CN109679992B

CN109679992B - Use of insecticidal proteins

Info

Publication number: CN109679992B
Application number: CN201910098030.3A
Authority: CN
Inventors: 谢香庭; 杨淑靖; 任振涛
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2019-01-31
Filing date: 2019-01-31
Publication date: 2023-04-28
Anticipated expiration: 2039-01-31
Also published as: CN109679992A

Abstract

The invention relates to an application of insecticidal protein, which comprises the following steps: the spodoptera littoralis pest is contacted with at least Vip3Aa protein. The invention controls the noctuid insect pests by producing Vip3Aa protein in the plant body, which can kill the noctuid; compared with the agricultural control method, the physical control method, the biological control method and the chemical control method used in the prior art, the invention protects the plants in the whole growth period and the whole plants to prevent and treat the attack of the noctuid pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Description

Use of insecticidal proteins

Technical Field

The invention relates to an application of insecticidal protein, in particular to an application of Vip3Aa protein in controlling spodoptera litura to be a pest plant by expressing the protein in the plant.

Background

The spodoptera litura Argyrogramma agnata belongs to the lepidoptera spodoptera and is mainly distributed in Yangtze river basin and yellow river basin of China, and is one of main soybean pests in main soybean producing areas of China. The spodoptera litura is a multi-feeding pest, mainly is a plurality of crops such as beans, rape, cabbage, broccoli, cabbage, radish and other cruciferous vegetables, and has the following harmful characteristics: the larvae eat the leaves to cause scars and holes, and the leaves are eaten out when serious occurs, so that the yield is affected. The cultivated soybean (Glycine max (l.) Merri) is an important cash crop planted globally as a main source of vegetable oil and vegetable protein, and is an important food crop in china. The soybean is one of the plants most favored by the spodoptera litura, and the grain loss of different degrees is caused by the spodoptera litura each year, so that the yield is reduced by 1-2 for the light people and 3-4 for the heavy people. In order to control the spodoptera litura, agricultural control, chemical control, physical control and biological control are commonly used as main methods.

The agricultural control is to comprehensively coordinate and manage multiple factors of the whole farmland ecological system, regulate and control crops, pests and environmental factors, and create a farmland ecological environment which is favorable for the growth of crops and unfavorable for the generation of spodoptera litura. If winter ploughing and deep ploughing are carried out on the field with more larvae at the last generation of autumn, part of overwintering pupae can be directly killed, the deeply buried pupae cannot emerge from soil, and the pupae exposed on the surface can be predated or air-dried by natural enemies such as birds and the like to die, so that the number of the insect population in the next year can be greatly reduced. Because most of agricultural prevention and control are preventive measures, the application has a certain limitation, the agricultural prevention and control cannot be used as an emergency measure, and the agricultural prevention and control cannot be used when the spodoptera litura erupts.

The chemical control, namely pesticide control, is an important component for killing pests by utilizing chemical pesticides, is an important component for comprehensive control of the spodoptera litura, has the characteristics of rapidness, convenience, simplicity and high economic benefit, and is an indispensable emergency measure especially under the condition that the spodoptera litura happens greatly. The existing chemical control method mainly comprises liquid medicine spraying and powder medicine spraying, and has good control effect before 3 years of spodoptera litura larvae, at this time, the larvae have small feed and weak drug resistance, and the 1-2-year larva stage can be determined according to the peak period of the adult under-lamp trapping, or the control time can be determined according to the pest shape of the early-age larvae. The wettable powder of 2.5% deltamethrin, 4.5% beta-cypermethrin, 5% abamectin, 5% chlorfluazuron emulsifiable concentrate or 10% imidacloprid is usually selected to be prepared into 1000-1500 times of liquid for spraying. Meanwhile, chemical control has the limitation that improper use often leads to crop injury and drug resistance of pests, kills natural enemies and pollutes the environment, and leads to the adverse consequences of damage to the farmland ecological system, threat of pesticide residues to the safety of people and livestock, and the like.

The physical control mainly utilizes various physical factors such as light, electricity, color, temperature and humidity and mechanical equipment to trap and kill and radiate sterility and the like to control pests according to the reactions of the pests to various physical factors in environmental conditions. When adults are contained, the adults are trapped and killed by using a net puff or lamplight. By utilizing the strong phototaxis of the spodoptera litura adults, a black light lamp is arranged in the eclosion period to trap and kill the adults so as to reduce the egg falling quantity and the larva density in the field; however, the black light lamp needs to clean dirt on the optical filter every day in time, otherwise, the emission of black light is influenced, and the insecticidal effect is further influenced; the stability requirement on the power supply voltage is high, and the danger of hurting eyes of people is also caused in operation; in addition, the one-time investment for installing the lamp is large.

Biological control is to control the population quantity of pests by using certain beneficial organisms or biological metabolites so as to achieve the aim of reducing or eliminating the pests, such as selecting pesticides with low toxicity to natural enemies, and adjusting the application time according to the difference between the pests and the field occurrence period of the natural enemies, so as to avoid the application of the pesticides when the natural enemies occur in a large quantity to protect the natural enemies; secondly, the preparation such as the rice bud worm, the melanoma and the agate bees or the bacillus thuringiensis SD-5, the silver vein moth nuclear polyhedrosis virus and the like can be manually put in to control the silver vein moth. The method is characterized by safety to human and livestock, less environmental pollution and long-term control of certain pests; however, the effect is often unstable, and the same investment is required for the noctuid to occur regardless of the weight of the noctuid.

In order to solve the limitations of agricultural control, chemical control, physical control and biological control in practical application, scientists have found that insect-resistant genes from bacillus thuringiensis encoding insecticidal proteins are transferred into plants, and some insect-resistant transgenic plants can be obtained to control plant insect pests.

Vip3Aa insecticidal protein is one of many insecticidal proteins, a specific protein produced by bacillus thuringiensis. Vip3Aa proteins have a poisoning effect on sensitive insects by eliciting apoptosis-type apoptosis. The Vip3Aa protein is hydrolyzed in the insect gut to 4 major protein products, of which only one protein hydrolysis product (66 KD) is the toxic core structure of the Vip3Aa protein. Vip3Aa protein binds to the midgut epithelial cells of sensitive insects, initiating apoptosis, causing lysis of midgut epithelial cells leading to insect death. Does not cause any symptoms to non-sensitive insects, and does not cause apoptosis and dissolution of midgut epithelial cells.

Plants transformed with the Vip3Aa gene have been shown to be resistant to lepidopteran (Lepidoptera) pests such as cutworm, cotton bollworm and spodoptera frugiperda, however, there has been no report to date that controlling spodoptera frugiperda is harmful to plants by producing transgenic plants expressing Vip3Aa protein.

Disclosure of Invention

The invention aims to provide an application of insecticidal protein, and provides a method for controlling the harm of spodoptera litura to plants by generating transgenic plants expressing Vip3Aa protein for the first time, and the technical defects of agricultural control, chemical control, physical control, biological control and the like in the prior art are effectively overcome.

To achieve the above object, the present invention provides a method for controlling spodoptera litura pests, comprising contacting the spodoptera litura pests with at least Vip3Aa protein.

Further, the Vip3Aa protein is present in a host cell that produces at least the Vip3Aa protein, and the spodoptera litura pest is contacted with at least the Vip3Aa protein by feeding the host cell.

Still further, the Vip3Aa protein is present in a bacterium or transgenic plant producing at least the Vip3Aa protein, and the spodoptera litura pest is contacted with at least the Vip3Aa protein by ingestion of tissue of the bacterium or transgenic plant, and after the contacting, growth of the spodoptera litura pest is inhibited and/or caused to die, to achieve control of a spodoptera litura-endangered plant.

The tissue of the transgenic plant is root, leaf, stem, fruit, tassel, female spike, anther or filament.

The plant is soybean, mung bean, cowpea, rape, cabbage, cauliflower, cabbage, and radish.

The transgenic plant may be in any stage of fertility.

The control of the plant endangered by the spodoptera litura is not changed by changing the planting place and/or the planting time.

The step preceding the contacting step is planting a plant containing a polynucleotide encoding the Vip3Aa protein.

Preferably, the amino acid sequence of the Vip3Aa protein has the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 3. The nucleotide sequence of the Vip3Aa protein has the nucleotide sequence shown as SEQ ID NO. 2 or SEQ ID NO. 4.

On the basis of the above technical solutions, the plant may further comprise at least one second nucleotide different from the nucleotide encoding the Vip3Aa protein.

Further, the second nucleotide encodes a Cry-type insecticidal protein, a Vip-type insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In the present invention, expression of the Vip3Aa protein in a transgenic plant can be accompanied by expression of one or more Cry-type insecticidal proteins and/or Vip-type insecticidal proteins. Co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering to include and express the desired genes in the plant. In addition, one plant (parent 1) can express Vip3Aa protein by genetic engineering operations and a second plant (parent 2) can express Cry-type insecticidal protein and/or Vip-type insecticidal protein by genetic engineering operations. Progeny plants expressing all genes introduced into the 1 st parent and the 2 nd parent are obtained by crossing the 1 st parent and the 2 nd parent.

Preferably, the second nucleotide encodes a Cry1Ab or a Cry2Ab protein.

Further, the amino acid sequence of the Cry1Ab protein has the amino acid sequence shown in SEQ ID NO. 5. The nucleotide sequence of the Cry1Ab protein has the nucleotide sequence shown in SEQ ID NO. 6. The amino acid sequence of the Cry2Ab protein has the amino acid sequence shown in SEQ ID NO. 7. The nucleotide sequence of the Cry2Ab protein has the nucleotide sequence shown in SEQ ID NO. 8.

Alternatively, the second nucleotide is a dsRNA that inhibits an important gene in the insect pest of interest.

In order to achieve the purpose, the invention also provides an application of the Vip3Aa protein in controlling the noctuid insect pests.

To achieve the above object, the present invention also provides a method for producing a plant for controlling spodoptera litura pest, comprising introducing into the genome of said plant a polynucleotide sequence encoding Vip3Aa protein.

To achieve the above object, the present invention also provides a method for producing a plant propagule for controlling a spodoptera litura pest, comprising crossing a first plant obtained by the method with a second plant, and/or removing a tissue having reproductive ability from the plant obtained by the method and culturing, thereby producing a plant propagule containing a polynucleotide sequence encoding a Vip3Aa protein.

To achieve the above object, the present invention also provides a method of culturing a plant for controlling spodoptera litura pest, comprising:

planting at least one plant propagule comprising in its genome a polynucleotide sequence encoding a Vip3Aa protein;

growing the plant propagules into plants;

growing the plant under conditions in which the spodoptera litura pest and/or the spodoptera litura pest naturally occur to be compromised, and harvesting a plant having reduced plant damage and/or increased plant yield as compared to other plants not having the polynucleotide sequence encoding the Vip3Aa protein.

"plant propagules" as used herein include, but are not limited to, plant sexual propagules and plant asexual propagules. Such plant propagules include, but are not limited to, plant seeds; the plant vegetative propagation body refers to a vegetative organ or a special tissue of a plant body, which can produce a new plant under ex vivo conditions; the vegetative organ or a particular tissue includes, but is not limited to, roots, stems and leaves, such as: plants using roots as vegetative propagation bodies include strawberries, sweet potatoes and the like; plants with stems as vegetative propagation material include sugarcane, potato (tuber) and the like; plants with leaves as vegetative propagation material include aloe and begonia etc.

The term "contacting" as used herein refers to touching, staying and/or feeding, in particular touching, staying and/or feeding by insects and/or vermin, a plant, plant organ, plant tissue or plant cell, which plant, plant organ, plant tissue or plant cell may be either expressing insecticidal proteins in its body or which plant, plant organ, plant tissue or plant cell has insecticidal proteins on its surface and/or has microorganisms producing insecticidal proteins.

