CN104621171A - Use of insecticidal protein - Google Patents

Abstract

The invention relates to the use of insecticidal protein. A method for controlling dichocrocis punctiferalis pests comprises the step of at least contacting the dichocrocis punctiferalis pests with Cry2Ab protein. According to the use of the insecticidal protein, the dichocrocis punctiferalis pests can be controlled by the Cry2Ab protein which is capable of killing the dichocrocis punctiferalis and is generated in plants; compared with the agricultural control method, chemical control method and biological control method which are used in the prior art, the use has the advantages that the insecticidal protein can be used for protecting the whole plants in the whole growth period so as to control the harm of the dichocrocis punctiferalis pests, and is free from pollution and residue, stable and thorough in effect, simple, convenient and economical.

Description

The purposes of insecticidal proteins

Technical field

The present invention relates to a kind of purposes of insecticidal proteins, particularly relate to a kind of Cry2Ab protein and control dichocrocis punctiferalis to cause harm the purposes of plant by expressing in plant.

Background technology

Dichocrocis punctiferalis (Conogethes punctiferalis) belongs to Lepidoptera Pyralidae, for polyphagous pest-insect, except harm corn, Chinese sorghum etc. make beyond the region of objective existence, also endanger the fruit trees such as peach, persimmon, Chinese chestnut, be distributed widely in China domestic, North gets Heilungkiang, the Inner Mongol, reach Taiwan, Hainan, Guangdong, Guangxi, south, Yunnan edge in the south, border, Dong Jie former Soviet Union east, border, Korea north, west from Shanxi, west, Shaanxi tiltedly to Ningxia, Gansu, fold into Sichuan, Yunnan, Tibet.During harm corn, the female fringe of main moth food, also can eat into stem, strain rate of being injured reaches 30%-80%; During harm Chinese sorghum, newly hatched larvae is eaten in the tender seed of Chinese sorghum children, with ight soil or swill, mouth is sealed, eat into evil within it, eat empty one and turn again one until before three ages, weaving silk after three ages knots puts together in the middle of small ear and leaves tunnel, inside walk and gnaw seed, serious has eaten sorghum grain moth.Stalk can be eaten in addition, the similar corn borer of Harm.

Corn is Chinese important cereal crops, every year because the grain loss that dichocrocis punctiferalis is caused is huge, has influence on the survival state of local population what is more.In order to prevent and treat dichocrocis punctiferalis, the main prevention and controls that people adopt usually has: cultural control, chemical control and biological control.

Cultural control is that regulation and control crop, insect, environmental factor, creation one are conducive to plant growth and are unfavorable for the farmland ecological environment that dichocrocis punctiferalis occurs multifactorial for whole field ecosystem comprehensive coordination management.As utilized process dichocrocis punctiferalis overwintering host, pick up and ruin shedding and extract wormed fruit, reform cropping system, plant anti-dichocrocis punctiferalis kind and plantation lures the measures such as collection field to reduce the harm of dichocrocis punctiferalis.Because cultural control must obey the requirement of crop allocation and volume increase, application has certain limitation, as emergency measure, just can not seem helpless when dichocrocis punctiferalis is broken out.

Chemical control and pesticide control, utilize chemical insecticide to carry out kill pests, it is the important component part of the dichocrocis punctiferalis comprehensive regulation, it has fast, the feature of convenient, easy and high economic benefit, particularly when the large generation of dichocrocis punctiferalis, be absolutely necessary emergency measure, and it can be eliminated before dichocrocis punctiferalis works the mischief.Current chemical prevention and control method mainly contains chemistry trapping, medicine liquid spray etc.But chemical control also has its limitation, as improper use often cause crops generation poisoning, insect develops immunity to drugs, and killed natural enemies, contaminated environment, make field ecosystem suffer the adverse consequencess such as destruction and the safety of residue of pesticide to people, animal constitute a threat to.

Biological control utilizes some beneficial organism or biological metabolic product to carry out Control pests population quantity, to reach the object reducing or eliminate destructive insects.Be characterized in that environmental pollution is few to people, animal safety, the object of long-term control can be reached some insect; But effect is often unstable, no matter and dichocrocis punctiferalis generation weight all needs same investment to carry out.

In order to solve cultural control, chemical control and biological control limitation in actual applications, scientists finds the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant.Cry2Ab insecticidal proteins is the one in numerous insecticidal proteins, is the insoluble sexual partner's spore crystalline protein produced by bacillus thuringiensis storehouse Stuckey subspecies (Bacillus thuringiensis subsp.kurstaki, B.t.k.).

