

The promoter is effable promoter in plant, and " the effable promoter in plant " refers to and ensure The promoter that coded sequence connected to it is expressed in plant cell.Effable promoter can be composing type in plant Promoter.The example for instructing the promoter of constitutive expression in plant includes but is not limited to, from cauliflower mosaic virus 35S promoter, arabidopsis Ubi10 promoter, corn Ubi promoter, promoter of rice GOS2 gene etc..Alternatively, plant In effable promoter can be organizing specific promoter, i.e., the promoter is in some tissues of plant such as in chlorenchyma The middle expression for instructing coded sequence is higher than its hetero-organization (can test and be measured by conventional RNA) of plant, such as PEP carboxylic Change enzyme promoters.Alternatively, effable promoter can be wound-induced promoter in plant.Wound-induced promoter or guidance When the promoter of the expression pattern of wound-induced refers to the wound caused by plant is subjected to machinery or is gnawed by insect, promoter tune The expression of coded sequence under control under the conditions of normal growth compared with being significantly increased.The example of wound-induced promoter includes but unlimited In the starting of protease suppressor (pin I and the pin II) and zein enzyme suppressor (MPI) of potato and tomato Son.

The transit peptides (also known as secretory signal sequence or targeting sequencing) are to instruct transgene product to specific organelle Or cellular compartment, for receptor protein, the transit peptides can be it is heterologous, for example, utilizing encoding chloroplast transit peptide Sequence targets chloroplaset, perhaps utilizes ' KDEL ' to retain sequence targeting endoplasmic reticulum or utilizes barley plants agglutinin gene CTPP targets vacuole.

The leader sequence is including but not limited to picornavirus leader sequence, such as EMCV leader sequence (encephalomyo-carditis disease Malicious 5 ' noncoding regions)；Potyvirus leaders, such as MDMV (Maize Dwarf Mosaic Virus) leader sequence；Human immunity Globular protein heavy-chain binding protein matter (BiP)；The coat protein mRNA's of alfalfa mosaic virus does not translate leader sequence (AMV RNA4)；Tobacco mosaic virus (TMV) (TMV) leader sequence.

The enhancer is including but not limited to cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) increase Hadron, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), duck plantar Straw colour mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, the introne is including but not limited to corn hsp70 introne, corn are general Plain introne, Adh introne 1, crose synthase intron or rice Act1 introne.For dicotyledon application, institute Introne is stated including but not limited to CAT-1 introne, pKANNIBAL introne, PIV2 introne and " super ubiquitin " include Son.

The terminator can be the suitable polyadenylation signal sequence to work in plant, including but unlimited In from the Polyadenylation of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Signal sequence, derives from pea at the polyadenylation signal sequence for deriving from protease-inhibitor Ⅱ (pin II) gene The polyadenylation signal sequence of ssRUBISCO E9 gene and the poly for deriving from alpha-tubulin (α-tubulin) gene Polyadenylation signal sequence.

Heretofore described " effectively connection " indicates the connection of nucleic acid sequence, described to be coupled so that a sequence can provide pair The function of being needed for linked sequence.Described in the present invention " effectively connection " can be by promoter and interested sequence phase Even, so that the transcription of the interested sequence is controlled and regulates and controls by the promoter.When interested sequential coding albumen and " effectively connection " indicates when going for the expression of the albumen: promoter is connected with the sequence, and connected mode to obtain Transcript efficient translation.If promoter and the connection of coded sequence are that transcript merges and wants to realize the albumen of coding Expression when, such connection is manufactured, so that the first translation initiation codon is the starting of coded sequence in obtained transcript Codon.Alternatively, if it is the table for the albumen that realization coding was merged and wanted in translation that promoter is with the connection of coded sequence Up to when, manufacture such connection so that the first translation initiation codon contained in 5 ' non-translated sequences is connected with promoter, And the relationship of the translation opening code-reading frame for the albumen that the translation product that connection type makes and coding are wanted is to meet reading Code frame.The nucleic acid sequence that " can effectively connect " includes but is not limited to: providing sequence (the i.e. gene expression of gene expression function Element, for example, promoter, 5 ' untranslated regions, introne, protein encoding regions, 3 ' untranslated regions, poly- putative adenylylation site and/ Or transcription terminator), provide DNA transfer and/or integration function sequence (i.e. T-DNA border sequence, locus specificity recombinase Recognition site integrates enzyme recognition site), provide selectivity function sequence (i.e. antibiotic resistance markers, biosynthesis base Cause), provide can score marker function sequence, in vitro or in vivo assist series of operations sequence (i.e. polylinker sequence, site Specific recombination sites) and provide copy function sequence (i.e. replication orgin, autonomously replicating sequence, the centromeric sequence of bacterium).

Heretofore described " desinsection " or " pest-resistant " refers to crop pests it is toxic, to realize " control " And/or " prevention and treatment " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to kill crop pests.More specifically, mesh Marking insect is three-spotted plusia pest.

Cry1A albumen has toxicity to three-spotted plusia pest in the present invention.Plant in the present invention, especially soybean, Contain exogenous DNA in its genome, the exogenous DNA includes the nucleotide sequence of coding Cry1A albumen, and three-spotted plusia pest is logical It crosses feeding plant tissue to contact with the albumen, the growth of three-spotted plusia pest is suppressed and/or causes death after contact.Inhibition is Refer to lethal or sub- lethal.Meanwhile plant should be morphologically normal, and can cultivate under conventional approaches with disappearing for product Consumption and/or generation.In addition, the plant can substantially eliminate needs (chemistry or the Biocidal to chemistry or biological insecticides Agent for the three-spotted plusia pest targeted for Cry1A albumen insecticide).

In vegetable material the expression of insecticidal crystal protein (ICP) can by described a variety of methods in the art into Row detection, such as quantified by the mRNA of the coded insect-killing protein generated in application primer pair tissue, or directly The amount for the insect-killing protein that specific detection generates.

It can be using the insecticidal effect of ICP in different test measurement plants.Targeted insect is mainly crazing in the present invention Noctuid.

In the present invention, the Cry1A albumen can have SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ Amino acid sequence shown in ID NO:7 or SEQ ID NO:9.It also may include other other than the code area comprising Cry1A albumen Element, such as the protein of encoding selection markers.

In addition, the expression cassette comprising the nucleotide sequence for encoding Cry1A albumen of the present invention in plant can also at least A kind of protein of encoding herbicide resistance gene is expressed together, and the herbicide resistance gene includes but is not limited to glufosinate-ammonium Resistant gene (such as bar gene, pat gene), phenmedipham resistant gene (such as pmph gene), Glyphosate resistance gene (such as EPSPS Gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of herbicide Dalapon, to ammonia The resistant gene of the resistant gene or glutamine synthetase inhibitor (such as PPT) of nitrile, thus obtain both have high insecticidal activity, Again with the genetically modified plants of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, the gene of Cry1A albumen or expression cassette or recombination as described in will encode Vector introduction plant cell, conventional method for transformation include but is not limited to that Agrobacterium-medialed transformation, micro transmitting bombard, are straight It connects and DNA is taken in into the DNA importing that protoplast, electroporation or silicon whisker mediate.

The present invention provides a kind of purposes of insecticidal proteins, have the advantage that

1, internal cause prevents and treats.The prior art is mainly that the harm of three-spotted plusia pest is controlled by external action, that is, external cause, Such as cultural control, chemical prevention, physical control and biological control；And the present invention is can to kill crazing by generating in plant The Cry1A albumen of noctuid controls three-spotted plusia pest, i.e., is prevented and treated by internal cause.

2, pollution-free, noresidue.Although the chemical prevention and control method that the prior art uses is to the danger of control three-spotted plusia pest Evil plays certain effect, but also brings pollution, destruction and residual to people, animal and farmland ecosystem simultaneously；Use this hair The method of bright control three-spotted plusia pest, can eliminate above-mentioned adverse consequences.

3, the time of infertility prevents and treats.The method for the control three-spotted plusia pest that the prior art uses all is interim, and this Invention is that the protection in the time of infertility is carried out to plant, and genetically modified plants (Cry1A albumen) are from germination, growth, until blooming, tying Fruit can avoid the infringement by three-spotted plusia.

4, whole plant is prevented and treated.The method for the control three-spotted plusia pest that the prior art uses is locality mostly, such as leaf Face sprays；And the present invention is protected to entire plant, such as the root, blade, stalk, fruit of genetically modified plants (Cry1A albumen) Reality, tassel, female fringe, anther or filigree etc. can all resist three-spotted plusia infringement.

5, effect stability.The either cultural control method or physical control method that the prior art uses require to utilize Environmental condition prevents and treats pest, and variable factor is more；The present invention is to make Cry1A albumen carry out table in plant It reaches, effectively overcomes the unstable defect of environmental condition, and the control efficiency of genetically modified plants of the present invention (Cry1A albumen) exists Different location, different time, different genetic backgrounds are also all stable and consistents.

6, simple, conveniently, it is economical.The disposably investment for the frequency ventilating type insecticidal lamp that the prior art uses is larger, and operates not When there are also the danger that electric shock is hurted sb.'s feelings；The present invention need to only plant the genetically modified plants that can express Cry1A albumen, without Using other measures, to save a large amount of human and material resources and financial resources.

7, effect is thorough.The prior art use control three-spotted plusia pest method, effect be it is halfway, only rise It is acted on to mitigation；And genetically modified plants (Cry1A albumen) of the present invention are almost hundred to the control efficiency of three-spotted plusia newly hatched larvae / hundred, extremely survival larva also substantially stops development individually, and larva is all significantly to send out substantially still in just state is incubated after 3 days It educates bad, and has stopped developing, can not survive in the natural environment of field, and genetically modified plants are generally only by slight damage.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Detailed description of the invention

Fig. 1 is the recombinant cloning vector DBN01-T structure containing Cry1A nucleotide sequence of the purposes of insecticidal proteins of the present invention Build flow chart；

Fig. 2 is the soybean recombinant expression carrier containing Cry1A nucleotide sequence of the purposes of insecticidal proteins of the present invention DBN100125 constructs flow chart.

Specific embodiment

The technical solution of the purposes of insecticidal proteins of the present invention is further illustrated below by specific embodiment.

The acquisition and synthesis of first embodiment, gene

1, nucleotide sequence is obtained

The amino acid sequence (818 amino acid) of Cry1Ab-01 insect-killing protein, such as SEQ ID NO:1 institute in sequence table Show；Coding corresponds to Cry1Ab-01 nucleotide sequence (2457 of the amino acid sequence of the Cry1Ab-01 insect-killing protein Nucleotide), as shown in SEQ ID NO:2 in sequence table.Amino acid sequence (615 amino of Cry1Ab-02 insect-killing protein Acid), as shown in SEQ ID NO:3 in sequence table；Coding corresponds to the amino acid sequence of the Cry1Ab-02 insect-killing protein Cry1Ab-02 nucleotide sequence (1848 nucleotide), as shown in SEQ ID NO:4 in sequence table.

The amino acid sequence (1178 amino acid) of Cry1Ac-01 insect-killing protein, such as SEQ ID NO:5 institute in sequence table Show；Coding corresponds to Cry1Ac-01 nucleotide sequence (3537 of the amino acid sequence of the Cry1Ac-01 insect-killing protein Nucleotide), as shown in SEQ ID NO:6 in sequence table.Amino acid sequence (1156 amino of Cry1Ac-02 insect-killing protein Acid), as shown in SEQ ID NO:7 in sequence table；Coding corresponds to the amino acid sequence of the Cry1Ac-02 insect-killing protein Cry1Ac-02 nucleotide sequence (3471 nucleotide), as shown in SEQ ID NO:8 in sequence table.

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing protein, such as SEQ ID NO:9 institute in sequence table Show；Coding corresponds to Cry1A.105 nucleotide sequence (3534 of the amino acid sequence of the Cry1A.105 insect-killing protein Nucleotide), as shown in SEQ ID NO:10 in sequence table.

The amino acid sequence (634 amino acid) of Cry2Ab insect-killing protein, as shown in SEQ ID NO:11 in sequence table； Coding corresponds to the Cry2Ab nucleotide sequence (1905 nucleotide) of the amino acid sequence of the Cry2Ab insect-killing protein, such as In sequence table shown in SEQ ID NO:12.