By "controlling" and/or "controlling" as used herein means that the noctuid pest is contacted with at least Vip3Aa protein, and after the contacting, the noctuid pest is inhibited from growing and/or causing death. Further, the noctuid pest is contacted with at least Vip3Aa protein by feeding plant tissue, and after the contact, all or part of the noctuid pest growth is inhibited and/or death is caused. Inhibition refers to sublethal, i.e., not yet lethal but can cause some effect on growth, behavior, physiology, biochemistry, and tissues, such as slow and/or cessation of growth. At the same time, the plants should be morphologically normal and can be cultivated in conventional methods for consumption and/or production of the product. In addition, plants and/or plant seeds containing a polynucleotide sequence encoding Vip3Aa protein that controls spodoptera litura pest have reduced plant damage, including but not limited to improved leaf resistance, and/or increased grain weight, and/or increased yield, as compared to non-transgenic wild type plants, under conditions in which artificial inoculation of the spodoptera litura pest and/or spodoptera litura pest naturally occurs to be compromised. The "controlling" and/or "controlling" effect of the Vip3Aa protein on spodoptera litura can be independent, in particular, any tissue of the transgenic plant (containing the polynucleotide sequence encoding the Vip3Aa protein) is present and/or produced simultaneously and/or asynchronously, the Vip3Aa protein and/or another substance which can control spodoptera litura pests, the presence of which Vip3Aa cannot lead to the "controlling" and/or "controlling" effect being effected wholly and/or partly by the other substance, independently of the Vip3Aa protein. In general, in the field, the ingestion of plant tissue by the noctuid pest is short and difficult to observe visually, and therefore, under conditions in which the noctuid pest is artificially inoculated and/or the noctuid pest is naturally harmful, such as the presence of dead noctuid pest in any tissue of the transgenic plant (containing the polynucleotide sequence encoding Vip3Aa protein), and/or the growth-inhibited noctuid pest remaining thereon, and/or the plant damage having a reduced level as compared with a non-transgenic wild-type plant, the method and/or use of the present invention is achieved, i.e., the method and/or use of the present invention is achieved by contacting the noctuid pest with at least Vip3Aa protein.

RNA interference (RNAi) refers to the phenomenon of highly conserved, highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution. Thus, RNAi technology can be used in the present invention to specifically knock out or shut down expression of a specific gene in a target insect pest, particularly a gene associated with the growth and development of the target insect pest.

The adult of the spodoptera litura has a grey brown body with a length of 15-17mm, a dark brown front wing, 2 silver transverse lines, 1 silver white triangle plaque and a horseshoe-like silver white plaque in the center. The back wing is dark brown and has metallic luster. The back of the chest has two clusters of longer and longer brown scale hairs. The egg is hemispherical, 0.4-0.5mm long, milky white in initial production, light yellow green after initial production, and the surface of egg shell has reticulate pattern. The larvae are 5 years old, the mature larvae are 25-32mm, the larvae are light green, the larvae are thin at the front and thick at the back, 6 longitudinal white fine lines are arranged at the back of the larvae, the valve lines are black, and the 1 st pair and the 2 nd pair of the larvae are degenerated and are bent and stretched during walking. The pupa length is 18-20mm, the body is thin, the early ventral surface is green, the whole body is black brown in the later period, the throttle holes of the abdomen 1 and 2 are obviously protruded, the tail is thorn a pair, and the cocoon is thin.

The spodoptera litura is widely distributed in China and mainly distributed in Yangtze river basin and yellow river basin. The generation numbers of the spodoptera littoralis are different in each year, the generation numbers of the spodoptera littoralis are 2-3 generations in Ningxia, about 3-4 generations in Hebei and Jiangsu, about 5-6 generations in Hunan and Hubei, and 7 generations in Guangzhou, and the spodoptera littoralis winters with pupa. The adult can emerge in the next 4 months, and the adult enters the full spawning period after 4-5 days after emerging. The eggs are scattered and produced on the leaf backs. The most spawning occurs in the 2 nd to 3 rd generation, and adults are provided with phototaxis and chemotaxis at night. The newly hatched larvae usually take mesophyll on the leaf backs, leave the epidermis, take tender leaves after 3 years of age to form holes, and the food intake is greatly increased. Larvae are 5 years old, have death, and can roll off the ground after being frightened. At room temperature, the larval stage is about 10 days. Mature larvae are subjected to white silk spitting on the back of the host leaves to form cocoons and pupations. Adults can still appear from the end of 11 months to the beginning of 12 months. The pest degree of the spodoptera litura is mainly influenced by the number of insect source bases and the temperature and humidity, and the high humidity and the low temperature in summer are beneficial to the occurrence of the spodoptera litura, but the occurrence of the heavy rain in the egg stage and the early larva stage is not beneficial to the occurrence of the heavy rain.

In classification systems, lepidoptera are generally classified into suborder, general, family, etc. mainly based on morphological characteristics such as pulse sequence, linkage pattern, type of antenna, etc. of adult wings. While the noctuidae is the most abundant family in lepidoptera, more than 2 tens of thousands have been found worldwide, and only a few thousand have been recorded in china. Most noctuidae insects are pests of crops, and can eat leaves, moth bolls and the like, such as cotton bollworms, prodenia litura and the like. Although cotton bollworms, prodenia litura and the like and silver vein noctuid belong to the lepidoptera noctuid family, the similarity exists in the classification standard, and the great difference exists in other morphological structures; as compared with the strawberry in the plant, the strawberry in the plant is the same as the apple (belonging to Rosaceae of Rosales), the strawberry has the characteristics of flower amphiprotic property, radiation symmetry, petal 5 pieces and the like, but the fruits and plant forms are quite different. However, people are more or less in the form of insects because of less exposure to insects, particularly to agricultural pests, and less concern about differences in the form of insects. In fact, spodoptera litura has its unique characteristics, both from a larval and adult form. For example, the heads of the prodenia litura larvae are black brown, the breasts are changeable, and the prodenia litura larvae are all black and green from turkish yellow; the prodenia litura adults are dark brown, white cluster hair is arranged on the back of the chest, and the front wings are gray brown with multiple patterns. While the spodoptera litura larvae belonging to the noctuidae are light green; the adult silver vein moths are grey brown, two clusters of longer brown scale hairs are erected on the back of the chest, and the front wings are dark brown and have silvery white specks.

Insects belonging to the genus noctuid have not only a large difference in morphological characteristics but also a difference in feeding habits. For example, cotton bolls or corn ear, which are cotton bollworms of the nocturnal family and are the cotton to be damaged by boring, prodenia litura is more preferred to bite leaves, only leaves of main pulse, and has extremely wide host range, but also can damage nearly 100 or 300 plants including melons, eggplants, beans, green onions, leeks, spinach, cruciferous vegetables, grains, cash crops and the like, while the host range of the silver vein noctuid is relatively concentrated on cruciferous vegetables and legume crops, and is mainly the damage of leaves. The difference in feeding habits also implies that the enzymes and receptor proteins produced by the digestive system in vivo are different. The enzyme produced in the digestive tract is a key point of the action of Bt genes, and only the enzyme or receptor protein capable of being combined with specific Bt genes can possibly enable a certain Bt gene to have insect-resistant effect on the insect. More and more studies have shown that insects of different orders, even different species of the same family, behave differently in terms of sensitivity to the same Bt protein. For example, the Vip3Aa gene showed anti-insect activity against both chilo suppressalis Chilo suppressalis and asian corn borer Ostrinia furnacalis of the borer family, but the Vip3Aa gene had no anti-insect effect against indian meal moth Plodia interpunctella and european corn borer Ostrinia nubilalis of the same genus of the borer family. All the above-mentioned pests belong to the Lepidoptera moth family, but the homologous Bt proteins show different resistance effects on the above-mentioned moth pests. In particular, european corn borer and Asian corn borer are classified even in Ostrinia (the same family and genus) belonging to the family of borer, but the reactions to the same Bt proteins are quite different, which more fully suggests that the interaction modes of Bt proteins with in vivo enzymes and receptors of insects are complex and unexpected.

The genome of a plant, plant tissue or plant cell as used herein refers to any genetic material within a plant, plant tissue or plant cell and includes the nuclear and plastid and mitochondrial genomes.

The polynucleotides and/or nucleotides described herein form an intact "gene" that encodes a protein or polypeptide in a desired host cell. One skilled in the art will readily recognize that polynucleotides and/or nucleotides of the invention may be placed under the control of regulatory sequences in a host of interest.

As is well known to those skilled in the art, DNA is typically present in double stranded form. In this arrangement, one strand is complementary to the other strand and vice versa. Other complementary strands of DNA are produced as a result of DNA replication in plants. Thus, the present invention includes the use of the polynucleotides exemplified in the sequence listing and their complementary strands. "coding strand" as commonly used in the art refers to the strand that is associated with the antisense strand. To express a protein in vivo, one strand of DNA is typically transcribed into a complementary strand of mRNA, which is translated into the protein as a template. mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (codons are three nucleotides, three at a time can produce a particular amino acid) which can be read as an Open Reading Frame (ORF) to form a protein or peptide of interest. The invention also includes RNAs that are functional equivalent to the exemplified DNAs.

The nucleic acid molecules according to the invention or fragments thereof hybridize under stringent conditions to the Vip3Aa gene according to the invention. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Vip3Aa gene of the invention. The nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain conditions. In the present invention, two nucleic acid molecules can be said to specifically hybridize to each other if they form an antiparallel double-stranded nucleic acid structure. Two nucleic acid molecules are said to be "complements" of one nucleic acid molecule if they exhibit complete complementarity. In the present invention, a nucleic acid molecule is said to exhibit "complete complementarity" when each nucleotide of the two molecules is complementary to a corresponding nucleotide of the other nucleic acid molecule. Two nucleic acid molecules are said to be "minimally complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under at least conventional "low stringency" conditions. Similarly, two nucleic acid molecules are said to have "complementarity" if they are capable of hybridizing to each other with sufficient stability such that they anneal and bind to each other under conventional "highly stringent" conditions. Deviations from complete complementarity are permissible provided that such deviations do not completely prevent the formation of double-stranded structures by the two molecules. In order to enable a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure sufficient complementarity in sequence to allow the formation of a stable double-stranded structure at the particular solvent and salt concentration employed.

In the present invention, a substantially homologous sequence is a nucleic acid molecule that specifically hybridizes to the complementary strand of a matching nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 XSSC/sodium citrate (SSC) at about 45℃followed by washing with 2.0 XSSC at 50℃are well known to those skilled in the art. For example, the salt concentration in the washing step may be selected from about 2.0 XSSC at low stringency conditions, about 0.2 XSSC at 50℃to high stringency conditions, about 50 ℃. In addition, the temperature conditions in the washing step may be raised from about 22 ℃ at room temperature under low stringency conditions to about 65 ℃ under high stringency conditions. The temperature conditions and salt concentration may both be varied, or one may remain unchanged while the other variable is varied. Preferably, the stringent conditions described in the present invention may be specific hybridization with SEQ ID NO. 2 and SEQ ID NO. 4 in 6 XSSC, 0.5% SDS solution at 65℃followed by washing the membrane 1 time with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

Thus, sequences which have insecticidal activity and which hybridize under stringent conditions to SEQ ID NO. 2 and SEQ ID NO. 4 of the present invention are included in the present invention. These sequences are at least about 40% -50% homologous, about 60%, 65% or 70% homologous, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence homology to the sequences of the present invention.

Genes and proteins described herein include not only the specific exemplified sequences, but also portions and/or fragments (including internal and/or terminal deletions as compared to the full-length protein), variants, mutants, substitutions (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the pesticidal activity characteristics of the specific exemplified proteins. By "variant" or "variation" is meant a nucleotide sequence encoding the same protein or encoding an equivalent protein having pesticidal activity. By "equivalent protein" is meant a protein having the same or substantially the same biological activity against spodoptera litura pests as the protein of the claims.

"fragment" or "truncation" of a DNA molecule or protein sequence as used herein refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) or an artificial engineered version thereof (e.g., a sequence suitable for plant expression), which may vary in length but is of sufficient length to ensure that the (encoded) protein is an insect toxin.

The genes can be modified and gene variants can be readily constructed using standard techniques. For example, techniques for making point mutations are well known in the art. Also for example, U.S. patent No. 5605793 describes methods for generating additional molecular diversity using DNA reassembly after random fragmentation. Fragments of full-length genes can be made using commercial endonucleases, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cleave nucleotides from the ends of these genes. A variety of restriction enzymes can also be used to obtain genes encoding active fragments. The active fragments of these toxins can be obtained directly using proteases.