Cry2Ab albumen is taken in by insect and is entered middle intestines, under toxalbumin parent toxin is dissolved in the alkaline pH environment of insect midgut.Parent toxin, by basic protein enzymic digestion, is transformed into active fragment by albumen N-and C-end; Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cell membrane to occur perforation focus, destroys osmotic pressure change inside and outside cell membrane and pH balance etc., upsets the digestion process of insect, finally cause it dead.

The plant having proved to turn Cry2Ab gene can resist the infringement of the Lepidoptera such as corn borer, cotton bollworm (Lepidoptera) insect, but, there is no so far and control the report of dichocrocis punctiferalis to plant hazard about by producing the transfer-gen plant of expressing Cry2Ab albumen.

Summary of the invention

The object of this invention is to provide a kind of purposes of insecticidal proteins, provide first and control the method for dichocrocis punctiferalis to plant hazard by producing the transfer-gen plant of expressing Cry2Ab albumen, and effectively overcome the technological deficiencies such as prior art cultural control, chemical control and biological control.

For achieving the above object, the invention provides a kind of method controlling dichocrocis punctiferalis insect, comprise by dichocrocis punctiferalis insect at least with Cry2Ab protein contact.

Further, described Cry2Ab albumen is present in the host cell at least producing described Cry2Ab albumen, described dichocrocis punctiferalis insect by ingest described host cell at least with described Cry2Ab protein contact.

Further, described Cry2Ab albumen is present in the bacterium or genetically modified plants at least producing described Cry2Ab albumen, described dichocrocis punctiferalis insect by ingest described bacterium or described genetically modified plants organize at least with described Cry2Ab protein contact, after contact, described dichocrocis punctiferalis insect growth is suppressed and/or causes death, to realize the control to dichocrocis punctiferalis harm plant.

Described genetically modified plants can be in any breeding time.

Described genetically modified plants be organized as root, blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

The described control to dichocrocis punctiferalis harm plant does not change because planting the change in place and/or implantation time.

Described plant is from corn, sunflower, soybean, Chinese sorghum, Chinese chestnut, peach, pomegranate, apple, tomato, eggplant, sugarcane, turfgrass, cotton, rape or strawberry.

Step before described contact procedure is the plant of the polynucleotides of plantation containing the described Cry2Ab albumen of coding.

Preferably, the amino acid sequence of described Cry2Ab albumen has the amino acid sequence shown in SEQ ID NO:1.The nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:2.

On the basis of technique scheme, described plant can also comprise the second nucleotide that at least one is different from the nucleotide of described Cry2Ab albumen of encoding.

Further, described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase.

Preferably, described the second nucleotide coding Cry1A.105 albumen or Vip3A albumen.

Further, the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:3.

Further, described the second nucleotide has the amino acid sequence shown in SEQ ID NO:4.

Selectively, described the second nucleotide is the dsRNA suppressing important gene in target insect pests.

For achieving the above object, present invention also offers the purposes that a kind of Cry2Ab protein controls dichocrocis punctiferalis insect.

For achieving the above object, present invention also offers a kind of method producing the plant controlling dichocrocis punctiferalis insect, comprise the polynucleotide sequence introducing coding Cry2Ab albumen in the genome of described plant.

For achieving the above object, present invention also offers a kind of method producing the plant seed controlling dichocrocis punctiferalis insect, comprise and the first plant obtained by described method and the second plant are hybridized, thus produce the seed of the polynucleotide sequence containing coding Cry2Ab albumen.

For achieving the above object, present invention also offers a kind of method of cultivating the plant controlling dichocrocis punctiferalis insect, comprising:

Plant at least one plant seed, the genome of described plant seed comprises the polynucleotide sequence of coding Cry2Ab albumen;

Described plant seed is made to grow up to plant;

Described plant is grown under the condition of artificial infection dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring harm, there is compared with the plant of gathering in the crops the polynucleotide sequence with other without Cry2Ab albumen of encoding the plant of the plant injury weakened and/or the plant products with increase.

" contact " described in the present invention, refer to insect and/or insect touching, stop and/or feeding plant, plant organ, plant tissue or plant cell, described plant, plant organ, plant tissue or plant cell both can be its expression in vivo insecticidal proteins, can also be described plant, the surface of plant organ, plant tissue or plant cell has insecticidal proteins and/or have and produce the microorganism of insecticidal proteins.