The amino acid sequence (1148 amino acid) of Cry1Fa insect-killing protein, such as SEQ ID NO:13 institute in sequence table Show；Cry1Fa nucleotide sequence (3447 nucleosides of the coding corresponding to the amino acid sequence of the Cry1Fa insect-killing protein Acid), as shown in SEQ ID NO:14 in sequence table.

2, above-mentioned nucleotide sequence is synthesized

Synthesize the Cry1Ab-01 nucleotide sequence (as shown in SEQ ID NO:2 in sequence table), the Cry1Ab-02 Nucleotide sequence (as shown in SEQ ID NO:4 in sequence table), the Cry1Ac-01 nucleotide sequence (SEQ in such as sequence table Shown in ID NO:6), the Cry1Ac-02 nucleotide sequence (as shown in SEQ ID NO:8 in sequence table), the Cry1A.105 Nucleotide sequence (as shown in SEQ ID NO:10 in sequence table), the Cry2Ab nucleotide sequence (SEQ ID in such as sequence table Shown in NO:12), the Cry1Fa nucleotide sequence (as shown in SEQ ID NO:14 in sequence table).The Cry1Ab- of synthesis 5 ' ends of 01 nucleotide sequence (SEQ ID NO:2) are also connected with Spe I restriction enzyme site, the Cry1Ab-01 nucleotide sequence 3 ' the ends of (SEQ ID NO:2) are also connected with BamH I restriction enzyme site；Cry1Ab-02 nucleotide sequence (the SEQ of synthesis ID NO:4) 5 ' ends be also connected with Kas I restriction enzyme site, the 3 ' of the Cry1Ab-02 nucleotide sequence (SEQ ID NO:4) End is also connected with BamH I restriction enzyme site；5 ' ends of the Cry1Ac-01 nucleotide sequence (SEQ ID NO:6) of synthesis also connect It is connected to BamH I restriction enzyme site, 3 ' ends of the Cry1Ac-01 nucleotide sequence (SEQ ID NO:6) are also connected with Kas I enzyme Enzyme site；5 ' ends of the Cry1Ac-02 nucleotide sequence (SEQ ID NO:8) of synthesis are also connected with BamH I digestion position 3 ' ends of point, the Cry1Ac-02 nucleotide sequence (SEQ ID NO:8) are also connected with Spe I restriction enzyme site；What is synthesized is described 5 ' ends of Cry1A.105 nucleotide sequence (SEQ ID NO:10) are also connected with Nco I restriction enzyme site, the Cry1A.105 core 3 ' ends of nucleotide sequence (SEQ ID NO:10) are also connected with Hind III digestion site；The Cry2Ab nucleotides sequence of synthesis 5 ' ends of column (SEQ ID NO:12) are also connected with Nco I restriction enzyme site, the Cry2Ab nucleotide sequence (SEQ ID NO: 12) 3 ' ends are also connected with Spe I restriction enzyme site；5 ' ends of the Cry1Fa nucleotide sequence (SEQ ID NO:14) of synthesis It is also connected with Asc I restriction enzyme site, 3 ' ends of the Cry1Fa nucleotide sequence (SEQ ID NO:14) are also connected with BamH I Restriction enzyme site.

Second embodiment, the building of recombinant expression carrier and recombinant expression carrier convert Agrobacterium

1, the recombinant cloning vector containing Cry1A gene is constructed

By the Cry1Ab-01 nucleotide sequence of synthesis be connected into cloning vector pGEM-T (Promega, Madison, USA, CAT:A3600 on), operating procedure is carried out by Promega Products pGEM-T carrier specification, obtains recombinant cloning vector DBN01-T, (wherein, Amp indicates ampicillin resistance gene to building process as shown in Figure 1；Fiori indicates bacteriophage f1 Replication orgin；LacZ is LacZ initiation codon；SP6 is SP6RNA polymerase promoter；T7 is t7 rna polymerase starting Son；Cry1Ab-01 is Cry1Ab-01 nucleotide sequence (SEQ ID NO:2)；MCS is multiple cloning sites).

Then by recombinant cloning vector DBN01-T with heat shock method convert Escherichia coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), hot shock condition are as follows: 50 μ L Escherichia coli T1 competent cells, 10 μ L Plasmid DNA (weight Group cloning vector DBN01-T), 42 DEG C of water-bath 30s；37 DEG C of shaken cultivation 1h (shaking table shakes under 100rpm revolving speed), apply on surface There is the ammonia benzyl of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro- 3- indoles-β-D- galactoside of the bromo- 4- of 5-) green (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L are used the LB plate of mycin (100mg/L) NaOH tune pH to growth on 7.5) overnight.Picking white colony, in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation. Its plasmid of alkalinity extraction: being centrifuged 1min under 12000rpm revolving speed for bacterium solution, removes supernatant, and precipitating thallus is pre-chilled with 100 μ L ice Solution I (25mM Tris-HCl, 10mM EDTA (ethylenediamine tetra-acetic acid), 50mM glucose, pH8.0) suspend；200 μ L are added The solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) newly prepared, pipe is overturned 4 times, and 3- on ice is set in mixing 5min；The ice-cold solution III of 150 μ L (3M potassium acetate, 5M acetic acid) is added, mixes well immediately, places 5-10min on ice；In It is centrifuged 5min under the conditions of 4 DEG C of temperature, revolving speed 12000rpm, 2 times of volume dehydrated alcohols are added in supernatant, room temperature is put after mixing Set 5min；It is centrifuged 5min under the conditions of 4 DEG C of temperature, revolving speed 12000rpm, abandons supernatant, precipitating is 70% with concentration (V/V) It is dried after ethanol washing；TE (10mM Tris-HCl, 1mM EDTA, pH8.0) of the 30 μ L containing RNase (20 μ g/ml) is added to dissolve Precipitating；The water-bath 30min at 37 DEG C of temperature digests RNA；It is saved backup in -20 DEG C of temperature.

The plasmid of extraction carries out sequence verification after Spe I and BamH I digestion identification, to positive colony, the results showed that weight The Cry1Ab-01 nucleotides sequence being inserted into group cloning vector DBN01-T is classified as core shown in SEQ ID NO:2 in sequence table Nucleotide sequence, i.e. Cry1Ab-01 nucleotide sequence are correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, by the Cry1Ab-02 nucleotide sequence of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN02-T, wherein Cry1Ab-02 is Cry1Ab-02 nucleotide Sequence (SEQ ID NO:4).Cry1Ab-02 nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN02-T It is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, by the Cry1Ac-01 nucleotide sequence of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN03-T, wherein Cry1Ac-01 is Cry1Ac-01 nucleotide Sequence (SEQ ID NO:6).Cry1Ac-01 nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN03-T It is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, by the Cry1Ac-02 nucleotide sequence of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN04-T, wherein Cry1Ac-02 is Cry1Ac-02 nucleotide Sequence (SEQ ID NO:8).Cry1Ac-02 nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN04-T It is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, by the Cry1A.105 nucleotide sequence of synthesis It is connected on cloning vector pGEM-T, obtains recombinant cloning vector DBN05-T, wherein Cry1A.105 is Cry1A.105 nucleotide Sequence (SEQ ID NO:10).Cry1A.105 nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN05-T It is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, the Cry2Ab nucleotide sequence of synthesis is connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN06-T, wherein Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO:12).Cry2Ab nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN06-T is correctly inserted into.

According to the method for above-mentioned building recombinant cloning vector DBN01-T, the Cry1Fa nucleotide sequence of synthesis is connected Enter on cloning vector pGEM-T, obtain recombinant cloning vector DBN07-T, wherein Cry1Fa is Cry1Fa nucleotide sequence (SEQ ID NO:14).Cry1Fa nucleotide sequence described in digestion and sequence verification recombinant cloning vector DBN07-T is correctly inserted into.

2, the soybean recombinant expression carrier containing Cry1A gene is constructed

Digestion recombinant cloning vector DBN01-T and expression vector are distinguished with restriction enzyme Spe I and BamH I DBNBC-01 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the Cry1Ab-01 nucleotides sequence that will be cut Column-slice section is inserted between Spe I and the BamH I site of expression vector DBNBC-01, utilizes conventional enzymatic cleavage methods carrier construction Be it is well-known to those skilled in the art, be built into recombinant expression carrier DBN100125, building process as shown in Figure 2 (Kan: Kanamycin gene；RB: right margin；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO: 15)；Cry1Ab-01:Cry1Ab-01 nucleotide sequence (SEQ ID NO:2)；TNos: the terminator of rouge alkali synthetase gene (SEQ ID NO:16)；Pr35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；PAT: glufosinate acetyl transfer Enzyme gene (SEQ ID NO:18)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19)；LB: left margin).

Recombinant expression carrier DBN100125 heat shock method is converted into Escherichia coli T1 competent cell, hot shock condition Are as follows: 50 μ L Escherichia coli T1 competent cells, 10 μ L Plasmid DNA (recombinant expression carrier DBN100125), 42 DEG C of water-bath 30s；37 DEG C shaken cultivation 1h (shaking table shakes under 100rpm revolving speed)；Then in the LB solid of kanamycins containing 50mg/L (Kanamycin) Plate (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, with NaOH tune pH on 7.5) in temperature Cultivate 12h under the conditions of 37 DEG C of degree, picking white colony, LB liquid medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycins 50mg/L, with NaOH tune pH in 7.5) under the conditions of 37 DEG C of temperature overnight incubation.Alkalinity extraction Its plasmid.It will be identified after restriction enzyme Spe I and BamH the I digestion of the plasmid of extraction, and positive colony be sequenced Identification, the results showed that nucleotides sequence of the recombinant expression carrier DBN100125 between Spe I and BamH I site is classified as in sequence table Nucleotide sequence shown in SEQ ID NO:2, i.e. Cry1Ab-01 nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100125, Kas I and BamH I digestion recombinant clone is carried The Cry1Ab-02 nucleotide sequence that body DBN02-T is cut is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100744.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100744 contains for SEQ in sequence table Nucleotide sequence shown in ID NO:4, i.e. Cry1Ab-02 nucleotide sequence, the Cry1Ab-02 nucleotide sequence can connect institute State prAtUbi10 promoter and tNos terminator.

According to the method for above-mentioned building recombinant expression carrier DBN100125, BamH I and Kas I digestion recombinant clone is carried The Cry1Ac-01 nucleotide sequence that body DBN03-T is cut is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100645 (Kan: kanamycin gene；RB: right margin；PrAtRbcS4: arabidopsis ribulose 1,5- diphosphonic acid carboxylase are small Subunit gene promoter (SEQ ID NO:20)；Cry1Ac-01:Cry1Ac-01 nucleotide sequence (SEQ ID NO:6)；TNos: The terminator (SEQ ID NO:16) of rouge alkali synthetase gene；Pr35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:18)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19)；LB: left margin).Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100645 contains Nucleotide sequence shown in SEQ ID NO:6, i.e. Cry1Ac-01 nucleotide sequence in promising sequence table.

According to the method for above-mentioned building recombinant expression carrier DBN100125, by BamH I and Kas I, Nco I and Spe I The Cry1Ac-01 nucleotide sequence and Cry2Ab nucleosides that digestion recombinant cloning vector DBN03-T and DBN06-T is cut respectively Acid sequence is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100175 (Kan: kanamycin gene；RB: the right Boundary；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15)；Cry2Ab:Cry2Ab nucleosides Acid sequence (SEQ ID NO:12)；TNos: the terminator (SEQ ID NO:16) of rouge alkali synthetase gene；PrAtRbcS4: quasi- Southern mustard ribulose 1,5- diphosphonic acid carboxylase small subunit gene promoters (SEQ ID NO:20)；Cry1Ac-01:Cry1Ac-01 Nucleotide sequence (SEQ ID NO:6)；TNos: the terminator (SEQ ID NO:16) of rouge alkali synthetase gene；Pr35S: flower Cauliflower mosaic virus 35S promoter (SEQ ID NO:17)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:18)； T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19)；LB: left margin).Digestion and sequence verification recombinant expression Nucleotide sequence in carrier DBN100175 contains for nucleotide shown in SEQ ID NO:6 in sequence table and SEQ ID NO:12 Sequence, i.e. Cry1Ac-01 nucleotide sequence and Cry2Ab nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100125, by BamH I and Spe I, Asc I and BamH I The Cry1Ac-02 nucleotide sequence and Cry1Fa nucleosides that digestion recombinant cloning vector DBN04-T and DBN07-T is cut respectively Acid sequence is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100656 (Kan: kanamycin gene；RB: the right Boundary；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15)；Cry1Fa:Cry1Fa nucleosides Acid sequence (SEQ ID NO:14)；TNos: the terminator (SEQ ID NO:16) of rouge alkali synthetase gene；PrCsVMV: cassava Vein mosaic virus promoters (SEQ ID NO:21)；Cry1Ac-02:Cry1Ac-02 nucleotide sequence (SEQ ID NO:8)； TNos: the terminator (SEQ ID NO:16) of rouge alkali synthetase gene；Pr35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:18)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19)；LB: left margin).Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100656 contains Nucleotide sequence shown in SEQ ID NO:8 and SEQ ID NO:14 in promising sequence table, i.e. Cry1Ac-02 nucleotide sequence and Cry1Fa nucleotide sequence.