The present invention can derive equivalent proteins and/or genes encoding such equivalent proteins from Bt isolates and/or DNA libraries. There are various methods for obtaining the insecticidal proteins of the present invention. For example, antibodies to the insecticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from protein mixtures. In particular, antibodies may be caused by the portion of the protein that is most constant and most different from other Bt proteins. These antibodies can then be used to specifically identify equivalent proteins with characteristic activity by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blot methods. Antibodies to the proteins disclosed in the present invention or equivalent proteins or fragments of such proteins can be readily prepared using procedures standard in the art. Genes encoding these proteins can then be obtained from the microorganism.

Due to the redundancy of the genetic code, a variety of different DNA sequences may encode the same amino acid sequence. The generation of these alternative DNA sequences encoding the same or substantially the same protein is within the skill level of those skilled in the art. These different DNA sequences are included within the scope of the present invention. The term "substantially identical" refers to sequences having amino acid substitutions, deletions, additions or insertions that do not substantially affect insecticidal activity, and also includes fragments that retain insecticidal activity.

Substitution, deletion or addition of amino acid sequences in the present invention is a routine technique in the art, and preferably such amino acid changes are: small characteristic changes, i.e., conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of about 1-30 amino acids; small amino-or carboxy-terminal extensions, such as amino-terminal extensions of one methionine residue; small connecting peptides, e.g., about 20-25 residues long.

Examples of conservative substitutions are those within the following amino acid groups: basic amino acids (e.g., arginine, lysine, and histidine), acidic amino acids (e.g., glutamic acid and aspartic acid), polar amino acids (e.g., glutamine, asparagine), hydrophobic amino acids (e.g., leucine, isoleucine, and valine), aromatic amino acids (e.g., phenylalanine, tryptophan, and tyrosine), and small molecule amino acids (e.g., glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that do not generally alter a particular activity are well known in the art and have been described, for example, by N.Neurath and R.L.Hill in Protein published by New York Academic Press (Academic Press) 1979. The most common exchanges are Ala/Ser, val/Ile, asp/Glu, thu/Ser, ala/Thr, ser/Asn, ala/Val, ser/Gly, tyr/Phe, ala/Pro, lys/Arg, asp/Asn, leu/Ile, leu/Val, ala/Glu and Asp/Gly, and vice versa.

It will be apparent to those skilled in the art that such substitutions may occur outside the region of interest for molecular function, and still produce an active polypeptide. For polypeptides of the invention, amino acid residues which are essential for their activity and which are therefore selected to be unsubstituted, can be identified according to methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (see, e.g., cunningham and Wells,1989,Science 244:1081-1085). The latter technique is to introduce mutations at each positively charged residue in the molecule, and to examine the insecticidal activity of the resulting mutant molecules, thereby determining amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site may also be determined by analysis of its three-dimensional structure, which may be determined by techniques such as nuclear magnetic resonance analysis, crystallography or photoaffinity labelling (see, e.g., de Vos et al 1992,Science 255:306-312; smith et al 1992,J.Mol.Biol 224:899-904; wlodaver et al 1992,FEBS Letters 309:59-64).

In the present invention, the Vip3Aa protein includes, but is not limited to, amino acid sequences having a certain homology with the amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 3. These sequences typically have greater than 60%, preferably greater than 75%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99% similarity/identity to the sequences of the present invention. Preferred polynucleotides and proteins of the invention may also be defined in terms of more specific identity and/or similarity ranges. For example, there is 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity and/or similarity to the sequences exemplified in the present invention.

The regulatory sequences of the present invention include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operably linked to the Vip3Aa protein.

The promoter is an expressible promoter in a plant, and the expression promoter in the plant refers to a promoter which ensures that a coding sequence connected with the promoter is expressed in a plant cell. The promoter expressible in the plant may be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, 35S promoters derived from cauliflower mosaic virus, arabidopsis Ubi10 promoter, maize Ubi promoter, promoters of rice GOS2 gene, and the like. Alternatively, the promoter that is expressible in a plant may be a tissue-specific promoter, i.e. the promoter directs higher expression of the coding sequence in some tissues of the plant, such as in green tissues, than in other tissues of the plant (as may be determined by conventional RNA assays), such as the PEP carboxylase promoter. Alternatively, the promoter expressible in the plant may be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs the pattern of wound-induced expression refers to a promoter that significantly increases expression of a coding sequence under the control of the promoter when the plant is subjected to a wound caused by mechanical or insect feeding, as compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of the protease inhibitor genes (pinI and pinII) and the maize protease inhibitor gene (MPI) of potato and tomato.

The transit peptide (also known as a secretion signal sequence or targeting sequence) is directed to direct the transgene product to a specific organelle or cellular compartment, and may be heterologous to the receptor protein, for example, targeting to the chloroplast using a sequence encoding a chloroplast transit peptide, or to the endoplasmic reticulum using a 'KDEL' retention sequence, or to the vacuole using CTPP of the barley plant lectin gene.

Such leader sequences include, but are not limited to, picornaviral leader sequences, such as EMCV leader sequences (encephalomyocarditis virus 5' non-coding region); potyvirus leader sequences, such as MDMV (maize dwarf mosaic virus) leader sequences; human immunoglobulin heavy chain binding proteins (bips); a non-translated leader sequence of alfalfa mosaic virus coat protein mRNA (AMV RNA 4); tobacco Mosaic Virus (TMV) leader sequence.

Such enhancers include, but are not limited to, the cauliflower mosaic virus (CaMV) enhancer, the Figwort Mosaic Virus (FMV) enhancer, the carnation weathered ring virus (CERV) enhancer, the cassava vein mosaic virus (CsVMV) enhancer, the Mirabilis jalapa mosaic virus (MMV) enhancer, the night yellow leaf curl virus (CmYLCV) enhancer, the Multan cotton leaf curl virus (CLCuMV), the Commelina maculosa refute virus (CoYMV), and the peanut chlorosis line mosaic virus (PCLSV) enhancer.

For monocot applications, the introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicot applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "superubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence for functioning in plants, including, but not limited to, a polyadenylation signal sequence derived from the Agrobacterium (Agrobacterium tumefaciens) nopaline synthase (NOS) gene, a polyadenylation signal sequence derived from the protease inhibitor II (pin II) gene, a polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and a polyadenylation signal sequence derived from the alpha-tubulin (alpha-tubulin) gene.

"operably linked" as used herein refers to a linkage of nucleic acid sequences such that one sequence provides the desired function for the linked sequences. In the present invention, the term "operably linked" may be used to link a promoter to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "operably linked" when a sequence of interest encodes a protein and it is desired to obtain expression of the protein means: the promoter is linked to the sequence in such a way that the resulting transcript is efficiently translated. If the linkage of the promoter to the coding sequence is a transcript fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made such that the first translation initiation codon contained in the 5' untranslated sequence is linked to the promoter and the linkage is such that the resulting translational product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that can be "operably linked" include, but are not limited to: sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 'untranslated regions, introns, protein coding regions, 3' untranslated regions, polyadenylation sites and/or transcription terminators), sequences that provide DNA transfer and/or integration functions (i.e., T-DNA border sequences, site-specific recombinase recognition sites, integrase recognition sites), sequences that provide selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scorable marker functions, sequences that assist sequence manipulation in vitro or in vivo (i.e., polylinker sequences, site-specific recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomous replication sequences, centromere sequences).

"insecticidal" or "insect-resistant" as used herein means being toxic to crop pests, thereby achieving "control" and/or "control" of the crop pests. Preferably, the term "insecticidal" or "insect-resistant" refers to killing crop pests. More specifically, the target insect is a spodoptera litura pest.

The Vip3Aa protein has toxicity to noctuid pests. Plants, particularly soybeans, in the present invention contain in their genome exogenous DNA comprising a nucleotide sequence encoding a Vip3Aa protein with which a spodoptera littoralis pest is contacted by feeding plant tissue, the growth of which is inhibited and/or which causes death. Inhibition refers to mortality or submortality. At the same time, the plants should be morphologically normal and can be cultivated in conventional methods for consumption and/or production of the product. In addition, the plant may substantially eliminate the need for a chemical or biological pesticide (which is a pesticide against the noctuid pest targeted by Vip3Aa protein).

The level of Insecticidal Crystal Protein (ICP) expression in plant material can be detected by a variety of methods described in the art, such as by quantitating the mRNA encoding the insecticidal protein produced in the tissue using specific primers, or by directly specifically detecting the amount of insecticidal protein produced.

Different tests can be applied to determine the insecticidal effect of ICP in plants. The target insect in the invention is mainly silver vein moth.

In the invention, the Vip3Aa protein can have amino acid sequences shown in SEQ ID NO. 1 and SEQ ID NO. 3 in a sequence table. In addition to the coding region comprising the Vip3Aa protein, other elements may be included, such as a protein encoding a selectable marker.

In addition, expression cassettes comprising a nucleotide sequence encoding the Vip3Aa protein of the invention may also be expressed in plants along with at least one protein encoding a herbicide resistance gene, including, but not limited to, a glufosinate resistance gene (e.g., bar gene, pat gene), a bendiquat resistance gene (e.g., pmph gene), a glyphosate resistance gene (e.g., EPSPS gene), a bromoxynil resistance gene, a sulfonylurea resistance gene, a resistance to herbicide thatch, a resistance to cyanamide, or a resistance to a glutamine synthetase inhibitor (e.g., PPT), to obtain transgenic plants having both high pesticidal activity and herbicide resistance.

In the present invention, exogenous DNA is introduced into a plant, such as a gene encoding the Vip3Aa protein or an expression cassette or recombinant vector, into a plant cell, and conventional transformation methods include, but are not limited to, agrobacterium-mediated transformation, microprojectile bombardment, direct DNA uptake into protoplasts, electroporation, or whisker-silicon-mediated DNA introduction.

The invention provides a method for controlling pests, which has the following advantages:

1. preventing and treating endogenous factors. The prior art mainly controls the harm of the noctuid pests through external action, namely external factor, such as agricultural control, chemical control, physical control and biological control; the invention controls the noctuid insect pests by producing Vip3Aa protein in the plant body, which can inhibit the growth of the noctuid, namely, the noctuid insect pests are controlled by an internal factor.

2. No pollution and no residue. Although the chemical control method used in the prior art plays a certain role in controlling the harm of the noctuid pests, the chemical control method also brings pollution, damage and residues to human, livestock and farmland ecosystems; the method for controlling the noctuid insect pests can eliminate the adverse effects.

3. And (5) preventing and controlling in the whole growth period. The method for controlling the spodoptera litura pests used in the prior art is staged, and the method protects plants in the whole growth period, and transgenic plants (Vip 3Aa protein) can resist the attack of the spodoptera litura from germination, growth, flowering and fruiting.

4. And (5) whole plant prevention and control. The method for controlling the noctuid insect pest used in the prior art is mostly local, such as foliar spraying; the invention protects the whole plant, such as the root, leaf, stem, fruit, tassel, female spike, anther and the like of the transgenic plant (Vip 3Aa protein), and can resist the invasion of the spodoptera litura.

5. The effect is stable. The frequency vibration type insecticidal lamp used in the prior art not only needs to clean dirt of a high-voltage power grid every day in time, but also cannot be used in thunder and rain days; the Vip3Aa protein is expressed in a plant body, so that the defect that the effect of the frequency vibration type insecticidal lamp is influenced by external factors is effectively overcome, and the control effect of the transgenic plant (Vip 3Aa protein) is stable and consistent in different places, different times and different genetic backgrounds.

6. Simple, convenient and economic. The frequency vibration type insecticidal lamp used in the prior art has the disadvantages of large disposable investment, improper operation and danger of injury to people by electric shock; the invention only needs to plant the transgenic plant capable of expressing the Vip3Aa protein, and does not need to adopt other measures, thereby saving a great deal of manpower, material resources and financial resources.