" control " of the present invention and/or " control " refer to dichocrocis punctiferalis insect at least with Cry2Ab protein contact, contact after dichocrocis punctiferalis insect growth be suppressed and/or cause death.Further, dichocrocis punctiferalis insect by feeding plant organize at least with Cry2Ab protein contact, after contact, the growth of all or part of dichocrocis punctiferalis insect is suppressed and/or causes death.Suppress to refer to sub-lethal, namely not yet lethal but can cause grow, behavior, physiology, the aspect such as biochemistry and tissue certain effect, as grown slowly and/or stopping.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.In addition, the plant of the control dichocrocis punctiferalis insect of the polynucleotide sequence containing coding Cry2Ab albumen and/or plant seed, under the condition that artificial infection dichocrocis punctiferalis insect and/or the naturally-occurring of dichocrocis punctiferalis insect endanger, have the plant injury weakened compared with not genetically modified WT lines, concrete manifestation includes but not limited to stem stalk resistance and/or the kernel weight improved and/or the volume increase etc. of improvement.Cry2Ab albumen is can be self-existent to " control " and/or " control " of dichocrocis punctiferalis effect, not because other can " control " and/or the existence of the material of " control " dichocrocis punctiferalis insect and weaken and/or disappear.Particularly, any tissue of genetically modified plants (polynucleotide sequence containing coding Cry2Ab albumen) simultaneously and/or asynchronously, exist and/or produce, Cry2Ab albumen and/or the another kind of material of dichocrocis punctiferalis insect can be controlled, then the existence of described another kind of material neither affects Cry2Ab albumen and acts on " control " and/or " control " of dichocrocis punctiferalis, described " control " and/or " control " effect can not be caused to be realized by described another kind of material completely and/or partly, and have nothing to do with Cry2Ab albumen.Under normal circumstances, in land for growing field crops, the process of dichocrocis punctiferalis insect feeding plant tissue is of short duration and be difficult to observe with the naked eye, therefore, under the condition that artificial infection dichocrocis punctiferalis insect and/or the naturally-occurring of dichocrocis punctiferalis insect endanger, there is dead dichocrocis punctiferalis insect in any tissue as genetically modified plants (polynucleotide sequence containing coding Cry2Ab albumen), and/or stop the dichocrocis punctiferalis insect growing and be suppressed thereon, and/or there is the plant injury weakened compared with not genetically modified WT lines, be and achieve method of the present invention and/or purposes, namely by dichocrocis punctiferalis insect at least with Cry2Ab protein contact to realize the method and/or the purposes that control dichocrocis punctiferalis insect.

In the present invention, the expression of Cry2Ab albumen in a kind of genetically modified plants can along with the expression of one or more Cry class insect-killing protein and/or Vip class insect-killing protein.This kind of Pesticidal toxins co expression in same strain genetically modified plants that exceedes can make plant comprise by genetic engineering and gene needed for expressing realizes.In addition, a Plants (the 1st parent) can express Cry2Ab protein by genetic engineering procedure, and the second plant (the 2nd parent) can express Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.The progeny plants of all genes of expressing introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNA interference, RNAi) refer to high conservative during evolution, brought out by double-stranded RNA (double-stranded RNA, dsRNA), the phenomenon of the efficient selective degradation of homologous mRNA.Therefore the expression of specific gene in RNAi technology specific depletion or closedown target insect pests can be used in the present invention.

In categorizing system, generally the morphological feature such as type of the main nervuration according to adult wing, linkage mode and feeler, Lepidoptera is divided into suborder, Superfamily, section etc., and Pyralidae is one of section of most species in Lepidoptera, the whole world has found more than 10,000 kinds, and only China's record just has several thousand.Major part Pyralidae insect is the insect of crops, and majority is caused harm, as striped rice borer and corn borer to eat into stem form.Although dichocrocis punctiferalis and striped rice borer, corn borer etc. belong to Lepidoptera Pyralidae, except there is similitude in criteria for classification, then there is huge difference in other morphosis; Like the strawberry in plant the same with apple (belonging to the Rosales rose family), the features such as they have colored both sexes, radiation symmetric, 5, petal, but its fruit and plant forms but vary.No matter dichocrocis punctiferalis is from Larva Morpho. Logy or adult form, all has the feature of its uniqueness.As dichocrocis punctiferalis is otherwise known as leopard line moth, be because its adult wing has leopard line.And the corn borer belonged to together with it, wing there is no completely leopard line, and have some ripple glazes.Adult stage is the important stage that insect will exercise mating breeding, and the decorative pattern on wing coordinates the sex pheromone of release, attracts companion, and then completes mating and raise up seed.So apparent slight difference, in fact embody be individual reproduction and colony procreation on fundamental difference.