According to the method for above-mentioned building recombinant expression carrier DBN100125, by Nco I and Hind III digestion recombinant clone The Cry1A.105 nucleotide sequence that carrier DBN05-T is cut is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100757.Nucleotide sequence in digestion and sequence verification recombinant expression carrier DBN100757 contains for SEQ in sequence table Nucleotide sequence shown in ID NO:10, i.e. Cry1A.105 nucleotide sequence, the Cry1A.105 nucleotide sequence can connect The prAtUbi10 promoter and tNos terminator.

According to the method for above-mentioned building recombinant expression carrier DBN100125, by Nco I and Hind III, Nco I and Spe I digestion recombinant cloning vector DBN05-T and DBN06-T is cut respectively the Cry1A.105 nucleotide sequence and Cry2Ab core Nucleotide sequence is inserted into expression vector DBNBC-01, obtains recombinant expression carrier DBN100176 (Kan: kanamycin gene；RB: right Boundary；PrAtUbi10: arabidopsis ubiquitin (Ubiquitin) gene promoter (SEQ ID NO:15)；Cry2Ab:Cry2Ab core Nucleotide sequence (SEQ ID NO:12)；TNos: the terminator (SEQ ID NO:16) of rouge alkali synthetase gene；PrAtRbcS4: Arabidopsis ribulose 1,5- diphosphonic acid carboxylase small subunit gene promoters (SEQ ID NO:20)；Cry1A.105: Cry1A.105 nucleotide sequence (SEQ ID NO:10)；TNos: rouge alkali synthetase gene terminator (SEQ ID NO: 16)；Pr35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:17)；PAT: glufosinate acetyl transferase gene (SEQ ID NO:18)；T35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:19)；LB: left margin).Digestion and sequencing are tested Nucleotide sequence in card recombinant expression carrier DBN100176 contains for SEQ ID NO:10 in sequence table and SEQ ID NO:12 Shown nucleotide sequence, i.e. Cry1A.105 nucleotide sequence and Cry2Ab nucleotide sequence.

3, recombinant expression carrier converts Agrobacterium

To oneself constructed correct soybean recombinant expression carrier DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176 are transformed into Agrobacterium LBA4404 with liquid nitrogen method In (Invitrgen, Chicago, USA, CAT:18313-015), conversion condition are as follows: 100 μ L Agrobacterium LBA4404s, 3 μ L matter Grain DNA (recombinant expression carrier)；It is placed in 10min in liquid nitrogen, 37 DEG C of tepidarium 10min；Agrobacterium LBA4404 after conversion is connect Kind cultivates 2h under the conditions of being 200rpm in 28 DEG C of temperature, revolving speed in LB test tube, is applied to the rifampin containing 50mg/L (Rifampicin) until growing positive monoclonal and on the LB plate of the kanamycins of 100mg/L, picking Colony Culture is simultaneously Extract its plasmid, with restriction enzyme to soybean recombinant expression carrier DBN100125, DBN100744, DBN100645, Digestion verification is carried out after DBN100175, DBN100656, DBN100757 and DBN100176 digestion, the results showed that soybean recombinates table Up to carrier DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176 Structure is completely correct.

The acquisition of 3rd embodiment, transgenic plant

1, Transgenic soybean plants are obtained

According to the Agrobacterium infestation method routinely used, by the cotyledonary node tissue of Huang 13 in the soybean varieties of sterile culture and the Agrobacterium described in 3 in two embodiments co-cultures, by the soybean recombinant expression carrier of 2 buildings in second embodiment The T-DNA of DBN100125, DBN100744, DBN100645, DBN100175, DBN100656, DBN100757 and DBN100176 (including Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ac-01 nucleotide sequence, Cry1Ac-02 core Nucleotide sequence, Cry1A.105 nucleotide sequence, Cry2Ab nucleotide sequence, Cry1Fa nucleotide sequence and pat gene) it is transferred to Into soybean genome, obtains and be transferred to the soybean plant strain of Cry1Ab-01 nucleotide sequence, be transferred to Cry1Ab-02 nucleotide The soybean plant strain of sequence, is transferred to Cry1Ac-01-Cry1Fa nucleotides sequence at the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence The soybean plant strain of column, is transferred to Cry1A.105 nucleotide sequence at the soybean plant strain for being transferred to Cry1Ac-02-Cry2Ab nucleotide sequence Soybean plant strain, be transferred to the soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence, while using Wild-type soy plant as Control.

For the transformation of soybean of mediated by agriculture bacillus, briefly, by mature soya seeds in soybean germination culture medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprouted, seed is inoculated on germination medium, By the following conditions culture: 25 ± 1 DEG C of temperature；Photoperiod (light dark) is 16/8h.It is taken after sprouting 4-6 days swollen at bud green cotyledonary node Big soybean aseptic seedling, cuts hypocotyl under cotyledonary node at 3-4mm, longitudinally slit cotyledon removes terminal bud, lateral bud and seminal root. Wound is carried out at cotyledonary node with the knife spine of scalpel, the cotyledonary node tissue crossed with agrobacterium suspension contact wound, middle peasant Cry1A nucleotide sequence can be transferred to cotyledonary node tissue (step 1: infecting step) that wound is crossed in this step by bacillus, Cotyledonary node tissue preferably immerses agrobacterium suspension (OD₆₆₀=0.5-0.8, infecting culture medium, (MS salt 2.15g/L, B5 tie up him Life, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2-morpholine ethane sulfonic acid (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) in start inoculation.Cotyledonary node tissue and Agrobacterium co-culture one period (3 days) (step 2: training altogether Support step).Preferably, cotyledonary node group is woven in infect step after in solid medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES 4g/L, ZT 2mg/L, agar 8g/L, pH5.6) on cultivate.It, can after the stage of co-cultivation herein To there is " recovery " step of a selectivity.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, ZT 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least in the presence of it is a kind of oneself know and inhibit the antibiotic (cephalosporin) of Agrobacterium growth, do not add plant and turn Change the selective agent (step 3: recovering step) of body.Preferably, the tissue block of cotyledon node regeneration is having antibiotic but no selective agent Solid medium on cultivate, to eliminate Agrobacterium and provide convalescence for infected cell.Then, the tissue block of cotyledon node regeneration It is cultivated on the culture medium containing selective agent (glufosinate) and selects the transformed calli (step 4: selection step) grown.It is excellent Selection of land, the tissue block of cotyledon node regeneration is in screening solid medium (B5 salt 3.1g/L, B5 vitamin, MES1g/ for having selective agent L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, Aspartic acid 100mg/L, glufosinate 6mg/L, pH5.6) on cultivate, cause conversion cell selective growth.Then, conversion Cytothesis is at plant (step 5: regeneration step), it is preferable that the cotyledon node regeneration grown on the culture medium containing selective agent Tissue block is cultivated on solid medium (B5 differential medium and B5 root media) with aftergrowth.

It screens obtained resistant tissues block and is transferred to the B5 differential medium (B5 salt 3.1g/L, B5 vitamin, MES1g/ L, sucrose 30g/L, ZT 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, red Mycin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH5.6) on, differentiation is cultivated at 25 DEG C.Differentiate the seedling transfer come To the B5 root media (B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole -3-butyric acid (IBA) 1mg/L), in culture of rootage, culture moves to hot-house culture to about 10cm high at 25 DEG C It is extremely solid.In the greenhouse, 16h is cultivated at 26 DEG C daily, cultivates 8h at 20 DEG C.

Fourth embodiment verifies transgenic plant with TaqMan

The soybean for taking the soybean plant strain for being transferred to Cry1Ab-01 nucleotide sequence respectively, being transferred to Cry1Ab-02 nucleotide sequence Plant, the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence, the soybean plant for being transferred to Cry1Ac-01-Cry1Fa nucleotide sequence Strain, the soybean plant strain for being transferred to Cry1Ac-02-Cry2Ab nucleotide sequence, the soybean plant strain for being transferred to Cry1A.105 nucleotide sequence Respectively about 100mg is as sample with the soybean plant strain that is transferred to Cry1A.105-Cry2Ab nucleotide sequence, with the DNeasy of Qiagen Plant Maxi Kit extracts its genomic DNA, and the copy of pat gene is detected by Taqman fluorescence probe quantitative PCR method Count the copy number to determine Cry1A gene.Simultaneously using Wild-type soy plant as control, detection point is carried out according to the method described above Analysis.Experiment sets 3 repetitions, is averaged.

Detecting pat gene copy number, the specific method is as follows:

Step 11 takes the soybean plant strain for being transferred to Cry1Ab-01 nucleotide sequence respectively, is transferred to Cry1Ab-02 nucleotides sequence The soybean plant strain of column, is transferred to Cry1Ac-01-Cry1Fa nucleotide sequence at the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence Soybean plant strain, be transferred to Cry1Ac-02-Cry2Ab nucleotide sequence soybean plant strain, be transferred to Cry1A.105 nucleotide sequence Each 100mg of blade of soybean plant strain and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence, respectively in mortar It is ground into homogenate with liquid nitrogen, each sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA concentration that above-mentioned sample is measured with NanoDrop 2000 (Thermo Scientific)；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μL；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification The sample of shellfish number is as standard items, and using the sample of Wild-type soy plant as control, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively:

Following primer and probe is used to detect pat gene:

Primer 1:gagggtgttgtggctggtattg is as shown in SEQ ID NO:22 in sequence table；

Primer 2: tctcaactgtccaatcgtaagcg is as shown in SEQ ID NO:23 in sequence table；

Probe 1:cttacgctgggccctggaaggctag is as shown in SEQ ID NO:24 in sequence table；

PCR reaction system are as follows:

50 × the primer/probe mixture includes each 45 μ L of every kind of primer, 50 μ of probe of 100 μM of concentration of 1mM concentration L and 860 μ L 1 × TE buffers, and at 4 DEG C, it is housed in amber tube.

PCR reaction condition are as follows:

Data are analyzed using SDS2.3 software (Applied Biosystems).

The experimental results showed that Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ac-01 nucleotide Sequence, Cry1Ac-01-Cry2Ab nucleotide sequence, Cry1Ac-02-Cry1Fa nucleotide sequence, Cry1A.105 nucleotides sequence Oneself is integrated into the genome of soybean plant strain detected for column and Cry1A.105-Cry2Ab nucleotide sequence, and is transferred to The soybean plant strain of Cry1Ab-01 nucleotide sequence, is transferred to Cry1Ac-01 at the soybean plant strain for being transferred to Cry1Ab-02 nucleotide sequence The soybean plant strain of nucleotide sequence, is transferred to Cry1Ac-02- at the soybean plant strain for being transferred to Cry1Ac-01-Cry2Ab nucleotide sequence The soybean plant strain of Cry1Fa nucleotide sequence, the soybean plant strain for being transferred to Cry1A.105 nucleotide sequence and it is transferred to Cry1A.105- The Transgenic soybean plants that the soybean plant strain of the soybean plant strain of Cry2Ab nucleotide sequence is singly copied.

The insect resistant effect detection of 5th embodiment, Transgenic soybean plants

By the soybean plant strain for being transferred to Cry1Ab-01 nucleotide sequence, be transferred to Cry1Ab-02 nucleotide sequence soybean plant Strain, the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence, the soybean plant for being transferred to Cry1Ac-01-Cry2Ab nucleotide sequence Strain, the soybean plant strain for being transferred to Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant for being transferred to Cry1A.105 nucleotide sequence Strain, Wild-type soy plant and is accredited as non-at the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence through Taqman The soybean plant strain of transgenosis carries out insect resistant effect detection to three-spotted plusia.