7. The effect is thorough. The method for controlling the noctuid insect pests used in the prior art has the advantages that the effect is incomplete, and only the effect of reducing is achieved; the control effect of the transgenic plant (Vip 3Aa protein) on the initially hatched larvae of the spodoptera litura is almost hundred percent, the extremely individual surviving larvae also basically stop developing, the larvae basically stay in the initially hatched state after 3 days, obvious dysplasia is generated, the larvae stop developing, the larvae cannot survive in the natural environment of the field, and the transgenic plant is basically only slightly damaged.

The technical scheme of the invention is further described in detail through the drawings and the embodiments.

Drawings

FIG. 1 is a flow chart of construction of recombinant cloning vector DBN01-T containing Vip3Aa-01 nucleotide sequence for use of the insecticidal protein of the present invention;

FIG. 2 is a flow chart showing construction of recombinant expression vector DBN100002 containing Vip3Aa-01 nucleotide sequence for use of the insecticidal protein of the present invention.

Detailed Description

The following is a detailed description of the use of the insecticidal proteins of the present invention.

First example, gene acquisition and Synthesis

1. Obtaining the nucleotide sequence

The amino acid sequence (789 amino acids) of the Vip3Aa-01 insecticidal protein is shown as SEQ ID NO. 1 in a sequence table; the nucleotide sequence (2370 nucleotides) of Vip3Aa, which codes for the amino acid sequence of the insecticidal protein corresponding to Vip3Aa, is shown as SEQ ID NO. 2 in the sequence table.

The amino acid sequence (789 amino acids) of the Vip3Aa-02 insecticidal protein is shown as SEQ ID NO. 3 in a sequence table; the nucleotide sequence (2370 nucleotides) of Vip3Aa-02 which codes for the amino acid sequence of said Vip3Aa-02 insecticidal protein is shown in SEQ ID NO. 4 of the sequence Listing.

The amino acid sequence (615 amino acids) of the Cry1Ab insecticidal protein is shown as SEQ ID NO. 5 in a sequence table; and a Cry1Ab nucleotide sequence (1848 nucleotides) which codes for an amino acid sequence corresponding to the Cry1Ab insecticidal protein, as shown in SEQ ID NO. 6 of the sequence list.

The amino acid sequence (634 amino acids) of the Cry2Ab insecticidal protein is shown as SEQ ID NO 7 in a sequence table; and a Cry2Ab nucleotide sequence (1905 nucleotides) which codes for an amino acid sequence corresponding to the Cry2Ab insecticidal protein is shown as SEQ ID NO. 8 in the sequence table.

2. Synthesis of the nucleotide sequence

Synthesizing the Vip3Aa-01 nucleotide sequence (shown as SEQ ID NO:2 in a sequence table), the Vip3Aa-02 nucleotide sequence (shown as SEQ ID NO:4 in the sequence table), the Cry1Ab nucleotide sequence (shown as SEQ ID NO:6 in the sequence table) and the Cry2Ab nucleotide sequence (shown as SEQ ID NO:8 in the sequence table); the 5 'end of the synthesized Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2) is also connected with a Sca I cleavage site, and the 3' end of the Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2) is also connected with a Spe I cleavage site; the 5 'end of the synthesized Vip3Aa-02 nucleotide sequence (SEQ ID NO: 4) is also connected with a Sca I cleavage site, and the 3' end of the Vip3Aa-02 nucleotide sequence (SEQ ID NO: 4) is also connected with a Spe I cleavage site; the 5 'end of the synthesized Cry1Ab nucleotide sequence (SEQ ID NO: 6) is also connected with a Kas I restriction enzyme site, and the 3' end of the Cry1Ab nucleotide sequence (SEQ ID NO: 6) is also connected with a BamH I restriction enzyme site; the 5 'end of the Cry2Ab nucleotide sequence (SEQ ID NO: 8) is also connected with an Nco I restriction enzyme site, and the 3' end of the Cry2Ab nucleotide sequence (SEQ ID NO: 8) is also connected with a SpeI restriction enzyme site.

Second example, construction of recombinant expression vector and transformation of Agrobacterium with recombinant expression vector

1. Construction of recombinant cloning vector containing Vip3Aa Gene

The synthesized nucleotide sequence of Vip3Aa-01 is connected to a cloning vector pGEM-T (Promega, madison, USA, CAT: A3600), the operation steps are carried out according to the instruction of the Promega company product pGEM-T vector, and the construction flow of the inverted recombinant cloning vector DBN01-T is shown in the figure 1 (wherein, amp represents an ampicillin resistance gene, f1ori represents the replication origin of phage f1, lacZ is the lacZ codon, SP6 is an SP6RNA polymerase promoter, T7 is a T7RNA polymerase promoter, vip3Aa-01 is a Vip3Aa-01 nucleotide sequence (SEQ ID NO: 2), and MCS is a multiple cloning site).

Then, the recombinant cloning vector DBN01-T is transformed into competent cells of the escherichia coli T1 (Transgen, beijin, china, CAT: CD 501) by a heat shock method, wherein the heat shock conditions are as follows: 50. Mu.L of E.coli T1 competent cells, 10. Mu.L of plasmid DNA (recombinant cloning vector DBN 01-T), 42℃water bath for 30s; shaking culture was carried out at 37℃for 1 hour (shaking of shaking table at 100 rpm), and grown overnight on LB plates (tryptone 10g/L, yeast extract 5g/L, naCl g/L, agar 15g/L, pH was adjusted to 7.5 with NaOH) coated with IPTG (isopropyl thio-. Beta. -D-galactoside) and X-gal (5-bromo-4-chloro-3-indol-. Beta. -D-galactoside) in ampicillin (100 mg/L). White colonies were picked and cultured overnight in LB liquid medium (tryptone 10g/L, yeast extract 5g/L, naCl g/L, ampicillin 100mg/L, pH 7.5 adjusted with NaOH) at 37 ℃. Extracting the plasmid by an alkaline method: centrifuging the bacterial solution at 12000rpm for 1min, removing supernatant, and suspending the precipitated bacterial cells with 100 μl of ice-precooled solution I (25 mM Tris-HCl, 10mM EDTA (ethylenediamine tetraacetic acid), 50mM glucose, pH 8.0); 200. Mu.L of freshly prepared solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)) was added, the tube was inverted 4 times, mixed, and placed on ice for 3-5min; adding 150 μl ice-cold solution III (3M potassium acetate, 5M acetic acid), immediately mixing, and standing on ice for 5-10min; centrifuging at 4deg.C and 12000rpm for 5min, adding 2 times volume of absolute ethanol into the supernatant, mixing, and standing at room temperature for 5min; centrifuging at 4deg.C and 12000rpm for 5min, removing supernatant, washing precipitate with 70% ethanol (V/V), and air drying; adding 30. Mu.L of TE (10 mM Tris-HCl, 1mM EDTA, pH 8.0) containing RNase (20. Mu.g/ml) to dissolve the precipitate; digesting RNA in a water bath at 37 ℃ for 30 min; preserving at-20deg.C for use.

After the extracted plasmid is subjected to enzyme digestion identification by Sca I and Spe I, sequencing verification is carried out on positive clones, and the result shows that the nucleotide sequence of Vip3Aa-01 inserted in the recombinant cloning vector DBN01-T is the nucleotide sequence shown in SEQ ID NO. 2 in the sequence table, namely, the nucleotide sequence of Vip3Aa-01 is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3Aa-02 nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein Vip3Aa-02 is the Vip3Aa-02 nucleotide sequence (SEQ ID NO: 4). And (3) enzyme digestion and sequencing to verify that the Vip3Aa-02 nucleotide sequence in the recombinant cloning vector DBN02-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN03-T, wherein the Cry1Ab is a Cry1Ab nucleotide sequence (SEQ ID NO: 6). And (3) enzyme digestion and sequencing to verify that the Cry1Ab nucleotide sequence in the recombinant cloning vector DBN03-T is correctly inserted.

According to the method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry2Ab nucleotide sequence is connected to the cloning vector pGEM-T to obtain the recombinant cloning vector DBN04-T, wherein the Cry2Ab is a Cry2Ab nucleotide sequence (SEQ ID NO: 8). And (3) enzyme digestion and sequencing to verify that the Cry2Ab nucleotide sequence in the recombinant cloning vector DBN04-T is correctly inserted.

2. Construction of recombinant expression vector containing Vip3Aa Gene

Recombinant cloning vectors DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from CAMBIA mechanism)) were digested with restriction enzymes Sca I and Spe I, respectively, and a cut-out Vip3Aa-01 nucleotide sequence fragment was inserted between Sca I and Spe I sites of expression vector DBNBC-01, and the vector was constructed by conventional digestion methods, as is well known to those skilled in the art, to construct a recombinant expression vector DBN100002, the construction procedure of which was shown in FIG. 2 (Kan: kanamycin gene; RB: right border; prAtUbi10: arabidopsis Ubiquitin gene promoter (SEQ ID NO: 9); vip3Aa-01: vip3Aa-01 nucleotide sequence (SEQ ID NO: 2); tNos: terminator of nopaline synthase gene (SEQ ID NO: 10); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 11); pat. In Acetylphosphine transfer gene (SEQ ID NO: 12); cauliflower mosaic virus 35S border 35S).

The recombinant expression vector DBN100002 is used for transforming competent cells of the escherichia coli T1 by a heat shock method, and the heat shock conditions are as follows: 50. Mu.L of E.coli T1 competent cells, 10. Mu.L of plasmid DNA (recombinant expression vector DBN 100002), 42℃in a water bath for 30s; shake culturing at 37deg.C for 1 hr (shaking table at 100 rpm); then, the cells were cultured on LB solid plates (tryptone 10g/L, yeast extract 5g/L, naCl g/L, agar 15g/L, pH was adjusted to 7.5 with NaOH) containing 50mg/L Kanamycin at 37℃for 12 hours, white colonies were picked up, and cultured on LB liquid medium (tryptone 10g/L, yeast extract 5g/L, naCl g/10 g/L, kanamycin 50mg/L, pH was adjusted to 7.5 with NaOH) at 37℃for overnight. Extracting the plasmid by an alkaline method. The extracted plasmid is identified after restriction enzyme Sca I and Spe I are used for enzyme digestion, and positive clone is sequenced and identified, and the result shows that the nucleotide sequence of the recombinant expression vector DBN100002 between Sca I and Spe I sites is the nucleotide sequence shown in SEQ ID NO. 2 in a sequence table, namely the Vip3Aa-01 nucleotide sequence

According to the method for constructing the recombinant vector DBN100002, the Vip3Aa-02 nucleotide sequence cut by the Sca I and Spe I enzyme-digested recombinant cloning vector DBN02-T is inserted into an expression vector DBNBC-01, so that the recombinant vector DBN100741 is obtained. The nucleotide sequence in the recombinant expression vector DBN100741 is verified by enzyme digestion and sequencing to contain a nucleotide sequence shown as SEQ ID NO. 4 in a sequence table, namely a Vip3Aa-02 nucleotide sequence, wherein the Vip3Aa-02 nucleotide sequence can be connected with the praTUBI10 promoter and the tNos terminator.

According to the method for constructing the recombinant vector DBN100002, sca I, speI, kas I and BamH I are respectively digested and recombined to clone the vector DBN02-T and the Vip3Aa-02 nucleotide sequence and Cry1Ab nucleotide sequence cut off by the vector DBN03-T are inserted into an expression vector DBNBC-01, so that the recombinant expression vector DBN100003 is obtained. The nucleotide sequence in the recombinant expression vector DBN100003 is verified by enzyme digestion and sequencing to contain the nucleotide sequences shown as SEQ ID NO. 4 and SEQ ID NO. 6 in a sequence table, namely a Vip3Aa-02 nucleotide sequence and a Cry1Ab nucleotide sequence.

According to the method for constructing the recombinant vector DBN100002, sca I, spe I, nco I and Spe I are respectively digested and recombined to clone the vector DBN02-T and the Vip3Aa-02 nucleotide sequence and Cry2Ab nucleotide sequence cut off by the DBN04-T are inserted into an expression vector DBNBC-01, so that the recombinant expression vector DBN100370 is obtained. The nucleotide sequence in the recombinant expression vector DBN100370 is verified by enzyme digestion and sequencing to contain the nucleotide sequences shown as SEQ ID NO. 4 and SEQ ID NO. 8 in a sequence table, namely a Vip3Aa-02 nucleotide sequence and a Cry2Ab nucleotide sequence.