The soybean for taking the soybean plant strain for being transferred to Cry1Ab-01 nucleotide sequence respectively, being transferred to Cry1Ab-02 nucleotide sequence Plant, the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence, the soybean plant for being transferred to Cry1Ac-01-Cry2Ab nucleotide sequence Strain, the soybean plant strain for being transferred to Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant for being transferred to Cry1A.105 nucleotide sequence Strain, Wild-type soy plant and is accredited as non-at the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence through Taqman The fresh blade of the soybean plant strain (tri-leaf period) of transgenosis, it is clean with aseptic water washing and blotted the water on blade with gauze, Then soybean leaves are removed into vein, while being cut into the strip of about 2cm × 3.5cm, take 1 cut after strip blade be put into On the moisturizing filter paper of round plastic culture dish bottom, 10 three-spotted plusias (newly hatched larvae) are put in each culture dish and are covered afterwards, After being placed 3 days under conditions of 25-28 DEG C of temperature, relative humidity 70-80%, photoperiod (light dark) 16:8, according to three-spotted plusia children Three Xiang Zhibiao of worm development progress, the death rate and blade injury rate is obtained resistance total score (full marks 300 divide): resistance total score=100 × The death rate+[100 × death rate+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+ 10 × and (negative control borer population/connect worm sum)]+100 × (1- blade injury rate).It is transferred to totally the 3 of Cry1Ab-01 nucleotide sequence A transformation event strain (S1, S2, S3), be transferred to Cry1Ab-02 nucleotide sequence totally 3 transformation event strains (S4, S5, S6), totally 3 transformation event strains (S7, S8, S9) of Cry1Ac-01 nucleotide sequence are transferred to, Cry1Ac-01-Cry2Ab is transferred to Totally 3 transformation event strains (S10, S11, S12) of nucleotide sequence, are transferred to being total to for Cry1Ac-02-Cry1Fa nucleotide sequence 3 transformation event strains (S13, S14, S15), be transferred to Cry1A.105 nucleotide sequence totally 3 transformation event strains (S16, S17, S18), totally 3 transformation event strains (S19, S20, S21) of Cry1A.105-Cry2Ab nucleotide sequence are transferred to, are passed through Taqman is accredited as non-transgenic (NGM) totally 1 strain, (negative control, the CK) of wild type totally 1 strain；From each strain System selects 3 plants to be tested, and every plant is repeated 1 times.The results are shown in Table 1.

Table 1, Transgenic soybean plants are inoculated with the pest-resistant experimental result of three-spotted plusia

Table 1 the result shows that: be transferred to the soybean plant strain of Cry1Ab-01 nucleotide sequence, be transferred to Cry1Ab-02 nucleotides sequence The soybean plant strain of column, is transferred to Cry1Ac-01-Cry2Ab nucleotide sequence at the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence Soybean plant strain, be transferred to Cry1Ac-02-Cry1Fa nucleotide sequence soybean plant strain, be transferred to Cry1A.105 nucleotide sequence Soybean plant strain and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence imitate three-spotted plusia with preferable desinsection Fruit, the average mortality of three-spotted plusia are almost 100%, and resistance total score is divided substantially near full marks 300, are identified through Taqman It is non-transgenic soybean plant strain and Wild-type soy plant pair three-spotted plusia without lethal or inhibiting effect, resistance total score is general 60 or so.

Compared with Wild-type soy plant, it is transferred to the soybean plant strain of Cry1Ab-01 nucleotide sequence, is transferred to Cry1Ab-02 The soybean plant strain of nucleotide sequence, is transferred to Cry1Ac-01-Cry2Ab core at the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence The soybean plant strain of nucleotide sequence, is transferred to Cry1A.105 nucleosides at the soybean plant strain for being transferred to Cry1Ac-02-Cry1Fa nucleotide sequence The soybean plant strain of acid sequence and the soybean plant strain of Cry1A.105-Cry2Ab nucleotide sequence is transferred to three-spotted plusia newly hatched larvae Control efficiency be almost absolutely, extremely individually survival larvas also substantially stop development, larva is substantially still in first after 3 days State is incubated, is all apparent depauperation, and stopped developing, can not survive in the natural environment of field；And it is transferred to Cry1Ab- The soybean plant strain of 01 nucleotide sequence, is transferred to Cry1Ac-01 nucleotide at the soybean plant strain for being transferred to Cry1Ab-02 nucleotide sequence The soybean plant strain of sequence, is transferred to Cry1Ac-02-Cry1Fa at the soybean plant strain for being transferred to Cry1Ac-01-Cry2Ab nucleotide sequence The soybean plant strain of nucleotide sequence, the soybean plant strain for being transferred to Cry1A.105 nucleotide sequence and it is transferred to Cry1A.105-Cry2Ab The soybean plant strain of nucleotide sequence is generally only by slight damage, and blade injury rate is 1% or so.

Thus it proves to be transferred to the soybean plant strain of Cry1Ab-01 nucleotide sequence, be transferred to the big of Cry1Ab-02 nucleotide sequence Beans plant, the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence, the soybean for being transferred to Cry1Ac-01-Cry2Ab nucleotide sequence Plant, the soybean plant strain for being transferred to Cry1Ac-02-Cry1Fa nucleotide sequence, the soybean plant for being transferred to Cry1A.105 nucleotide sequence Strain and the soybean plant strain for being transferred to Cry1A.105-Cry2Ab nucleotide sequence show the activity of highly resistance three-spotted plusia, this activity It is enough the growth to three-spotted plusia and generates ill effect to make it be controlled in field.

Above-mentioned experimental result also shows: being transferred to the soybean plant strain of Cry1Ab-01 nucleotide sequence, is transferred to Cry1Ab-02 core The soybean plant strain of nucleotide sequence, is transferred to Cry1Ac-01-Cry2Ab nucleosides at the soybean plant strain for being transferred to Cry1Ac-01 nucleotide sequence The soybean plant strain of acid sequence, is transferred to Cry1A.105 nucleotide at the soybean plant strain for being transferred to Cry1Ac-02-Cry1Fa nucleotide sequence The soybean plant strain of sequence and control/prevention and treatment of the soybean plant strain to three-spotted plusia for being transferred to Cry1A.105-Cry2Ab nucleotide sequence Apparently because plant itself can produce Cry1A albuminoid, such as Cry1Ab albumen, Cry1Ac albumen or Cry1A.105 albumen, institute With, it is well known to those skilled in the art, according to Cry1A albumen to the toxic action of three-spotted plusia, Cry1A egg is transferred in the present invention White plant can also generate at least one second of insect-killing protein different from Cry1A albumen, such as Vip albuminoid or Cry Albuminoid etc..

In conclusion the purposes of insecticidal proteins of the present invention can kill the Cry1A of three-spotted plusia by generating in plant Albumen controls three-spotted plusia pest；Cultural control method, chemical prevention and control method, the physical control method used with the prior art It is compared with biological control method, the present invention carries out the protection in the time of infertility, whole plant to plant to prevent and treat three-spotted plusia pest Infringement, and pollution-free, noresidue, effect stability, thoroughly, simply, conveniently, it is economical.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Sequence table

<110>Beijing Da Bei Nong Bioisystech Co., Ltd

<120>purposes of insecticidal proteins

<130> DBNBC141

<160> 24

<170> SIPOSequenceListing 1.0

<210> 1

<211> 818

<212> PRT

<213>artificial sequence-Cry1Ab-01 amino acid sequence (Artificial Sequence)

<400> 1

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Glu Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Glu Cys Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro Asn

675 680 685

Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser Thr

690 695 700

Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser His

785 790 795 800

His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp

805 810 815

Phe Arg

<210> 2

<211> 2457

<212> DNA

<213>artificial sequence-Cry1Ab-01 nucleotide sequence (Artificial Sequence)

<400> 2

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cctggattca tcgcagcgcg 1380

gagttcaaca atatcattcc gtcctcccaa atcacccaaa tccccctcac caagtccacc 1440

aacctgggca gcggcacctc cgtggtgaag ggcccaggct tcacgggcgg cgacatcctg 1500

cgcaggacct ccccgggcca gatcagcacc ctccgcgtca acatcaccgc tcccctgtcc 1560

cagaggtacc gcgtcaggat tcgctacgct agcaccacca acctgcaatt ccacacctcc 1620

atcgacggca ggccgatcaa tcagggtaac ttctccgcca ccatgtccag cggcagcaac 1680

ctccaatccg gcagcttccg caccgtgggt ttcaccaccc ccttcaactt ctccaacggc 1740

tccagcgttt tcaccctgag cgcccacgtg ttcaattccg gcaatgaggt gtacattgac 1800

cgcattgagt tcgtgccagc cgaggtcacc ttcgaagccg agtacgacct ggagagagcc 1860

cagaaggctg tcaatgagct cttcacgtcc agcaatcaga tcggcctgaa gaccgacgtc 1920

actgactacc acatcgacca agtctccaac ctcgtggagt gcctctccga tgagttctgc 1980

ctcgacgaga agaaggagct gtccgagaag gtgaagcatg ccaagcgtct cagcgacgag 2040

aggaatctcc tccaggaccc caatttccgc ggcatcaaca ggcagctcga ccgcggctgg 2100

cgcggcagca ccgacatcac gatccagggc ggcgacgatg tgttcaagga gaactacgtg 2160

actctcctgg gcactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaagctca aggcttacac tcgctaccag ctccgcggct acatcgaaga cagccaagac 2280

ctcgagattt acctgatccg ctacaacgcc aagcacgaga ccgtcaacgt gcccggtact 2340

ggttccctct ggccgctgag cgcccccagc ccgatcggca agtgtgccca ccacagccac 2400

cacttctcct tggacatcga tgtgggctgc accgacctga acgaggactt tcggtag 2457

<210> 3

<211> 615

<212> PRT

<213>artificial sequence-Cry1Ab-02 amino acid sequence (Artificial Sequence)

<400> 3

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr

610 615

<210> 4

<211> 1848

<212> DNA

<213>artificial sequence-Cry1Ab-02 nucleotide sequence (Artificial Sequence)

<400> 4

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga 1848

<210> 5

<211> 1178

<212> PRT

<213>artificial sequence-Cry1Ac-01 amino acid sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn

625 630 635 640

Val Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser

675 680 685

Asn Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser

690 695 700

Thr Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn

785 790 795 800

Arg Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys

805 810 815

Arg Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp

820 825 830

Ile Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val

835 840 845

Ile Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu

850 855 860

Glu Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val

865 870 875 880

Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp

885 890 895

Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu

900 905 910

Phe Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala

915 920 925

Met Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr

930 935 940

Leu Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu

945 950 955 960

Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg

965 970 975

Asn Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn

980 985 990

Val Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val

995 1000 1005

Leu Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val

1010 1015 1020

Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly

1025 1030 1035 1040

Tyr Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp

1045 1050 1055

Glu Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn

1060 1065 1070

Thr Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly

1075 1080 1085

Ala Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro

1090 1095 1100

Ala Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg

1105 1110 1115 1120

Arg Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro

1125 1130 1135

Leu Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr

1140 1145 1150

Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val

1155 1160 1165

Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 6

<211> 3537

<212> DNA

<213>artificial sequence-Cry1Ac-01 nucleotide sequence (Artificial Sequence)

<400> 6

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct cttggataca tcgtagtgct 1380

gagttcaaca acatcatcgc atccgatagt attactcaaa tccctgcagt gaagggaaac 1440

tttctcttca acggttctgt catttcagga ccaggattca ctggtggaga cctcgttaga 1500

ctcaacagca gtggaaataa cattcagaat agagggtata ttgaagttcc aattcacttc 1560

ccatccacat ctaccagata tagagttcgt gtgaggtatg cttctgtgac ccctattcac 1620

ctcaacgtta attggggtaa ttcatccatc ttctccaata cagttccagc tacagctacc 1680

tccttggata atctccaatc cagcgatttc ggttactttg aaagtgccaa tgcttttaca 1740

tcttcactcg gtaacatcgt gggtgttaga aactttagtg ggactgcagg agtgattatc 1800

gacagattcg agttcattcc agttactgca acactcgagg ctgagtacaa ccttgagaga 1860

gcccagaagg ctgtgaacgc cctctttacc tccaccaatc agcttggctt gaaaactaac 1920

gttactgact atcacattga ccaagtgtcc aacttggtca cctaccttag cgatgagttc 1980

tgcctcgacg agaagcgtga actctccgag aaagttaaac acgccaagcg tctcagcgac 2040

gagaggaatc tcttgcaaga ctccaacttc aaagacatca acaggcagcc agaacgtggt 2100

tggggtggaa gcaccgggat caccatccaa ggaggcgacg atgtgttcaa ggagaactac 2160

gtcaccctct ccggaacttt cgacgagtgc taccctacct acttgtacca gaagatcgat 2220

gagtccaaac tcaaagcctt caccaggtat caacttagag gctacatcga agacagccaa 2280

gaccttgaaa tctactcgat caggtacaat gccaagcacg agaccgtgaa tgtcccaggt 2340

actggttccc tctggccact ttctgcccaa tctcccattg ggaagtgtgg agagcctaac 2400

agatgcgctc cacaccttga gtggaatcct gacttggact gctcctgcag ggatggcgag 2460

aagtgtgccc accattctca tcacttctcc ttggacatcg atgtgggatg tactgacctg 2520

aatgaggacc tcggagtctg ggtcatcttc aagatcaaga cccaagacgg acacgcaaga 2580

cttggcaacc ttgagtttct cgaagagaaa ccattggtcg gtgaagctct cgctcgtgtg 2640

aagagagcag agaagaagtg gagggacaaa cgtgagaaac tcgaatggga aactaacatc 2700

gtttacaagg aggccaaaga gtccgtggat gctttgttcg tgaactccca atatgatcag 2760

ttgcaagccg acaccaacat cgccatgatc cacgccgcag acaaacgtgt gcacagcatt 2820

cgtgaggctt acttgcctga gttgtccgtg atccctggtg tgaacgctgc catcttcgag 2880

gaacttgagg gacgtatctt taccgcattc tccttgtacg atgccagaaa cgtcatcaag 2940

aacggtgact tcaacaatgg cctcagctgc tggaatgtga aaggtcatgt ggacgtggag 3000

gaacagaaca atcagcgttc cgtcctggtt gtgcctgagt gggaagctga agtgtcccaa 3060

gaggttagag tctgtccagg tagaggctac attctccgtg tgaccgctta caaggaggga 3120

tacggtgagg gttgcgtgac catccacgag atcgagaaca acaccgacga gcttaagttc 3180

tccaactgcg tcgaggaaga aatctatccc aacaacaccg ttacttgcaa cgactacact 3240

gtgaatcagg aagagtacgg aggtgcctac actagccgta acagaggtta caacgaagct 3300

ccttccgttc ctgctgacta tgcctccgtg tacgaggaga aatcctacac agatggcaga 3360

cgtgagaacc cttgcgagtt caacagaggt tacagggact acacaccact tccagttggc 3420

tatgttacca aggagcttga gtactttcct gagaccgaca aagtgtggat cgagatcggt 3480

gaaaccgagg gaaccttcat cgtggacagc gtggagcttc tcttgatgga ggaataa 3537

<210> 7

<211> 1156

<212> PRT

<213>artificial sequence-Cry1Ac-02 amino acid sequence (Artificial Sequence)

<400> 7

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp Tyr Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Val Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ala Leu Phe Pro Asn Tyr Asp Ser Arg Arg Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Arg Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Tyr Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Ala Val Lys Gly Asn

465 470 475 480

Phe Leu Phe Asn Gly Ser Val Ile Ser Gly Pro Gly Phe Thr Gly Gly

485 490 495

Asp Leu Val Arg Leu Asn Ser Ser Gly Asn Asn Ile Gln Asn Arg Gly

500 505 510

Tyr Ile Glu Val Pro Ile His Phe Pro Ser Thr Ser Thr Arg Tyr Arg

515 520 525

Val Arg Val Arg Tyr Ala Ser Val Thr Pro Ile His Leu Asn Val Asn

530 535 540

Trp Gly Asn Ser Ser Ile Phe Ser Asn Thr Val Pro Ala Thr Ala Thr

545 550 555 560

Ser Leu Asp Asn Leu Gln Ser Ser Asp Phe Gly Tyr Phe Glu Ser Ala

565 570 575

Asn Ala Phe Thr Ser Ser Leu Gly Asn Ile Val Gly Val Arg Asn Phe

580 585 590

Ser Gly Thr Ala Gly Val Ile Ile Asp Arg Phe Glu Phe Ile Pro Val

595 600 605

Thr Ala Thr Leu Glu Ala Glu Ser Asp Leu Glu Arg Ala Gln Lys Ala

610 615 620

Val Asn Ala Leu Phe Thr Ser Ser Asn Gln Ile Gly Leu Lys Thr Asp

625 630 635 640

Val Thr Asp Tyr His Ile Asp Arg Val Ser Asn Leu Val Glu Cys Leu

645 650 655

Ser Asp Glu Phe Cys Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys Val

660 665 670

Lys His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Pro

675 680 685

Asn Phe Arg Gly Ile Asn Arg Gln Leu Asp Arg Gly Trp Arg Gly Ser

690 695 700

Thr Asp Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr

705 710 715 720

Val Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr

725 730 735

Gln Lys Ile Asp Glu Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gln Leu

740 745 750

Arg Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Leu Ile Arg

755 760 765

Tyr Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu

770 775 780

Trp Pro Leu Ser Ala Pro Ser Pro Ile Gly Lys Cys Ala His His Ser

785 790 795 800

His His Phe Ser Leu Asp Ile Asp Val Gly Cys Thr Asp Leu Asn Glu

805 810 815

Asp Leu Gly Val Trp Val Ile Phe Lys Ile Lys Thr Gln Asp Gly His

820 825 830

Ala Arg Leu Gly Asn Leu Glu Phe Leu Glu Glu Lys Pro Leu Val Gly

835 840 845

Glu Ala Leu Ala Arg Val Lys Arg Ala Glu Lys Lys Trp Arg Asp Lys

850 855 860

Arg Glu Lys Leu Glu Trp Glu Thr Asn Ile Val Tyr Lys Glu Ala Lys

865 870 875 880

Glu Ser Val Asp Ala Leu Phe Val Asn Ser Gln Tyr Asp Arg Leu Gln

885 890 895

Ala Asp Thr Asn Ile Ala Met Ile His Ala Ala Asp Lys Arg Val His

900 905 910

Ser Ile Arg Glu Ala Tyr Leu Pro Glu Leu Ser Val Ile Pro Gly Val

915 920 925

Asn Ala Ala Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe Thr Ala Phe

930 935 940

Ser Leu Tyr Asp Ala Arg Asn Val Ile Lys Asn Gly Asp Phe Asn Asn

945 950 955 960

Gly Leu Ser Cys Trp Asn Val Lys Gly His Val Asp Val Glu Glu Gln

965 970 975

Asn Asn His Arg Ser Val Leu Val Val Pro Glu Trp Glu Ala Glu Val

980 985 990

Ser Gln Glu Val Arg Val Cys Pro Gly Arg Gly Tyr Ile Leu Arg Val

995 1000 1005

Thr Ala Tyr Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr Ile His Glu

1010 1015 1020

Ile Glu Asn Asn Thr Asp Glu Leu Lys Phe Ser Asn Cys Val Glu Glu

1025 1030 1035 1040

Glu Val Tyr Pro Asn Asn Thr Val Thr Cys Asn Asp Tyr Thr Ala Thr

1045 1050 1055

Gln Glu Glu Tyr Glu Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr Asp

1060 1065 1070

Gly Ala Tyr Glu Ser Asn Ser Ser Val Pro Ala Asp Tyr Ala Ser Ala

1075 1080 1085

Tyr Glu Glu Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn Pro Cys Glu

1090 1095 1100

Ser Asn Arg Gly Tyr Gly Asp Tyr Thr Pro Leu Pro Ala Gly Tyr Val

1105 1110 1115 1120

Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp Lys Val Trp Ile Glu

1125 1130 1135

Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp Ser Val Glu Leu Leu

1140 1145 1150

Leu Met Glu Glu

1155

<210> 8

<211> 3471

<212> DNA

<213>artificial sequence-Cry1Ac-02 nucleotide sequence (Artificial Sequence)