3. Recombinant expression vector transformation of agrobacterium

The recombinant expression vectors DBN100002, DBN100741, DBN100003 and DBN100370 which have been constructed correctly were transformed into Agrobacterium LBA4404 (Invitrogen, chicago, USA, CAT: 18313-015) by the liquid nitrogen method under the following transformation conditions: 100. Mu.L of Agrobacterium LBA4404, 3. Mu.L of plasmid DNA (recombinant expression vector); placing in liquid nitrogen for 10min, and warm water bath at 37deg.C for 10min; the transformed agrobacterium LBA4404 is inoculated in an LB test tube and cultured for 2 hours at the temperature of 28 ℃ and the rotating speed of 200rpm, and is coated on an LB plate containing 50mg/L of Rifampicin (Rifampicin) and 100mg/L of kanamycin until positive monoclonals are grown, the monoclonals are selected for culture, plasmids of the monoclonals are extracted, restriction endonucleases are used for enzyme digestion of recombinant expression vectors DBN100002, DBN100741, DBN100003 and DBN100370, and the results show that the structures of the recombinant expression vectors DBN100002, DBN100741, DBN100003 and DBN100370 are completely correct.

Third example, obtaining transgenic plants

1. Obtaining transgenic soybean plants

The cotyledonary node tissue of yellow 13 in the soybean variety subjected to aseptic culture was co-cultured with agrobacterium as described in the second example 3 according to the conventionally employed agrobacterium infection method to transfer the recombinant expression vectors DBN100002, DBN100741, DBN100003 and DBN100370 constructed in the second example 2 (including the promoter sequence of the arabidopsis ubiquitin gene, vip3Aa-01 nucleotide sequence, vip3Aa-02-Cry1Ab nucleotide sequence, vip3Aa-02-Cry2Ab nucleotide sequence, PAT gene and tNos terminator sequence) into the soybean genome to obtain soybean plants transferred with Vip3Aa-01 nucleotide sequence, soybean plants transferred with Vip3Aa-02-Cry1Ab nucleotide sequence and soybean plants transferred with Vip3Aa-01-Cry2 nucleotide sequence; wild type soybean plants were also used as controls.

For Agrobacterium-mediated transformation of soybean, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH 5.6), and the seeds were inoculated in germination cultureOn the base, the following conditions were used: the temperature is 25+/-1 ℃; the photoperiod (light/dark) was 16/8h. Taking the soybean aseptic seedlings which are expanded at the cotyledonary node and are fresh green after germination for 4-6 days, cutting off hypocotyls at the position 3-4mm below the cotyledonary node, longitudinally cutting off cotyledons, and removing terminal buds, lateral buds and seed roots. Wounding at the cotyledonary node with the back of a scalpel, contacting the wounded cotyledonary node tissue with an agrobacterium suspension, wherein the agrobacterium is capable of transferring the Vip3Aa nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step) in which the cotyledonary node tissue is preferably immersed in the agrobacterium suspension (OD ₆₆₀ =0.5-0.8), in an infection medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2-morpholinoethanesulfonic acid (MES) 4g/L, zeatin (ZT) 2mg/L, ph 5.3) to initiate inoculation. The cotyledonary node tissue was co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Preferably, the cotyledonary node tissue is cultured after the infection step on a solid medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES g/L, ZT 2mg/L, agar 8g/L, pH 5.6). After this co-cultivation stage, there may be an optional "recovery" step. In the "recovery" step, at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in the recovery medium (B5 salt 3.1g/L, B vitamin, MES1g/L, sucrose 30g/L, ZT mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH 5.6) without addition of a selection agent for plant transformants (step 3: recovery step). Preferably, the tissue mass regenerated from cotyledonary nodes is cultured on a solid medium with antibiotics but no selection agent to eliminate agrobacterium and provide a recovery period for the infected cells. Next, the cotyledonary node regenerated tissue pieces are cultured on a medium containing a selection agent (glufosinate) and the grown transformed calli are selected (step 4: selection step). Preferably, the cotyledonary node regenerated tissue pieces are cultured on a selective solid medium (B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, glufosinate 6mg/L, pH 5.6) with a selective agent, resulting in selective growth of the transformed cells. Transformed cells are then regenerated into plants The regenerated tissue mass of cotyledonary node grown on the medium containing the selection agent is preferably cultured on a solid medium (B5 differentiation medium and B5 rooting medium) to regenerate plants (step 5: regeneration step).

The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1g/L, B vitamin, MES1g/L, sucrose 30g/L, ZT mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, auxin 1mg/L, glufosinate 6mg/L, pH 5.6) and cultured at 25 ℃. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1g/L, B5 vitamin, MES1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole-3-butyric acid (IBA) 1 mg/L), cultured on rooting medium at 25℃to a height of about 10cm, and transferred to greenhouse for cultivation until set. In the greenhouse, the cells were cultured at 26℃for 16 hours per day and at 20℃for 8 hours.

Fourth example, taqMan verification of transgenic plants

About 100mg of leaf of the soybean plant into which the Vip3Aa-01 nucleotide sequence was transferred, the soybean plant into which the Vip3Aa-02-Cry1Ab nucleotide sequence was transferred, and the soybean plant into which the Vip3Aa-02-Cry1Ab nucleotide sequence was transferred were respectively taken as samples, their genomic DNA was extracted with DNeasy Plant Maxi Kit of Qiagen, and the copy number of PAT gene was detected by Taqman probe fluorescent quantitative PCR method to determine the copy number of Vip3Aa gene. Meanwhile, wild soybean plants are used as a control, and detection and analysis are carried out according to the method. Experiments were repeated 3 times and averaged.

The specific method for detecting the PAT gene copy number is as follows:

step 11, respectively taking 100mg of soybean plants transferred with a Vip3Aa-01 nucleotide sequence, soybean plants transferred with a Vip3Aa-02-Cry1Ab nucleotide sequence, soybean plants transferred with a Vip3Aa-02-Cry2Ab nucleotide sequence and leaves of wild soybean plants, respectively grinding into homogenates in a mortar by liquid nitrogen, and taking 3 samples each for repetition;

step 12, extracting genomic DNA of the sample by using DNeasy Plant Mini Kit of Qiagen, wherein the specific method refers to the product instruction;

step 13, determining the concentration of the genomic DNA of the sample by using NanoDrop 2000 (Thermo Scientific);

step 14, adjusting the concentration of the genomic DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 ng/mu L to 100 ng/mu L;

step 15, identifying the copy number of the sample by adopting a Taqman probe fluorescent quantitative PCR method, taking the sample with the identified known copy number as a standard substance, taking the sample of a wild soybean plant as a control, repeating each sample for 3 times, and taking an average value; the fluorescent quantitative PCR primer and the probe sequences are respectively as follows:

the following primers and probes were used to detect PAT nucleotide sequences:

Primer 1: gagggtgttgtggctggtattg is shown as SEQ ID NO. 14 in the sequence table;

primer 2: tctcaactgtccaatcgtaagcg is shown as SEQ ID NO. 15 in the sequence table;

probe 1: cttacgctgggccctggaaggctag is shown as SEQ ID NO. 16 in the sequence table;

the PCR reaction system is as follows:

the 50 Xprimer/probe mixture contained 45. Mu.L of each primer at a concentration of 1mM, 50. Mu.L of probe at a concentration of 100. Mu.M and 860. Mu.L of 1 XTE buffer, and was stored in amber tubes at 4 ℃.

The PCR reaction conditions were:

the data were analyzed using SDS2.3 software (Applied Biosystems).

Experimental results show that the Vip3A-01 nucleotide sequence, the Vip3Aa-02-Cry1Ab nucleotide sequence and the Vip3Aa-02-Cry2Ab nucleotide sequence are integrated into the chromosome group of the detected soybean plants, and the soybean plants transferred with the Vip3Aa-01 nucleotide sequence, the soybean plants transferred with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plants transferred with the Vip3Aa-02-Cry2Ab nucleotide sequence all obtain single copy transgenic soybean plants.

Fifth embodiment, insect-resistant Effect detection of transgenic plants

The soybean plants transferred with the nucleotide sequence of Vip3Aa-01, the soybean plants transferred with the nucleotide sequence of Vip3Aa-02-Cry1Ab, the soybean plants transferred with the nucleotide sequence of Vip3Aa-02-Cry2Ab, the wild soybean plants and the soybean plants identified as non-transgenic by Taqman are subjected to insect resistance effect detection.

Respectively taking fresh leaves of soybean plants transferred with a Vip3Aa-01 nucleotide sequence, soybean plants transferred with a Vip3Aa-02-Cry1Ab nucleotide sequence and soybean plants transferred with a Vip3Aa-02-Cry2Ab nucleotide sequence, wild soybean plants and soybean plants identified as non-transgenic by Taqman (three leaf period), washing with sterile water and sucking water on the leaves with gauze, cutting into strips of about 2cm multiplied by 3.5cm, placing 1 cut strip of leaves on moisturizing filter paper at the bottom of a circular plastic culture dish, placing 10 head spodoptera litura (initially hatched larva) in each culture dish, capping, and standing for 3 days under conditions of a temperature of 25-28 ℃ and a relative humidity of 70-80% and a photoperiod (light/dark) of 16:8, and obtaining three indexes of the development progress, mortality and leaf damage rate of the spodoptera litura, namely, total resistance score (300 minutes) of the whole score: total resistance = 100 x mortality + [100 x mortality +90 x (number of initially hatched insects/total number of grafted insects) +60 x (number of initially hatched negative control insects/total number of grafted insects) +10 x (number of negative control insects/total number of grafted insects) ] +100 x (1-leaf damage rate). A total of 3 strains (S1, S2, S3) into which the Vip3Aa-01 nucleotide sequence was transferred, a total of 3 strains (S4, S5, S6) into which the Vip3Aa-02 nucleotide sequence was transferred, a total of 3 transformation event strains (S7, S8, S9) into which the Vip3Aa-02-Cry1Ab nucleotide sequence was transferred, a total of 3 transformation event strains (S10, S11, S12) into which the Vip3Aa-02-Cry2Ab nucleotide sequence was transferred, a total of 1 strain identified as non-transgenic (NGM) by Taqman, a total of 1 strain of wild type (negative control, CK); 3 strains were selected from each strain for testing, each strain being repeated 1 time. The results are shown in Table 1.

Table 1, results of insect-resistant experiments of transgenic soybean plants inoculated with Spodoptera litura

The results in table 1 show that: the soybean plants transferred with the Vip3Aa-01 nucleotide sequence, the soybean plants transferred with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plants transferred with the Vip3Aa-02-Cry2Ab nucleotide sequence have good insecticidal effects on the spodoptera litura, the average death rate of the spodoptera litura is more than 90 percent, and the total resistance score of the spodoptera litura is more than 280 percent; the total resistance score of the non-transgenic soybean plants and wild-type soybean plants identified by Taqman is generally about 60 minutes.

Compared with wild soybean plants, soybean plants transferred with a Vip3Aa-01 nucleotide sequence, soybean plants transferred with a Vip3Aa-02-Cry1Ab nucleotide sequence and soybean plants transferred with a Vip3Aa-02-Cry2Ab nucleotide sequence can cause a great deal of death of the larva of the spodoptera litura, and cause great inhibition on development progress of a small part of surviving larva, the larva is basically still in an initial incubation state or is in a state between initial incubation and negative control states after 3 days, and the insect which is inhibited from developing can not survive under natural conditions; and the soybean plants transferred with the Vip3Aa-01 nucleotide sequence, the soybean plants transferred with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plants transferred with the Vip3Aa-02-Cry2Ab nucleotide sequence are basically only slightly damaged, and the leaf damage rate is below 7 percent.