<400> 8

atggacaaca atcccaacat caacgagtgc attccttaca actgcctgag caaccctgag 60

gttgaggtgc tgggtggaga acggattgag actggttaca cacctatcga catctcgttg 120

tcacttaccc aattcctttt gtcagagttc gtgcccggtg ctggattcgt gcttggactt 180

gtcgatatca tttggggaat ctttggtccc tctcaatggg acgcctttct tgtacagata 240

gagcagttaa ttaaccaaag aatagaagaa ttcgctagga accaagccat ctcaaggtta 300

gaaggcctca gcaaccttta ccagatttac gcagaatctt ttcgagagtg ggaagcagac 360

ccgaccaatc ctgccttaag agaggagatg cgcattcaat tcaatgacat gaacagcgcg 420

ctgacgaccg caattccgct cttcgccgtt cagaattacc aagttcctct tttatccgtg 480

tacgtgcagg ctgccaacct gcacttgtcg gtgctccgcg atgtctccgt gttcggacaa 540

cggtggggct ttgatgccgc aactatcaat agtcgttata atgatctgac taggcttatt 600

ggcaactata ccgattatgc tgttcgctgg tacaacacgg gtctcgaacg tgtctgggga 660

ccggattcta gagattgggt caggtacaac cagttcaggc gagagttgac actaactgtc 720

ctagacattg tcgctctctt tcccaactac gactctaggc gctacccaat ccgtactgtg 780

tcacaattga cccgggaaat ctacacaaac ccagtcctcg agaacttcga cggtagcttt 840

cgaggctcgg ctcagggcat agagagaagc atcaggtctc cacacctgat ggacatattg 900

aacagtatca cgatctacac cgatgcgcac cgcggttatt actactggtc agggcatcag 960

atcatggcat cacccgttgg gttctctgga ccagaattca ctttcccact ttacgggact 1020

atgggcaatg cagctccaca acaacgtatt gttgctcaac tcggtcaggg cgtgtataga 1080

accttgtcca gcactctata taggagacct ttcaacatcg gcatcaacaa tcaacaattg 1140

tctgtgcttg acgggacaga atttgcctat ggaacctcct caaatctgcc atccgctgtc 1200

tacagaaaga gcggaacagt tgatagcttg gatgagatcc ctccacagaa caacaacgtt 1260

ccacctaggc aagggtttag ccatcgcctt agccatgtgt ccatgttccg ttcaggcttt 1320

agtaatagca gcgttagtat catcagagct ccgatgttct cttggataca tcgtagtgct 1380

gagtttaaca acataattgc atccgatagc attactcaga tcccagctgt caaggggaac 1440

tttctcttta atggttctgt catttcagga ccaggattca ctggaggcga cttggttagg 1500

ctgaattctt ccggcaacaa catccagaat agagggtata ttgaagtgcc cattcacttc 1560

ccatcgacat ctaccagata tcgtgttcgt gtaaggtatg cctctgttac ccctattcac 1620

ctcaacgtca attggggtaa ttcctccatc ttttccaata cagtaccagc gacagctaca 1680

tccttggata atctccaatc tagcgatttc ggttacttcg aaagtgccaa tgccttcacc 1740

tcttccctag gtaacatagt aggtgttaga aatttctccg gaaccgccgg agtgataatc 1800

gaccgcttcg aattcattcc cgttactgca acgctcgagg cagagtctga cttggaaaga 1860

gcacagaagg cggtgaatgc tctgttcact tcgtccaatc agattgggct caagacagat 1920

gtgactgact atcacatcga tcgcgtttcc aaccttgttg agtgcctctc tgatgagttc 1980

tgtttggatg agaagaagga gttgtccgag aaggtcaaac atgctaagcg acttagtgat 2040

gagcggaact tgcttcaaga tcccaacttt cgcgggatca acaggcaact agatcgtgga 2100

tggaggggaa gtacggacat caccattcaa ggaggtgatg atgtgttcaa ggagaactat 2160

gttacgctct tgggtacctt tgatgagtgc tatccaacat acctgtacca gaagatagat 2220

gaatcgaaac tcaaagccta cacaagatac cagttgagag gttacatcga ggacagtcaa 2280

gaccttgaga tctacctcat cagatacaac gccaaacatg agacagtcaa tgtgcctggg 2340

acgggttcac tctggccact ttcagcccca agtcccatcg gcaagtgtgc ccatcactca 2400

caccacttct ccttggacat agacgttggc tgtaccgacc tgaacgaaga cctcggtgtg 2460

tgggtgatct tcaagatcaa gactcaagat ggccatgcca ggctaggcaa tctggagttt 2520

ctagaagaga aaccacttgt tggagaagcc ctcgctagag tgaagagggc tgagaagaag 2580

tggagggaca agagagagaa gttggaatgg gaaacaaaca ttgtgtacaa agaagccaaa 2640

gaaagcgttg acgctctgtt tgtgaactct cagtatgata ggctccaagc tgataccaac 2700

atagctatga ttcatgctgc agacaaacgc gttcatagca ttcgggaagc ttaccttcct 2760

gaacttagcg tgattccggg tgtcaatgct gctatctttg aagagttaga agggcgcatc 2820

ttcactgcat tctccttgta tgatgcgagg aatgtcatca agaatggtga cttcaacaat 2880

ggcctatcct gctggaatgt gaaagggcac gtagatgtag aagaacagaa caatcaccgc 2940

tctgtccttg ttgttcctga gtgggaagca gaagtttcac aagaagttcg tgtctgtcct 3000

ggtcgtggct acattcttcg tgttaccgcg tacaaagaag gatacggaga aggttgcgtc 3060

accatacacg agattgagaa caacaccgac gagctgaagt tcagcaactg cgtcgaggag 3120

gaagtctacc caaacaacac cgtaacttgc aatgactaca ctgcgactca agaggagtat 3180

gagggtactt acacttctcg caatcgagga tacgatggag cctatgagag caactcttct 3240

gtacccgctg actatgcatc agcctatgag gagaaggctt acaccgatgg acgtagggac 3300

aatccttgcg aatctaacag aggctatggg gactacacac cgttaccagc cggctatgtc 3360

accaaagagt tagagtactt tccagaaacc gacaaggttt ggattgagat tggagaaacg 3420

gaaggaacat tcattgttga tagcgtggag ttacttctga tggaggaatg a 3471

<210> 9

<211> 1177

<212> PRT

<213>artificial sequence-Cry1A.105 amino acid sequence (Artificial Sequence)

<400> 9

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Ala Ser Asp Ser Ile Thr Gln Ile Pro Leu Val Lys Ala His

465 470 475 480

Thr Leu Gln Ser Gly Thr Thr Val Val Arg Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Gly Gly Pro Phe Ala Tyr Thr Ile

500 505 510

Val Asn Ile Asn Gly Gln Leu Pro Gln Arg Tyr Arg Ala Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Arg Ile Tyr Val Thr Val Ala Gly Glu

530 535 540

Arg Ile Phe Ala Gly Gln Phe Asn Lys Thr Met Asp Thr Gly Asp Pro

545 550 555 560

Leu Thr Phe Gln Ser Phe Ser Tyr Ala Thr Ile Asn Thr Ala Phe Thr

565 570 575

Phe Pro Met Ser Gln Ser Ser Phe Thr Val Gly Ala Asp Thr Phe Ser

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Phe Glu Leu Ile Pro Val Thr

595 600 605

Ala Thr Leu Glu Ala Glu Tyr Asn Leu Glu Arg Ala Gln Lys Ala Val

610 615 620

Asn Ala Leu Phe Thr Ser Thr Asn Gln Leu Gly Leu Lys Thr Asn Val

625 630 635 640

Thr Asp Tyr His Ile Asp Gln Val Ser Asn Leu Val Thr Tyr Leu Ser

645 650 655

Asp Glu Phe Cys Leu Asp Glu Lys Arg Glu Leu Ser Glu Lys Val Lys

660 665 670

His Ala Lys Arg Leu Ser Asp Glu Arg Asn Leu Leu Gln Asp Ser Asn

675 680 685

Phe Lys Asp Ile Asn Arg Gln Pro Glu Arg Gly Trp Gly Gly Ser Thr

690 695 700

Gly Ile Thr Ile Gln Gly Gly Asp Asp Val Phe Lys Glu Asn Tyr Val

705 710 715 720

Thr Leu Ser Gly Thr Phe Asp Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln

725 730 735

Lys Ile Asp Glu Ser Lys Leu Lys Ala Phe Thr Arg Tyr Gln Leu Arg

740 745 750

Gly Tyr Ile Glu Asp Ser Gln Asp Leu Glu Ile Tyr Ser Ile Arg Tyr

755 760 765

Asn Ala Lys His Glu Thr Val Asn Val Pro Gly Thr Gly Ser Leu Trp

770 775 780

Pro Leu Ser Ala Gln Ser Pro Ile Gly Lys Cys Gly Glu Pro Asn Arg

785 790 795 800

Cys Ala Pro His Leu Glu Trp Asn Pro Asp Leu Asp Cys Ser Cys Arg

805 810 815

Asp Gly Glu Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile

820 825 830

Asp Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile

835 840 845

Phe Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu

850 855 860

Phe Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys

865 870 875 880

Arg Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu

885 890 895

Thr Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe

900 905 910

Val Asn Ser Gln Tyr Asp Gln Leu Gln Ala Asp Thr Asn Ile Ala Met

915 920 925

Ile His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu

930 935 940

Pro Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu

945 950 955 960

Leu Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn

965 970 975

Val Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val

980 985 990

Lys Gly His Val Asp Val Glu Glu Gln Asn Asn Gln Arg Ser Val Leu

995 1000 1005

Val Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys

1010 1015 1020

Pro Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr

1025 1030 1035 1040

Gly Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu

1045 1050 1055

Leu Lys Phe Ser Asn Cys Val Glu Glu Glu Ile Tyr Pro Asn Asn Thr

1060 1065 1070

Val Thr Cys Asn Asp Tyr Thr Val Asn Gln Glu Glu Tyr Gly Gly Ala

1075 1080 1085

Tyr Thr Ser Arg Asn Arg Gly Tyr Asn Glu Ala Pro Ser Val Pro Ala

1090 1095 1100

Asp Tyr Ala Ser Val Tyr Glu Glu Lys Ser Tyr Thr Asp Gly Arg Arg

1105 1110 1115 1120

Glu Asn Pro Cys Glu Phe Asn Arg Gly Tyr Arg Asp Tyr Thr Pro Leu

1125 1130 1135

Pro Val Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp

1140 1145 1150

Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe Ile Val Asp

1155 1160 1165

Ser Val Glu Leu Leu Leu Met Glu Glu

1170 1175

<210> 10

<211> 3534

<212> DNA

<213>artificial sequence-Cry1A.105 nucleotide sequence (Artificial Sequence)

<400> 10

atggacaaca acccaaacat caacgagtgc atcccgtaca actgcctcag caaccctgag 60

gtcgaggtgc tcggcggtga gcgcatcgag accggttaca cccccatcga catctccctc 120

tccctcacgc agttcctgct cagcgagttc gtgccaggcg ctggcttcgt cctgggcctc 180

gtggacatca tctggggcat ctttggcccc tcccagtggg acgccttcct ggtgcaaatc 240

gagcagctca tcaaccagag gatcgaggag ttcgccagga accaggccat cagccgcctg 300

gagggcctca gcaacctcta ccaaatctac gctgagagct tccgcgagtg ggaggccgac 360

cccactaacc cagctctccg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc 420

ctgaccaccg ccatcccact cttcgccgtc cagaactacc aagtcccgct cctgtccgtg 480

tacgtccagg ccgccaacct gcacctcagc gtgctgaggg acgtcagcgt gtttggccag 540

aggtggggct tcgacgccgc caccatcaac agccgctaca acgacctcac caggctgatc 600

ggcaactaca ccgaccacgc tgtccgctgg tacaacactg gcctggagcg cgtctggggc 660

cctgattcta gagactggat tcgctacaac cagttcaggc gcgagctgac cctcaccgtc 720

ctggacattg tgtccctctt cccgaactac gactcccgca cctacccgat ccgcaccgtg 780

tcccaactga cccgcgaaat ctacaccaac cccgtcctgg agaacttcga cggtagcttc 840

aggggcagcg cccagggcat cgagggctcc atcaggagcc cacacctgat ggacatcctc 900

aacagcatca ctatctacac cgatgcccac cgcggcgagt actactggtc cggccaccag 960

atcatggcct ccccggtcgg cttcagcggc cccgagttta cctttcctct ctacggcacg 1020

atgggcaacg ccgctccaca acaacgcatc gtcgctcagc tgggccaggg cgtctaccgc 1080

accctgagct ccaccctgta ccgcaggccc ttcaacatcg gtatcaacaa ccagcagctg 1140

tccgtcctgg atggcactga gttcgcctac ggcacctcct ccaacctgcc ctccgctgtc 1200

taccgcaaga gcggcacggt ggattccctg gacgagatcc caccacagaa caacaatgtg 1260

ccccccaggc agggtttttc ccacaggctc agccacgtgt ccatgttccg ctccggcttc 1320

agcaactcgt ccgtgagcat catcagagct cctatgttct cttggataca ccgtagtgct 1380

gagttcaaca acatcattgc atccgacagc attactcaaa tacccttggt gaaagcacat 1440

acacttcagt caggtactac tgttgtcaga ggtccagggt ttacaggagg agacattctt 1500

cgtcgcacaa gtggaggacc ctttgcttac actattgtta acatcaatgg ccaattgccc 1560

caaaggtatc gtgcaagaat ccgctatgcc tctactacaa atctcaggat ctacgtgact 1620

gttgcaggtg aaaggatctt tgctggtcag ttcaacaaga ctatggatac cggtgaccct 1680

ttgacattcc aatcttttag ctacgcaact atcaacacag cttttacatt cccaatgagc 1740

cagagtagct tcacagtagg tgctgacact ttcagctcag ggaatgaagt ttacatcgac 1800

aggtttgaat tgattccagt tactgcaacc ctcgaggctg agtacaacct tgagagagcc 1860

cagaaggctg tgaacgccct ctttacctcc accaatcagc ttggcttgaa aactaacgtt 1920

actgactatc acattgacca agtgtccaac ttggtcacct accttagcga tgagttctgc 1980

ctcgacgaga agcgtgaact ctccgagaaa gttaaacacg ccaagcgtct cagcgacgag 2040

aggaatctct tgcaagactc caacttcaaa gacatcaaca ggcagccaga acgtggttgg 2100

ggtggaagca ccgggatcac catccaagga ggcgacgatg tgttcaagga gaactacgtc 2160

accctctccg gaactttcga cgagtgctac cctacctact tgtaccagaa gatcgatgag 2220

tccaaactca aagccttcac caggtatcaa cttagaggct acatcgaaga cagccaagac 2280

cttgaaatct actcgatcag gtacaatgcc aagcacgaga ccgtgaatgt cccaggtact 2340

ggttccctct ggccactttc tgcccaatct cccattggga agtgtggaga gcctaacaga 2400

tgcgctccac accttgagtg gaatcctgac ttggactgct cctgcaggga tggcgagaag 2460

tgtgcccacc attctcatca cttctccttg gacatcgatg tgggatgtac tgacctgaat 2520

gaggacctcg gagtctgggt catcttcaag atcaagaccc aagacggaca cgcaagactt 2580

ggcaaccttg agtttctcga agagaaacca ttggtcggtg aagctctcgc tcgtgtgaag 2640

agagcagaga agaagtggag ggacaaacgt gagaaactcg aatgggaaac taacatcgtt 2700

tacaaggagg ccaaagagtc cgtggatgct ttgttcgtga actcccaata tgatcagttg 2760

caagccgaca ccaacatcgc catgatccac gccgcagaca aacgtgtgca cagcattcgt 2820

gaggcttact tgcctgagtt gtccgtgatc cctggtgtga acgctgccat cttcgaggaa 2880

cttgagggac gtatctttac cgcattctcc ttgtacgatg ccagaaacgt catcaagaac 2940

ggtgacttca acaatggcct cagctgctgg aatgtgaaag gtcatgtgga cgtggaggaa 3000

cagaacaatc agcgttccgt cctggttgtg cctgagtggg aagctgaagt gtcccaagag 3060

gttagagtct gtccaggtag aggctacatt ctccgtgtga ccgcttacaa ggagggatac 3120

ggtgagggtt gcgtgaccat ccacgagatc gagaacaaca ccgacgagct taagttctcc 3180

aactgcgtcg aggaagaaat ctatcccaac aacaccgtta cttgcaacga ctacactgtg 3240

aatcaggaag agtacggagg tgcctacact agccgtaaca gaggttacaa cgaagctcct 3300

tccgttcctg ctgactatgc ctccgtgtac gaggagaaat cctacacaga tggcagacgt 3360

gagaaccctt gcgagttcaa cagaggttac agggactaca caccacttcc agttggctat 3420

gttaccaagg agcttgagta ctttcctgag accgacaaag tgtggatcga gatcggtgaa 3480

accgagggaa ccttcatcgt ggacagcgtg gagcttctct tgatggagga ataa 3534

<210> 11

<211> 634

<212> PRT

<213>artificial sequence-Cry2Ab amino acid sequence (Artificial Sequence)