From this, it was confirmed that the soybean plants into which the Vip3Aa-01 nucleotide sequence was transferred, the soybean plants into which the Vip3Aa-02-Cry1Ab nucleotide sequence was transferred, and the soybean plants into which the Vip3Aa-02-Cry2Ab nucleotide sequence was transferred all exhibited an activity for suppressing spodoptera litura, which was sufficient to exert an adverse effect on the growth of spodoptera litura so that it was controlled in the field.

The above experimental results also show that the control/control of the spodoptera litura by the soybean plants transferred with the Vip3Aa-01 nucleotide sequence, the soybean plants transferred with the Vip3Aa-02-Cry1Ab nucleotide sequence and the soybean plants transferred with the Vip3Aa-02-Cry2Ab nucleotide sequence is obviously because the plants themselves can produce Vip3Aa protein, so that the plants transferred with Vip3Aa protein can also produce at least one second insecticidal protein different from Vip3Aa protein, such as Cry type protein, according to the poisoning effect of Vip3Aa protein on the spodoptera litura.

In summary, the use of the insecticidal protein of the present invention controls the noctuid insect pest by producing Vip3Aa protein in the plant body capable of killing the noctuid; compared with the agricultural control method, the chemical control method, the physical control method and the biological control method used in the prior art, the invention protects the plants in the whole growth period and the whole plants to prevent and treat the attack of the noctuid pests, and has the advantages of no pollution, no residue, stable and thorough effect, simplicity, convenience and economy.

Finally, it should be noted that the above-mentioned embodiments are merely for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications and equivalents may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.

Sequence listing

<110> Beijing Dabei agricultural biotechnology Co., ltd

<120> use of insecticidal proteins

<130> DBNBC144

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 789

<212> PRT

<213> Artificial sequence-Vip 3Aa-01 amino acid sequence (Artificial Sequence)

<400> 1

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Ile Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 2

<211> 2370

<212> DNA

<213> Artificial sequence-Vip 3Aa-01 nucleotide sequence (Artificial Sequence)

<400> 2

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcattaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 3

<211> 789

<212> PRT

<213> Artificial sequence-Vip 3Aa-02 amino acid sequence (Artificial Sequence)

<400> 3

Met Asn Lys Asn Asn Thr Lys Leu Ser Thr Arg Ala Leu Pro Ser Phe

1 5 10 15

Ile Asp Tyr Phe Asn Gly Ile Tyr Gly Phe Ala Thr Gly Ile Lys Asp

20 25 30

Ile Met Asn Met Ile Phe Lys Thr Asp Thr Gly Gly Asp Leu Thr Leu

35 40 45

Asp Glu Ile Leu Lys Asn Gln Gln Leu Leu Asn Asp Ile Ser Gly Lys

50 55 60

Leu Asp Gly Val Asn Gly Ser Leu Asn Asp Leu Ile Ala Gln Gly Asn

65 70 75 80

Leu Asn Thr Glu Leu Ser Lys Glu Ile Leu Lys Ile Ala Asn Glu Gln

85 90 95

Asn Gln Val Leu Asn Asp Val Asn Asn Lys Leu Asp Ala Ile Asn Thr

100 105 110

Met Leu Arg Val Tyr Leu Pro Lys Ile Thr Ser Met Leu Ser Asp Val

115 120 125

Met Lys Gln Asn Tyr Ala Leu Ser Leu Gln Ile Glu Tyr Leu Ser Lys

130 135 140

Gln Leu Gln Glu Ile Ser Asp Lys Leu Asp Ile Ile Asn Val Asn Val

145 150 155 160

Leu Ile Asn Ser Thr Leu Thr Glu Ile Thr Pro Ala Tyr Gln Arg Ile

165 170 175

Lys Tyr Val Asn Glu Lys Phe Glu Glu Leu Thr Phe Ala Thr Glu Thr

180 185 190

Ser Ser Lys Val Lys Lys Asp Gly Ser Pro Ala Asp Ile Leu Asp Glu

195 200 205

Leu Thr Glu Leu Thr Glu Leu Ala Lys Ser Val Thr Lys Asn Asp Val

210 215 220

Asp Gly Phe Glu Phe Tyr Leu Asn Thr Phe His Asp Val Met Val Gly

225 230 235 240

Asn Asn Leu Phe Gly Arg Ser Ala Leu Lys Thr Ala Ser Glu Leu Ile

245 250 255

Thr Lys Glu Asn Val Lys Thr Ser Gly Ser Glu Val Gly Asn Val Tyr

260 265 270

Asn Phe Leu Ile Val Leu Thr Ala Leu Gln Ala Gln Ala Phe Leu Thr

275 280 285

Leu Thr Thr Cys Arg Lys Leu Leu Gly Leu Ala Asp Ile Asp Tyr Thr

290 295 300

Ser Ile Met Asn Glu His Leu Asn Lys Glu Lys Glu Glu Phe Arg Val

305 310 315 320

Asn Ile Leu Pro Thr Leu Ser Asn Thr Phe Ser Asn Pro Asn Tyr Ala

325 330 335

Lys Val Lys Gly Ser Asp Glu Asp Ala Lys Met Ile Val Glu Ala Lys

340 345 350

Pro Gly His Ala Leu Ile Gly Phe Glu Ile Ser Asn Asp Ser Ile Thr

355 360 365

Val Leu Lys Val Tyr Glu Ala Lys Leu Lys Gln Asn Tyr Gln Val Asp

370 375 380

Lys Asp Ser Leu Ser Glu Val Ile Tyr Gly Asp Met Asp Lys Leu Leu

385 390 395 400

Cys Pro Asp Gln Ser Glu Gln Ile Tyr Tyr Thr Asn Asn Ile Val Phe

405 410 415

Pro Asn Glu Tyr Val Ile Thr Lys Ile Asp Phe Thr Lys Lys Met Lys

420 425 430

Thr Leu Arg Tyr Glu Val Thr Ala Asn Phe Tyr Asp Ser Ser Thr Gly

435 440 445

Glu Ile Asp Leu Asn Lys Lys Lys Val Glu Ser Ser Glu Ala Glu Tyr

450 455 460

Arg Thr Leu Ser Ala Asn Asp Asp Gly Val Tyr Met Pro Leu Gly Val

465 470 475 480

Ile Ser Glu Thr Phe Leu Thr Pro Ile Asn Gly Phe Gly Leu Gln Ala

485 490 495

Asp Glu Asn Ser Arg Leu Ile Thr Leu Thr Cys Lys Ser Tyr Leu Arg

500 505 510

Glu Leu Leu Leu Ala Thr Asp Leu Ser Asn Lys Glu Thr Lys Leu Ile

515 520 525

Val Pro Pro Ser Gly Phe Ile Ser Asn Ile Val Glu Asn Gly Ser Ile

530 535 540

Glu Glu Asp Asn Leu Glu Pro Trp Lys Ala Asn Asn Lys Asn Ala Tyr

545 550 555 560

Val Asp His Thr Gly Gly Val Asn Gly Thr Lys Ala Leu Tyr Val His

565 570 575

Lys Asp Gly Gly Ile Ser Gln Phe Ile Gly Asp Lys Leu Lys Pro Lys

580 585 590

Thr Glu Tyr Val Ile Gln Tyr Thr Val Lys Gly Lys Pro Ser Ile His

595 600 605

Leu Lys Asp Glu Asn Thr Gly Tyr Ile His Tyr Glu Asp Thr Asn Asn

610 615 620

Asn Leu Glu Asp Tyr Gln Thr Ile Asn Lys Arg Phe Thr Thr Gly Thr

625 630 635 640

Asp Leu Lys Gly Val Tyr Leu Ile Leu Lys Ser Gln Asn Gly Asp Glu

645 650 655

Ala Trp Gly Asp Asn Phe Ile Ile Leu Glu Ile Ser Pro Ser Glu Lys

660 665 670

Leu Leu Ser Pro Glu Leu Ile Asn Thr Asn Asn Trp Thr Ser Thr Gly

675 680 685

Ser Thr Asn Ile Ser Gly Asn Thr Leu Thr Leu Tyr Gln Gly Gly Arg

690 695 700

Gly Ile Leu Lys Gln Asn Leu Gln Leu Asp Ser Phe Ser Thr Tyr Arg

705 710 715 720

Val Tyr Phe Ser Val Ser Gly Asp Ala Asn Val Arg Ile Arg Asn Ser

725 730 735

Arg Glu Val Leu Phe Glu Lys Arg Tyr Met Ser Gly Ala Lys Asp Val

740 745 750

Ser Glu Met Phe Thr Thr Lys Phe Glu Lys Asp Asn Phe Tyr Ile Glu

755 760 765

Leu Ser Gln Gly Asn Asn Leu Tyr Gly Gly Pro Ile Val His Phe Tyr

770 775 780

Asp Val Ser Ile Lys

785

<210> 4

<211> 2370

<212> DNA

<213> Artificial sequence-Vip 3Aa-02 nucleotide sequence (Artificial Sequence)

<400> 4

atgaacaaga acaacaccaa gctctccaca cgggcacttc cctcctttat tgactacttt 60

aatggcatct atgggtttgc tacggggatc aaggacatta tgaacatgat cttcaagaca 120

gacactggcg gggatcttac gctcgacgag attcttaaga atcagcaact cctgaacgat 180

atctctggca agctggacgg cgtgaatggg tcacttaacg acctcatcgc tcaggggaat 240

ctcaacacag aactgtctaa ggagatcctc aagattgcaa atgagcagaa ccaagttctt 300

aatgatgtga acaataagct cgacgccatc aacacaatgc ttcgcgtgta cctcccaaag 360

attactagca tgctctcgga cgtcatgaag cagaactacg cgctgtccct tcaaattgag 420

tatctgagca agcagcttca agaaatctcg gacaagctgg atatcattaa tgtgaacgtc 480

ctcatcaaca gcaccctgac ggagattaca ccggcgtacc agaggatcaa gtatgtgaat 540

gagaagttcg aggaactcac ttttgctaca gaaacttcca gcaaggtcaa gaaggatggc 600

tcaccagccg acatcctgga tgagcttaca gaactcactg agctggcgaa gtccgtgacc 660

aagaatgacg tcgatggctt cgagttttac ctgaacacgt tccacgacgt tatggtgggc 720

aacaatcttt ttgggcggag cgctctcaag actgcatcgg aactgatcac caaggagaac 780

gttaagacga gcggctcgga ggtcgggaat gtttacaact tccttatcgt cctcaccgca 840

ctccaggccc aagcgtttct cacgctgacc acctgccgca agctcctcgg cctcgcagac 900

atcgattaca cctccatcat gaacgagcac ctgaacaagg agaaggagga gttccgcgtg 960

aatatccttc cgacactctc gaacactttt tctaatccaa actacgctaa ggtcaagggc 1020

tccgacgaag atgcaaagat gatcgttgag gccaagcctg gccatgcgct catcgggttc 1080

gagatttcta acgactcaat taccgtgctg aaggtctacg aggcgaagct caagcagaat 1140

tatcaagtgg acaaggattc tctgtcagag gttatctacg gcgacatgga taagctgctt 1200

tgccctgatc agtccgagca aatctactat acgaacaata ttgtcttccc caacgaatac 1260

gtgatcacca agattgactt tacgaagaag atgaagacac tccggtacga ggtgacggct 1320

aacttctatg attcgtctac gggcgagatc gacctcaaca agaagaaggt cgaatcatcc 1380

gaggccgaat acagaaccct gtcggcgaac gacgatggcg tgtatatgcc tcttggggtc 1440

atttctgaga ccttcctcac gcccatcaat ggctttgggc tccaggcaga tgagaactcc 1500

cgcctgatca cccttacgtg caagagctac ctcagggagc tgctgcttgc caccgacctc 1560

tctaacaagg aaacgaagct gatcgttccg ccatcaggct tcatctccaa tattgtggag 1620

aacgggtcaa ttgaggaaga taatctggaa ccgtggaagg ctaacaataa gaacgcatac 1680

gttgaccaca caggcggggt gaatggcact aaggcgctct atgtgcataa ggatggtggc 1740

atctcccagt tcattggcga caagctgaag ccgaagacag aatacgtgat tcaatatact 1800

gtgaagggca agccaagcat ccacctcaag gatgagaaca cagggtacat ccattacgaa 1860

gatactaaca acaacctgga ggactaccag acaatcaata agaggttcac aactggcact 1920

gacctgaagg gggtctatct tattctcaag tcccagaatg gcgatgaggc ctggggcgac 1980

aacttcatca ttctcgaaat ctcccctagc gagaagctcc tgagccccga gctgattaac 2040

accaataact ggacatccac tggcagcacg aatatctcgg ggaacaccct gacgctttac 2100

cagggcggga gaggcattct gaagcagaac ctccaactgg attcgttctc tacctacaga 2160

gtctattttt cagtttccgg cgacgcgaat gtgcgcatca ggaactcgcg ggaagtcctc 2220

ttcgagaaga gatacatgtc tggcgctaag gatgtgtcag aaatgttcac cacgaagttt 2280

gagaaggaca acttttatat cgaactgtcc caagggaata acctctacgg cggccccatt 2340

gttcattttt acgacgtgag catcaagtga 2370

<210> 5

<211> 615

<212> PRT

<213> Artificial sequence-Cry 1Ab amino acid sequence (Artificial Sequence)