<400> 11

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 12

<211> 1905

<212> DNA

<213>artificial sequence-Cry2Ab nucleotide sequence (Artificial Sequence)

<400> 12

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 13

<211> 1148

<212> PRT

<213>artificial sequence-Cry1Fa amino acid sequence (Artificial Sequence)

<400> 13

Met Glu Asn Asn Ile Gln Asn Gln Cys Val Pro Tyr Asn Cys Leu Asn

1 5 10 15

Asn Pro Glu Val Glu Ile Leu Asn Glu Glu Arg Ser Thr Gly Arg Leu

20 25 30

Pro Leu Asp Ile Ser Leu Ser Leu Thr Arg Phe Leu Leu Ser Glu Phe

35 40 45

Val Pro Gly Val Gly Val Ala Phe Gly Leu Phe Asp Leu Ile Trp Gly

50 55 60

Phe Ile Thr Pro Ser Asp Trp Ser Leu Phe Leu Leu Gln Ile Glu Gln

65 70 75 80

Leu Ile Glu Gln Arg Ile Glu Thr Leu Glu Arg Asn Arg Ala Ile Thr

85 90 95

Thr Leu Arg Gly Leu Ala Asp Ser Tyr Glu Ile Tyr Ile Glu Ala Leu

100 105 110

Arg Glu Trp Glu Ala Asn Pro Asn Asn Ala Gln Leu Arg Glu Asp Val

115 120 125

Arg Ile Arg Phe Ala Asn Thr Asp Asp Ala Leu Ile Thr Ala Ile Asn

130 135 140

Asn Phe Thr Leu Thr Ser Phe Glu Ile Pro Leu Leu Ser Val Tyr Val

145 150 155 160

Gln Ala Ala Asn Leu His Leu Ser Leu Leu Arg Asp Ala Val Ser Phe

165 170 175

Gly Gln Gly Trp Gly Leu Asp Ile Ala Thr Val Asn Asn His Tyr Asn

180 185 190

Arg Leu Ile Asn Leu Ile His Arg Tyr Thr Lys His Cys Leu Asp Thr

195 200 205

Tyr Asn Gln Gly Leu Glu Asn Leu Arg Gly Thr Asn Thr Arg Gln Trp

210 215 220

Ala Arg Phe Asn Gln Phe Arg Arg Asp Leu Thr Leu Thr Val Leu Asp

225 230 235 240

Ile Val Ala Leu Phe Pro Asn Tyr Asp Val Arg Thr Tyr Pro Ile Gln

245 250 255

Thr Ser Ser Gln Leu Thr Arg Glu Ile Tyr Thr Ser Ser Val Ile Glu

260 265 270

Asp Ser Pro Val Ser Ala Asn Ile Pro Asn Gly Phe Asn Arg Ala Glu

275 280 285

Phe Gly Val Arg Pro Pro His Leu Met Asp Phe Met Asn Ser Leu Phe

290 295 300

Val Thr Ala Glu Thr Val Arg Ser Gln Thr Val Trp Gly Gly His Leu

305 310 315 320

Val Ser Ser Arg Asn Thr Ala Gly Asn Arg Ile Asn Phe Pro Ser Tyr

325 330 335

Gly Val Phe Asn Pro Gly Gly Ala Ile Trp Ile Ala Asp Glu Asp Pro

340 345 350

Arg Pro Phe Tyr Arg Thr Leu Ser Asp Pro Val Phe Val Arg Gly Gly

355 360 365

Phe Gly Asn Pro His Tyr Val Leu Gly Leu Arg Gly Val Ala Phe Gln

370 375 380

Gln Thr Gly Thr Asn His Thr Arg Thr Phe Arg Asn Ser Gly Thr Ile

385 390 395 400

Asp Ser Leu Asp Glu Ile Pro Pro Gln Asp Asn Ser Gly Ala Pro Trp

405 410 415

Asn Asp Tyr Ser His Val Leu Asn His Val Thr Phe Val Arg Trp Pro

420 425 430

Gly Glu Ile Ser Gly Ser Asp Ser Trp Arg Ala Pro Met Phe Ser Trp

435 440 445

Thr His Arg Ser Ala Thr Pro Thr Asn Thr Ile Asp Pro Glu Arg Ile

450 455 460

Thr Gln Ile Pro Leu Val Lys Ala His Thr Leu Gln Ser Gly Thr Thr

465 470 475 480

Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr

485 490 495

Ser Gly Gly Pro Phe Ala Tyr Thr Ile Val Asn Ile Asn Gly Gln Leu

500 505 510

Pro Gln Arg Tyr Arg Ala Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu

515 520 525

Arg Ile Tyr Val Thr Val Ala Gly Glu Arg Ile Phe Ala Gly Gln Phe

530 535 540

Asn Lys Thr Met Asp Thr Gly Asp Pro Leu Thr Phe Gln Ser Phe Ser

545 550 555 560

Tyr Ala Thr Ile Asn Thr Ala Phe Thr Phe Pro Met Ser Gln Ser Ser

565 570 575

Phe Thr Val Gly Ala Asp Thr Phe Ser Ser Gly Asn Glu Val Tyr Ile

580 585 590

Asp Arg Phe Glu Leu Ile Pro Val Thr Ala Thr Leu Glu Ala Glu Ser

595 600 605

Asp Leu Glu Arg Ala Gln Lys Ala Val Asn Ala Leu Phe Thr Ser Ser

610 615 620

Asn Gln Ile Gly Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp Arg

625 630 635 640

Val Ser Asn Leu Val Glu Cys Leu Ser Asp Glu Phe Cys Leu Asp Glu

645 650 655

Lys Lys Glu Leu Ser Glu Lys Val Lys His Ala Lys Arg Leu Ser Asp

660 665 670

Glu Arg Asn Leu Leu Gln Asp Pro Asn Phe Arg Gly Ile Asn Arg Gln

675 680 685

Leu Asp Arg Gly Trp Arg Gly Ser Thr Asp Ile Thr Ile Gln Gly Gly

690 695 700

Asp Asp Val Phe Lys Glu Asn Tyr Val Thr Leu Leu Gly Thr Phe Asp

705 710 715 720

Glu Cys Tyr Pro Thr Tyr Leu Tyr Gln Lys Ile Asp Glu Ser Lys Leu

725 730 735

Lys Ala Tyr Thr Arg Tyr Gln Leu Arg Gly Tyr Ile Glu Asp Ser Gln

740 745 750

Asp Leu Glu Ile Tyr Leu Ile Arg Tyr Asn Ala Lys His Glu Thr Val

755 760 765

Asn Val Pro Gly Thr Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser Pro

770 775 780

Ile Gly Lys Cys Ala His His Ser His His Phe Ser Leu Asp Ile Asp

785 790 795 800

Val Gly Cys Thr Asp Leu Asn Glu Asp Leu Gly Val Trp Val Ile Phe

805 810 815

Lys Ile Lys Thr Gln Asp Gly His Ala Arg Leu Gly Asn Leu Glu Phe

820 825 830

Leu Glu Glu Lys Pro Leu Val Gly Glu Ala Leu Ala Arg Val Lys Arg

835 840 845

Ala Glu Lys Lys Trp Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu Thr

850 855 860

Asn Ile Val Tyr Lys Glu Ala Lys Glu Ser Val Asp Ala Leu Phe Val

865 870 875 880

Asn Ser Gln Tyr Asp Arg Leu Gln Ala Asp Thr Asn Ile Ala Met Ile

885 890 895

His Ala Ala Asp Lys Arg Val His Ser Ile Arg Glu Ala Tyr Leu Pro

900 905 910

Glu Leu Ser Val Ile Pro Gly Val Asn Ala Ala Ile Phe Glu Glu Leu

915 920 925

Glu Gly Arg Ile Phe Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn Val

930 935 940

Ile Lys Asn Gly Asp Phe Asn Asn Gly Leu Ser Cys Trp Asn Val Lys

945 950 955 960

Gly His Val Asp Val Glu Glu Gln Asn Asn His Arg Ser Val Leu Val

965 970 975

Val Pro Glu Trp Glu Ala Glu Val Ser Gln Glu Val Arg Val Cys Pro

980 985 990

Gly Arg Gly Tyr Ile Leu Arg Val Thr Ala Tyr Lys Glu Gly Tyr Gly

995 1000 1005

Glu Gly Cys Val Thr Ile His Glu Ile Glu Asn Asn Thr Asp Glu Leu

1010 1015 1020

Lys Phe Ser Asn Cys Val Glu Glu Glu Val Tyr Pro Asn Asn Thr Val

1025 1030 1035 1040

Thr Cys Asn Asp Tyr Thr Ala Thr Gln Glu Glu Tyr Glu Gly Thr Tyr

1045 1050 1055

Thr Ser Arg Asn Arg Gly Tyr Asp Gly Ala Tyr Glu Ser Asn Ser Ser

1060 1065 1070

Val Pro Ala Asp Tyr Ala Ser Ala Tyr Glu Glu Lys Ala Tyr Thr Asp

1075 1080 1085

Gly Arg Arg Asp Asn Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp Tyr

1090 1095 1100

Thr Pro Leu Pro Ala Gly Tyr Val Thr Lys Glu Leu Glu Tyr Phe Pro

1105 1110 1115 1120

Glu Thr Asp Lys Val Trp Ile Glu Ile Gly Glu Thr Glu Gly Thr Phe

1125 1130 1135

Ile Val Asp Ser Val Glu Leu Leu Leu Met Glu Glu

1140 1145

<210> 14

<211> 3447

<212> DNA

<213>artificial sequence-Cry1Fa nucleotide sequence (Artificial Sequence)