<400> 5

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Ile Ile Pro Ser Ser Gln Ile Thr Gln Ile Pro Leu Thr Lys Ser Thr

465 470 475 480

Asn Leu Gly Ser Gly Thr Ser Val Val Lys Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln Ile Ser Thr Leu Arg

500 505 510

Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr Arg Val Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr Ser Ile Asp Gly Arg

530 535 540

Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met Ser Ser Gly Ser Asn

545 550 555 560

Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe Thr Thr Pro Phe Asn

565 570 575

Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser Ala His Val Phe Asn

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu Phe Val Pro Ala Glu

595 600 605

Val Thr Phe Glu Ala Glu Tyr

610 615

<210> 6

<211> 1848

<212> DNA

<213> Artificial sequence-Cry 1Ab nucleotide sequence (Artificial Sequence)

<400> 6

atggacaaca acccaaacat caacgaatgc attccataca actgcttgag taacccagaa 60

gttgaagtac ttggtggaga acgcattgaa accggttaca ctcccatcga catctccttg 120

tccttgacac agtttctgct cagcgagttc gtgccaggtg ctgggttcgt tctcggacta 180

gttgacatca tctggggtat ctttggtcca tctcaatggg atgcattcct ggtgcaaatt 240

gagcagttga tcaaccagag gatcgaagag ttcgccagga accaggccat ctctaggttg 300

gaaggattga gcaatctcta ccaaatctat gcagagagct tcagagagtg ggaagccgat 360

cctactaacc cagctctccg cgaggaaatg cgtattcaat tcaacgacat gaacagcgcc 420

ttgaccacag ctatcccatt gttcgcagtc cagaactacc aagttcctct cttgtccgtg 480

tacgttcaag cagctaatct tcacctcagc gtgcttcgag acgttagcgt gtttgggcaa 540

aggtggggat tcgatgctgc aaccatcaat agccgttaca acgaccttac taggctgatt 600

ggaaactaca ccgaccacgc tgttcgttgg tacaacactg gcttggagcg tgtctggggt 660

cctgattcta gagattggat tagatacaac cagttcagga gagaattgac cctcacagtt 720

ttggacattg tgtctctctt cccgaactat gactccagaa cctaccctat ccgtacagtg 780

tcccaactta ccagagaaat ctatactaac ccagttcttg agaacttcga cggtagcttc 840

cgtggttctg cccaaggtat cgaaggctcc atcaggagcc cacacttgat ggacatcttg 900

aacagcataa ctatctacac cgatgctcac agaggagagt attactggtc tggacaccag 960

atcatggcct ctccagttgg attcagcggg cccgagttta cctttcctct ctatggaact 1020

atgggaaacg ccgctccaca acaacgtatc gttgctcaac taggtcaggg tgtctacaga 1080

accttgtctt ccaccttgta cagaagaccc ttcaatatcg gtatcaacaa ccagcaactt 1140

tccgttcttg acggaacaga gttcgcctat ggaacctctt ctaacttgcc atccgctgtt 1200

tacagaaaga gcggaaccgt tgattccttg gacgaaatcc caccacagaa caacaatgtg 1260

ccacccaggc aaggattctc ccacaggttg agccacgtgt ccatgttccg ttccggattc 1320

agcaacagtt ccgtgagcat catcagagct cctatgttct catggattca tcgtagtgct 1380

gagttcaaca atatcattcc ttcctctcaa atcacccaaa tcccattgac caagtctact 1440

aaccttggat ctggaacttc tgtcgtgaaa ggaccaggct tcacaggagg tgatattctt 1500

agaagaactt ctcctggcca gattagcacc ctcagagtta acatcactgc accactttct 1560

caaagatatc gtgtcaggat tcgttacgca tctaccacta acttgcaatt ccacacctcc 1620

atcgacggaa ggcctatcaa tcagggtaac ttctccgcaa ccatgtcaag cggcagcaac 1680

ttgcaatccg gcagcttcag aaccgtcggt ttcactactc ctttcaactt ctctaacgga 1740

tcaagcgttt tcacccttag cgctcatgtg ttcaattctg gcaatgaagt gtacattgac 1800

cgtattgagt ttgtgcctgc cgaagttacc ttcgaggctg agtactga 1848

<210> 7

<211> 634

<212> PRT

<213> Artificial sequence-Cry 2Ab amino acid sequence (Artificial Sequence)

<400> 7

Met Asp Asn Ser Val Leu Asn Ser Gly Arg Thr Thr Ile Cys Asp Ala

1 5 10 15

Tyr Asn Val Ala Ala His Asp Pro Phe Ser Phe Gln His Lys Ser Leu

20 25 30

Asp Thr Val Gln Lys Glu Trp Thr Glu Trp Lys Lys Asn Asn His Ser

35 40 45

Leu Tyr Leu Asp Pro Ile Val Gly Thr Val Ala Ser Phe Leu Leu Lys

50 55 60

Lys Val Gly Ser Leu Val Gly Lys Arg Ile Leu Ser Glu Leu Arg Asn

65 70 75 80

Leu Ile Phe Pro Ser Gly Ser Thr Asn Leu Met Gln Asp Ile Leu Arg

85 90 95

Glu Thr Glu Lys Phe Leu Asn Gln Arg Leu Asn Thr Asp Thr Leu Ala

100 105 110

Arg Val Asn Ala Glu Leu Thr Gly Leu Gln Ala Asn Val Glu Glu Phe

115 120 125

Asn Arg Gln Val Asp Asn Phe Leu Asn Pro Asn Arg Asn Ala Val Pro

130 135 140

Leu Ser Ile Thr Ser Ser Val Asn Thr Met Gln Gln Leu Phe Leu Asn

145 150 155 160

Arg Leu Pro Gln Phe Gln Met Gln Gly Tyr Gln Leu Leu Leu Leu Pro

165 170 175

Leu Phe Ala Gln Ala Ala Asn Leu His Leu Ser Phe Ile Arg Asp Val

180 185 190

Ile Leu Asn Ala Asp Glu Trp Gly Ile Ser Ala Ala Thr Leu Arg Thr

195 200 205

Tyr Arg Asp Tyr Leu Lys Asn Tyr Thr Arg Asp Tyr Ser Asn Tyr Cys

210 215 220

Ile Asn Thr Tyr Gln Ser Ala Phe Lys Gly Leu Asn Thr Arg Leu His

225 230 235 240

Asp Met Leu Glu Phe Arg Thr Tyr Met Phe Leu Asn Val Phe Glu Tyr

245 250 255

Val Ser Ile Trp Ser Leu Phe Lys Tyr Gln Ser Leu Leu Val Ser Ser

260 265 270

Gly Ala Asn Leu Tyr Ala Ser Gly Ser Gly Pro Gln Gln Thr Gln Ser

275 280 285

Phe Thr Ser Gln Asp Trp Pro Phe Leu Tyr Ser Leu Phe Gln Val Asn

290 295 300

Ser Asn Tyr Val Leu Asn Gly Phe Ser Gly Ala Arg Leu Ser Asn Thr

305 310 315 320

Phe Pro Asn Ile Val Gly Leu Pro Gly Ser Thr Thr Thr His Ala Leu

325 330 335

Leu Ala Ala Arg Val Asn Tyr Ser Gly Gly Ile Ser Ser Gly Asp Ile

340 345 350

Gly Ala Ser Pro Phe Asn Gln Asn Phe Asn Cys Ser Thr Phe Leu Pro

355 360 365

Pro Leu Leu Thr Pro Phe Val Arg Ser Trp Leu Asp Ser Gly Ser Asp

370 375 380

Arg Glu Gly Val Ala Thr Val Thr Asn Trp Gln Thr Glu Ser Phe Glu

385 390 395 400

Thr Thr Leu Gly Leu Arg Ser Gly Ala Phe Thr Ala Arg Gly Asn Ser

405 410 415

Asn Tyr Phe Pro Asp Tyr Phe Ile Arg Asn Ile Ser Gly Val Pro Leu

420 425 430

Val Val Arg Asn Glu Asp Leu Arg Arg Pro Leu His Tyr Asn Glu Ile

435 440 445

Arg Asn Ile Ala Ser Pro Ser Gly Thr Pro Gly Gly Ala Arg Ala Tyr

450 455 460

Met Val Ser Val His Asn Arg Lys Asn Asn Ile His Ala Val His Glu

465 470 475 480

Asn Gly Ser Met Ile His Leu Ala Pro Asn Asp Tyr Thr Gly Phe Thr

485 490 495

Ile Ser Pro Ile His Ala Thr Gln Val Asn Asn Gln Thr Arg Thr Phe

500 505 510

Ile Ser Glu Lys Phe Gly Asn Gln Gly Asp Ser Leu Arg Phe Glu Gln

515 520 525

Asn Asn Thr Thr Ala Arg Tyr Thr Leu Arg Gly Asn Gly Asn Ser Tyr

530 535 540

Asn Leu Tyr Leu Arg Val Ser Ser Ile Gly Asn Ser Thr Ile Arg Val

545 550 555 560

Thr Ile Asn Gly Arg Val Tyr Thr Ala Thr Asn Val Asn Thr Thr Thr

565 570 575

Asn Asn Asp Gly Val Asn Asp Asn Gly Ala Arg Phe Ser Asp Ile Asn

580 585 590

Ile Gly Asn Val Val Ala Ser Ser Asn Ser Asp Val Pro Leu Asp Ile

595 600 605

Asn Val Thr Leu Asn Ser Gly Thr Gln Phe Asp Leu Met Asn Ile Met

610 615 620

Leu Val Pro Thr Asn Ile Ser Pro Leu Tyr

625 630

<210> 8

<211> 1905

<212> DNA

<213> Artificial sequence-Cry 2Ab nucleotide sequence (Artificial Sequence)

<400> 8

atggacaact ccgtcctgaa ctctggtcgc accaccatct gcgacgccta caacgtcgcg 60

gcgcatgatc cattcagctt ccagcacaag agcctcgaca ctgttcagaa ggagtggacg 120

gagtggaaga agaacaacca cagcctgtac ctggacccca tcgtcggcac ggtggccagc 180

ttccttctca agaaggtcgg ctctctcgtc gggaagcgca tcctctcgga actccgcaac 240

ctgatctttc catctggctc caccaacctc atgcaagaca tcctcaggga gaccgagaag 300

tttctcaacc agcgcctcaa cactgatacc cttgctcgcg tcaacgctga gctgacgggt 360

ctgcaagcaa acgtggagga gttcaaccgc caagtggaca acttcctcaa ccccaaccgc 420

aatgcggtgc ctctgtccat cacttcttcc gtgaacacca tgcaacaact gttcctcaac 480

cgcttgcctc agttccagat gcaaggctac cagctgctcc tgctgccact ctttgctcag 540

gctgccaacc tgcacctctc cttcattcgt gacgtgatcc tcaacgctga cgagtggggc 600

atctctgcag ccacgctgag gacctaccgc gactacctga agaactacac cagggactac 660

tccaactatt gcatcaacac ctaccagtcg gccttcaagg gcctcaatac gaggcttcac 720

gacatgctgg agttcaggac ctacatgttc ctgaacgtgt tcgagtacgt cagcatctgg 780

tcgctcttca agtaccagag cctgctggtg tccagcggcg ccaacctcta cgccagcggc 840

tctggtcccc aacaaactca gagcttcacc agccaggact ggccattcct gtattcgttg 900

ttccaagtca actccaacta cgtcctcaac ggcttctctg gtgctcgcct ctccaacacc 960

ttccccaaca ttgttggcct ccccggctcc accacaactc atgctctgct tgctgccaga 1020

gtgaactact ccggcggcat ctcgagcggc gacattggtg catcgccgtt caaccagaac 1080

ttcaactgct ccaccttcct gccgccgctg ctcaccccgt tcgtgaggtc ctggctcgac 1140

agcggctccg accgcgaggg cgtggccacc gtcaccaact ggcaaaccga gtccttcgag 1200

accacccttg gcctccggag cggcgccttc acggcgcgtg gaaattctaa ctacttcccc 1260

gactacttca tcaggaacat ctctggtgtt cctctcgtcg tccgcaacga ggacctccgc 1320

cgtccactgc actacaacga gatcaggaac atcgcctctc cgtccgggac gcccggaggt 1380

gcaagggcgt acatggtgag cgtccataac aggaagaaca acatccacgc tgtgcatgag 1440

aacggctcca tgatccacct ggcgcccaat gattacaccg gcttcaccat ctctccaatc 1500

cacgccaccc aagtgaacaa ccagacacgc accttcatct ccgagaagtt cggcaaccag 1560

ggcgactccc tgaggttcga gcagaacaac accaccgcca ggtacaccct gcgcggcaac 1620

ggcaacagct acaacctgta cctgcgcgtc agctccattg gcaactccac catcagggtc 1680

accatcaacg ggagggtgta cacagccacc aatgtgaaca cgacgaccaa caatgatggc 1740

gtcaacgaca acggcgcccg cttcagcgac atcaacattg gcaacgtggt ggccagcagc 1800

aactccgacg tcccgctgga catcaacgtg accctgaact ctggcaccca gttcgacctc 1860

atgaacatca tgctggtgcc aactaacatc tcgccgctgt actga 1905

<210> 9

<211> 1322

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 9

gtcgacctgc aggtcaacgg atcaggatat tcttgtttaa gatgttgaac tctatggagg 60

tttgtatgaa ctgatgatct aggaccggat aagttccctt cttcatagcg aacttattca 120

aagaatgttt tgtgtatcat tcttgttaca ttgttattaa tgaaaaaata ttattggtca 180

ttggactgaa cacgagtgtt aaatatggac caggccccaa ataagatcca ttgatatatg 240

aattaaataa caagaataaa tcgagtcacc aaaccacttg ccttttttaa cgagacttgt 300

tcaccaactt gatacaaaag tcattatcct atgcaaatca ataatcatac aaaaatatcc 360

aataacacta aaaaattaaa agaaatggat aatttcacaa tatgttatac gataaagaag 420

ttacttttcc aagaaattca ctgattttat aagcccactt gcattagata aatggcaaaa 480

aaaaacaaaa aggaaaagaa ataaagcacg aagaattcta gaaaatacga aatacgcttc 540

aatgcagtgg gacccacggt tcaattattg ccaattttca gctccaccgt atatttaaaa 600

aataaaacga taatgctaaa aaaatataaa tcgtaacgat cgttaaatct caacggctgg 660

atcttatgac gaccgttaga aattgtggtt gtcgacgagt cagtaataaa cggcgtcaaa 720

gtggttgcag ccggcacaca cgagtcgtgt ttatcaactc aaagcacaaa tacttttcct 780

caacctaaaa ataaggcaat tagccaaaaa caactttgcg tgtaaacaac gctcaataca 840

cgtgtcattt tattattagc tattgcttca ccgccttagc tttctcgtga cctagtcgtc 900

ctcgtctttt cttcttcttc ttctataaaa caatacccaa agcttcttct tcacaattca 960

gatttcaatt tctcaaaatc ttaaaaactt tctctcaatt ctctctaccg tgatcaaggt 1020

aaatttctgt gttccttatt ctctcaaaat cttcgatttt gttttcgttc gatcccaatt 1080

tcgtatatgt tctttggttt agattctgtt aatcttagat cgaagacgat tttctgggtt 1140

tgatcgttag atatcatctt aattctcgat tagggtttca taaatatcat ccgatttgtt 1200

caaataattt gagttttgtc gaataattac tcttcgattt gtgatttcta tctagatctg 1260

gtgttagttt ctagtttgtg cgatcgaatt tgtcgattaa tctgagtttt tctgattaac 1320

ag 1322

<210> 10

<211> 530

<212> DNA

<213> terminator (Agrobacterium tumefaciens)

<400> 10

ccatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag actggcgaac 60

agttcataca gagtctctta cgactcaatg acaagaagaa aatcttcgtc aacatggtgg 120

agcacgacac gcttgtctac tccaaaaata tcaaagatac agtctcagaa gaccaaaggg 180

caattgagac ttttcaacaa agggtaatat ccggaaacct cctcggattc cattgcccag 240

ctatctgtca ctttattgtg aagatagtgg aaaaggaagg tggctcctac aaatgccatc 300

attgcgataa aggaaaggcc atcgttgaag atgcctctgc cgacagtggt cccaaagatg 360

gacccccacc cacgaggagc atcgtggaaa aagaagacgt tccaaccacg tcttcaaagc 420

aagtggattg atgtgatatc tccactgacg taagggatga cgcacaatcc cactatcctt 480

cgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca 530

<210> 11

<211> 529

<212> DNA

<213> promoter (Cauliflower mosaic virus)

<400> 11

gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcga aggatagtgg 60

gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac 120

gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga 180

ccactgtcgg cagaggcatc ttcaacgatg gcctttcctt tatcgcaatg atggcatttg 240

taggagccac cttccttttc cactatcttc acaataaagt gacagatagc tgggcaatgg 300

aatccgagga ggtttccgga tattaccctt tgttgaaaag tctcaattgc cctttggtct 360

tctgagactg tatctttgat atttttggag tagacaagcg tgtcgtgctc caccatgttg 420

acgaagattt tcttcttgtc attgagtcgt aagagactct gtatgaactg ttcgccagtc 480

tttacggcga gttctgttag gtcctctatt tgaatctttg actccatgg 529

<210> 12

<211> 552

<212> DNA

<213> Streptomyces viridochromogenes

<400> 12

atgtctccgg agaggagacc agttgagatt aggccagcta cagcagctga tatggccgcg 60

gtttgtgata tcgttaacca ttacattgag acgtctacag tgaactttag gacagagcca 120

caaacaccac aagagtggat tgatgatcta gagaggttgc aagatagata cccttggttg 180

gttgctgagg ttgagggtgt tgtggctggt attgcttacg ctgggccctg gaaggctagg 240

aacgcttacg attggacagt tgagagtact gtttacgtgt cacataggca tcaaaggttg 300

ggcctaggat ccacattgta cacacatttg cttaagtcta tggaggcgca aggttttaag 360

tctgtggttg ctgttatagg ccttccaaac gatccatctg ttaggttgca tgaggctttg 420

ggatacacag cccggggtac attgcgcgca gctggataca agcatggtgg atggcatgat 480

gttggttttt ggcaaaggga ttttgagttg ccagctcctc caaggccagt taggccagtt 540

acccagatct ga 552

<210> 13

<211> 195

<212> DNA

<213> terminator (Cauliflower mosaic virus)

<400> 13

ctgaaatcac cagtctctct ctacaaatct atctctctct ataataatgt gtgagtagtt 60

cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 120

cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 180

accaaaatcc agtgg 195

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence-primer 1 (Artificial Sequence)

<400> 14

gagggtgttg tggctggtat tg 22

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence-primer 2 (Artificial Sequence)

<400> 15

tctcaactgt ccaatcgtaa gcg 23

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence-Probe 1 (Artificial Sequence)

<400> 16

cttacgctgg gccctggaag gctag 25

Claims

1. A method for controlling noctuid pests is characterized by comprising the step of contacting the noctuid pests with at least Vip3Aa protein, wherein the amino acid sequence of the Vip3Aa protein is shown as SEQ ID NO. 1 or SEQ ID NO. 3.

2. The method of controlling noctuid pest according to claim 1, wherein the Vip3Aa protein is present in a host cell producing at least the Vip3Aa protein, and the noctuid pest is contacted with at least the Vip3Aa protein by feeding the host cell.

3. A method of controlling spodoptera littoralis insect pests according to claim 2 wherein the Vip3Aa protein is present in a bacterium or transgenic plant producing at least the Vip3Aa protein, the spodoptera littoralis insect pest being contacted with at least the Vip3Aa protein by ingestion of tissue of the bacterium or transgenic plant, the spodoptera littoralis insect pest growth being inhibited and/or causing death upon contact to effect control of a plant that is compromised by spodoptera littoralis.

4. A method of controlling noctuid insect pest according to claim 3, wherein the tissue of the transgenic plant is roots, leaves, stems, fruits, tassel, female ear, anthers or filaments.

5. A method of controlling noctuid pest according to any one of claims 3 to 4, wherein the plant is soybean, mung bean, cowpea, rape, cabbage, broccoli, chinese cabbage, radish.

6. The method for controlling noctuid pest according to claim 3 or 4, wherein the nucleotide sequence of Vip3Aa protein is shown in SEQ ID No. 2 or SEQ ID No. 4.

7. The method for controlling noctuid pest according to claim 5, wherein the nucleotide sequence of Vip3Aa protein is shown in SEQ ID No. 2 or SEQ ID No. 4.

8. The method of controlling a spodoptera littoralis pest according to any one of claims 3, 4 and 7 wherein said plant further comprises at least one second nucleotide different from the nucleotide encoding said Vip3Aa protein, said second nucleotide encoding a Cry1Ab protein or a Cry2Ab protein, wherein the amino acid sequence of said Cry1Ab protein is set forth in SEQ ID No. 5 and the amino acid sequence of said Cry2Ab protein is set forth in SEQ ID No. 7.

9. The method for controlling noctuid insect pest according to claim 8, wherein the nucleotide sequence of the Cry1Ab protein is a nucleotide sequence shown in SEQ ID No. 6, and the nucleotide sequence of the Cry2Ab protein is a nucleotide sequence shown in SEQ ID No. 8.

10. The method of controlling noctuid pest according to claim 6, wherein the plant further comprises at least one second nucleotide different from the nucleotide encoding the Vip3Aa protein, the second nucleotide encoding a Cry1Ab protein or a Cry2Ab protein, wherein the Cry1Ab protein has an amino acid sequence as shown in SEQ ID No. 5 and the Cry2Ab protein has an amino acid sequence as shown in SEQ ID No. 7.

11. The method for controlling noctuid insect pest according to claim 10, wherein the nucleotide sequence of the Cry1Ab protein is a nucleotide sequence shown in SEQ ID No. 6, and the nucleotide sequence of the Cry2Ab protein is a nucleotide sequence shown in SEQ ID No. 8.

12. The method of controlling noctuid pest according to claim 5, wherein the plant further comprises at least one second nucleotide different from the nucleotide encoding the Vip3Aa protein, the second nucleotide encoding a Cry1Ab protein or a Cry2Ab protein, wherein the Cry1Ab protein has an amino acid sequence as shown in SEQ ID No. 5 and the Cry2Ab protein has an amino acid sequence as shown in SEQ ID No. 7.

13. The method for controlling noctuid insect pest according to claim 12, wherein the nucleotide sequence of the Cry1Ab protein is a nucleotide sequence shown in SEQ ID No. 6, and the nucleotide sequence of the Cry2Ab protein is a nucleotide sequence shown in SEQ ID No. 8.

14. The application of Vip3Aa protein in controlling noctuid pest is disclosed, wherein the amino acid sequence of the Vip3Aa protein is shown as SEQ ID NO. 1 or SEQ ID NO. 3.