<400> 14

atggagaaca acatacagaa tcagtgcgtc ccctacaact gcctcaacaa tcctgaagta 60

gagattctca acgaagagag gtcgactggc agattgccgt tagacatctc cctgtccctt 120

acacgtctcc tgttgtctga gtttgttcca ggtgtgggag ttgcgtttgg cctcttcgac 180

ctcatctggg gcttcatcac tccatctgat tggagcctct ttcttctcca gattgaacag 240

ttgattgaac aaaggattga gaccttggaa aggaatcggg ccatcactac ccttcgtggc 300

ttagcagaca gctatgagat ctacattgaa gcactaagag agtgggaagc caatcctaac 360

aatgcccaac tgagagaaga tgtgcgtata cgctttgcta acacagatga tgctttgatc 420

acagccatca acaacttcac ccttaccagc ttcgagatcc ctcttctctc ggtctatgtt 480

caagctgcta acctgcactt gtcactactg cgcgacgctg tgtcgtttgg gcaaggttgg 540

ggactggaca tagctactgt caacaatcac tacaacagac tcatcaatct gattcatcga 600

tacacgaaac attgtttgga tacctacaat cagggattgg agaacctgag aggtactaac 660

actcgccaat gggccaggtt caatcagttc aggagagacc ttacacttac tgtgttagac 720

atagttgctc tctttccgaa ctacgatgtt cgtacctatc cgattcaaac gtcatcccaa 780

cttacaaggg agatctacac cagttcagtc attgaagact ctccagtttc tgcgaacata 840

cccaatggtt tcaacagggc tgagtttgga gtcagaccac cccatctcat ggacttcatg 900

aactctttgt ttgtgactgc agagactgtt agatcccaaa ctgtgtgggg aggacactta 960

gttagctcac gcaacacggc tggcaatcgt atcaactttc ctagttacgg ggtcttcaat 1020

cccgggggcg ccatctggat tgcagatgaa gatccacgtc ctttctatcg gaccttgtca 1080

gatcctgtct tcgtccgagg aggctttggc aatcctcact atgtactcgg tcttagggga 1140

gtggcctttc aacaaactgg tacgaatcac acccgcacat tcaggaactc cgggaccatt 1200

gactctctag atgagatacc acctcaagac aacagcggcg caccttggaa tgactactcc 1260

catgtgctga atcatgttac ctttgtgcgc tggccaggtg agatctcagg ttccgactca 1320

tggagagcac caatgttctc ttggacgcat cgtagcgcta cccccacaaa caccattgat 1380

ccagagagaa tcactcagat tcccttggtg aaggcacaca cacttcagtc aggaactaca 1440

gttgtaagag ggccggggtt cacgggagga gacattcttc gacgcactag tggaggacca 1500

ttcgcgtaca ccattgtcaa catcaatggg caacttcccc aaaggtatcg tgccaggata 1560

cgctatgcct ctactaccaa tctaagaatc tacgttacgg ttgcaggtga acggatcttt 1620

gctggtcagt tcaacaagac aatggatacc ggtgatccac ttacattcca atctttctcc 1680

tacgccacta tcaacaccgc gttcaccttt ccaatgagcc agagcagttt cacagtaggt 1740

gctgatacct tcagttcagg caacgaagtg tacattgaca ggtttgagtt gattccagtt 1800

actgccacac tcgaggcaga gtctgacttg gaaagagcac agaaggcggt gaatgctctg 1860

ttcacttcgt ccaatcagat tgggctcaag acagatgtga ctgactatca catcgatcgc 1920

gtttccaacc ttgttgagtg cctctctgat gagttctgtt tggatgagaa gaaggagttg 1980

tccgagaagg tcaaacatgc taagcgactt agtgatgagc ggaacttgct tcaagatccc 2040

aactttcgcg ggatcaacag gcaactagat cgtggatgga ggggaagtac ggacatcacc 2100

attcaaggag gtgatgatgt gttcaaggag aactatgtta cgctcttggg tacctttgat 2160

gagtgctatc caacatacct gtaccagaag atagatgaat cgaaactcaa agcctacaca 2220

agataccagt tgagaggtta catcgaggac agtcaagacc ttgagatcta cctcatcaga 2280

tacaacgcca aacatgagac agtcaatgtg cctgggacgg gttcactctg gccactttca 2340

gccccaagtc ccatcggcaa gtgtgcccat cactcacacc acttctcctt ggacatagac 2400

gttggctgta ccgacctgaa cgaagacctc ggtgtgtggg tgatcttcaa gatcaagact 2460

caagatggcc atgccaggct aggcaatctg gagtttctag aagagaaacc acttgttgga 2520

gaagccctcg ctagagtgaa gagggctgag aagaagtgga gggacaagag agagaagttg 2580

gaatgggaaa caaacattgt gtacaaagaa gccaaagaaa gcgttgacgc tctgtttgtg 2640

aactctcagt atgataggct ccaagctgat accaacatag ctatgattca tgctgcagac 2700

aaacgcgttc atagcattcg ggaagcttac cttcctgaac ttagcgtgat tccgggtgtc 2760

aatgctgcta tctttgaaga gttagaaggg cgcatcttca ctgcattctc cttgtatgat 2820

gcgaggaatg tcatcaagaa tggtgacttc aacaatggcc tatcctgctg gaatgtgaaa 2880

gggcacgtag atgtagaaga acagaacaat caccgctctg tccttgttgt tcctgagtgg 2940

gaagcagaag tttcacaaga agttcgtgtc tgtcctggtc gtggctacat tcttcgtgtt 3000

accgcgtaca aagaaggata cggagaaggt tgcgtcacca tacacgagat tgagaacaac 3060

accgacgagc tgaagttcag caactgcgtc gaggaggaag tctacccaaa caacaccgta 3120

acttgcaatg actacactgc gactcaagag gagtatgagg gtacttacac ttctcgcaat 3180

cgaggatacg atggagccta tgagagcaac tcttctgtac ccgctgacta tgcatcagcc 3240

tatgaggaga aggcttacac cgatggacgt agggacaatc cttgcgaatc taacagaggc 3300

tatggggact acacaccgtt accagccggc tatgtcacca aagagttaga gtactttcca 3360

gaaaccgaca aggtttggat tgagattgga gaaacggaag gaacattcat tgttgatagc 3420

gtggagttac ttctgatgga ggaatga 3447

<210> 15

<211> 1322

<212> DNA

<213>arabidopsis (Arabidopsis thaliana)

<400> 15

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 16

<211> 530

<212> DNA

<213> Agrobacterium tumefaciens

<400> 16

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 17

<211> 529

<212> DNA

<213>promoter (Cauliflower mosaic virus)

<400> 17

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 18

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 18

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 19

<211> 195

<212> DNA

<213>terminator (Cauliflower mosaic virus)

<400> 19

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 20

<211> 1744

<212> DNA

<213>arabidopsis thaliana promoter is sub (Arabidopsis thaliana)

<400> 20

aattcaaatt tattatgtgt tttttttccg tggtcgagat tgtgtattat tctttagtta 60

ttacaagact tttagctaaa atttgaaaga atttacttta agaaaatctt aacatctgag 120

ataatttcag caatagatta tatttttcat tactctagca gtatttttgc agatcaatcg 180

caacatatat ggttgttaga aaaaatgcac tatatatata tatattattt tttcaattaa 240

aagtgcatga tatataatat atatatatat atatatgtgt gtgtgtatat ggtcaaagaa 300

attcttatac aaatatacac gaacacatat atttgacaaa atcaaagtat tacactaaac 360

aatgagttgg tgcatggcca aaacaaatat gtagattaaa aattccagcc tccaaaaaaa 420

aatccaagtg ttgtaaagca ttatatatat atagtagatc ccaaattttt gtacaattcc 480

acactgatcg aatttttaaa gttgaatatc tgacgtagga tttttttaat gtcttacctg 540

accatttact aataacattc atacgttttc atttgaaata tcctctataa ttatattgaa 600

tttggcacat aataagaaac ctaattggtg atttatttta ctagtaaatt tctggtgatg 660

ggctttctac tagaaagctc tcggaaaatc ttggaccaaa tccatattcc atgacttcga 720

ttgttaaccc tattagtttt cacaaacata ctatcaatat cattgcaacg gaaaaggtac 780

aagtaaaaca ttcaatccga tagggaagtg atgtaggagg ttgggaagac aggcccagaa 840

agagatttat ctgacttgtt ttgtgtatag ttttcaatgt tcataaagga agatggagac 900

ttgagaagtt ttttttggac tttgtttagc tttgttgggc gttttttttt ttgatcaata 960

actttgttgg gcttatgatt tgtaatattt tcgtggactc tttagtttat ttagacgtgc 1020

taactttgtt gggcttatga cttgttgtaa catattgtaa cagatgactt gatgtgcgac 1080

taatctttac acattaaaca tagttctgtt ttttgaaagt tcttattttc atttttattt 1140

gaatgttata tatttttcta tatttataat tctagtaaaa ggcaaatttt gcttttaaat 1200

gaaaaaaata tatattccac agtttcacct aatcttatgc atttagcagt acaaattcaa 1260

aaatttccca tttttattca tgaatcatac cattatatat taactaaatc caaggtaaaa 1320

aaaaggtatg aaagctctat agtaagtaaa atataaattc cccataagga aagggccaag 1380

tccaccaggc aagtaaaatg agcaagcacc actccaccat cacacaattt cactcataga 1440

taacgataag attcatggaa ttatcttcca cgtggcatta ttccagcggt tcaagccgat 1500

aagggtctca acacctctcc ttaggccttt gtggccgtta ccaagtaaaa ttaacctcac 1560

acatatccac actcaaaatc caacggtgta gatcctagtc cacttgaatc tcatgtatcc 1620

tagaccctcc gatcactcca aagcttgttc tcattgttgt tatcattata tatagatgac 1680

caaagcacta gaccaaacct cagtcacaca aagagtaaag aagaacaatg gcttcctcta 1740

tgct 1744

<210> 21

<211> 515

<212> DNA

<213>cassava vein mosaic virus promoters (Manihot esculenta)

<400> 21

ccagaaggta attatccaag atgtagcatc aagaatccaa tgtttacggg aaaaactatg 60

gaagtattat gtgagctcag caagaagcag atcaatatgc ggcacatatg caacctatgt 120

tcaaaaatga agaatgtaca gatacaagat cctatactgc cagaatacga agaagaatac 180

gtagaaattg aaaaagaaga accaggcgaa gaaaagaatc ttgaagacgt aagcactgac 240

gacaacaatg aaaagaagaa gataaggtcg gtgattgtga aagagacata gaggacacat 300

gtaaggtgga aaatgtaagg gcggaaagta accttatcac aaaggaatct tatcccccac 360

tacttatcct tttatatttt tccgtgtcat ttttgccctt gagttttcct atataaggaa 420

ccaagttcgg catttgtgaa aacaagaaaa aatttggtgt aagctatttt ctttgaagta 480

ctgaggatac aagttcagag aaatttgtaa gtttg 515

<210> 22

<211> 22

<212> DNA

<213>artificial sequence-primer 1 (Artificial Sequence)

<400> 22

gagggtgttg tggctggtat tg 22

<210> 23

<211> 23

<212> DNA

<213>artificial sequence-primer 2 (Artificial Sequence)

<400> 23

tctcaactgt ccaatcgtaa gcg 23

<210> 24

<211> 25

<212> DNA

<213>artificial sequence-probe 1 (Artificial Sequence)

<400> 24

cttacgctgg gccctggaag gctag 25

Claims (15)

1. it is a kind of control three-spotted plusia pest method, which is characterized in that including by three-spotted plusia pest at least with Cry1A albumen Contact.

2. the method for control three-spotted plusia pest according to claim 1, which is characterized in that the Cry1A albumen exists In the host cell at least generating the Cry1A albumen, the three-spotted plusia pest is by ingesting the host cell at least It is contacted with the Cry1A albumen.

3. the method for control three-spotted plusia pest according to claim 2, which is characterized in that the Cry1A albumen exists In the bacterium or genetically modified plants at least generating the Cry1A albumen, the three-spotted plusia pest passes through the bacterium that ingests Or the tissue of genetically modified plants is at least contacted with the Cry1A albumen, the three-spotted plusia pest growth is suppressed after contact And/or lead to death, to realize the control for endangering three-spotted plusia plant.

4. the method for control three-spotted plusia pest according to claim 3, which is characterized in that the group of the genetically modified plants It is woven to root, blade, stalk, fruit, tassel, female fringe, anther or filigree.

5. it is according to claim 3 or 4 control three-spotted plusia pest method, which is characterized in that the plant be soybean, Mung bean, cowpea, rape, wild cabbage, cauliflower, Chinese cabbage, radish.

6. the method for control three-spotted plusia pest according to any one of claims 1 to 5, which is characterized in that the Cry1A Albumen is Cry1Ab albumen, Cry1Ac albumen or Cry1A.105 albumen.

7. the method for control three-spotted plusia pest according to claim 6, which is characterized in that the Cry1A albumen has SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, amino acid sequence shown in SEQ ID NO:7 or SEQ ID NO:9.

8. the method for control three-spotted plusia pest according to claim 7, which is characterized in that the Cry1A albumen has SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, nucleotides sequence shown in SEQ ID NO:8 or SEQ ID NO:10 Column.

9. according to the method for the described in any item control three-spotted plusia pests of claim 3 to 8, which is characterized in that the plant It further include second of nucleotide of at least one nucleotide for being different from encoding the Cry1A albumen.

10. the method for control three-spotted plusia pest according to claim 9, which is characterized in that second of the nucleotide Encode Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, alpha-amylase or peroxidase.

11. the method for control three-spotted plusia pest according to claim 10, which is characterized in that second of the nucleotide Encode Vip3A albumen, Cry2Ab albumen or Cry1Fa albumen.

12. the method for control three-spotted plusia pest according to claim 11, which is characterized in that second of the nucleotide Coding has amino acid sequence shown in SEQ ID NO:11 or SEQ ID NO:13.

13. the method for control three-spotted plusia pest according to claim 12, which is characterized in that second of the nucleotide With nucleotide sequence shown in SEQ ID NO:12 or SEQ ID NO:14.

14. the method for control three-spotted plusia pest according to claim 9, which is characterized in that second of the nucleotide For the dsRNA for inhibiting important gene in target insect pests.

15. a kind of purposes of Cry1A protein control three-spotted plusia pest.