Not only there is larger difference in the insect belonging to Pyralidae together, simultaneously on feeding habit, also there are differences in morphological feature.The corn borer being such as all Pyralidae is mainly caused harm corn gramineous, other broad-leaved class crop of seldom causing harm, and especially never has report to have corn borer to cause harm the fruit tree crops such as peach, pomegranate, apple.And dichocrocis punctiferalis is except corn of causing harm, non-crop gramineous such as sunflower, soybean and peach, pomegranate etc. of also causing harm in a large number.The difference of feeding habit, also imply that the enzyme that the digested system of body produces is different with receptor protein.And the enzyme produced in digestive tract is the key point that Bt gene works, the enzyme that only can combine with specific b t gene or receptor protein, just likely make certain this insect of Bt gene pairs have insect resistant effect.Increasing research shows, the susceptibility performance of not equal with order, even equal insect not of the same race to Bt albumen of the same race is different.Striped rice borer (Chilo suppressalis), the Asiatic corn borer (Ostrinia furnacalis) of such as Vip3Aa gene pairs Pyralidae all show anti-insect activity, but but do not have insect resistant effect for the Indian meal moth (Plodia interpunctella) and European corn borer (Ostrinia nubilalis) belonging to Pyralidae together.Above-mentioned four kinds of insects all belong to Lepidoptera Pyralidae, but Bt albumen of the same race shows different resistance effects to four kinds of Pyralidae insects.Especially European corn borer and Asiatic corn borer even belong to Pyralidae Ostrinia genus (belonging to together with order is equal) in classification, but it is but distinct to the reaction of Bt albumen of the same race, more absolutely prove that the interaction mode of Bt albumen and insect bodies endoenzyme and acceptor is complexity and is difficult to expect.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to any genetic material in plant, plant tissue or plant cell, and comprises cell nucleus and plastid and mitochondrial genomes.

Polynucleotides described in the present invention and/or nucleotide are formed complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, under polynucleotides of the present invention and/or nucleotide can being placed in the regulating and controlling sequence control of object host.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand creating DNA in plant.Like this, the present invention includes the use of polynucleotides to example in sequence table and complementary strand thereof." coding strand " that this area often uses refers to the chain be combined with antisense strand.In order to marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template.MRNA is actually and transcribes from " antisense " chain of DNA." have justice " or " coding " chain has a series of codon (codon is three nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form destination protein matter or peptide.The present invention also comprises the RNA having suitable function with the DNA of example.

Nucleic acid molecule of the present invention or its fragment under strict conditions with Cry2Ab gene recombination of the present invention.The nucleic acid hybridization of any routine or amplification method may be used to the existence identifying Cry2Ab gene of the present invention.Nucleic acid molecules or its fragment can carry out specific hybrid with other nucleic acid molecules in any case.In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid molecules demonstrate complementary completely, then one of them nucleic acid molecules is claimed to be another nucleic acid molecules " complement ".In the present invention, when corresponding nucleotide complementary with another nucleic acid molecules of each nucleotide of a nucleic acid molecules, then these two nucleic acid molecules are claimed to demonstrate " complete complementary ".If two nucleic acid molecules can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecules for " minimum level is complementary ".Similarly, if two nucleic acid molecules can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecules are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecules as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, this nucleic acid molecules under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salinity in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salinity can all change, and also can one of them to remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C, with SEQ ID NO:2, specific hybrid occurs, and then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and the sequence of hybridizing with SEQ ID NO:2 of the present invention under strict conditions comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise part and/or fragment (comprising compared with full length protein and/or terminal deletion), variant, mutant, substituent (having alternative amino acid whose protein), chimera and the fusion of the insecticidal activity feature of the protein saving described particular example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity.Described " equivalent protein " refers to the bioactive albumen with the albumen of claim with identical or substantially identical anti-dichocrocis punctiferalis insect.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refers to a part or its artificial reconstructed form (being such as applicable to the sequence of expression of plants) of original DNA or the protein sequence (nucleotide or amino acid) related to, can there is change in the length of foregoing sequences, but length is enough to guarantee that (coding) protein is insect toxins.

Use standard technique can build gene variant with being easy to by modifier gene.Such as, the technology of well known manufacturing place sudden change.Such as U.S. Patent number 5605793 describes and after random fracture, to use DNA to reassembly produce the method for other molecular diversity again.Commercialization endonuclease can be used to manufacture the fragment of full-length gene, and exonuclease can be used according to standardization program.Such as, enzyme such as Bal31 or direct mutagenesis can be used to excise nucleotide from the end system of these genes.Multiple restriction enzyme can also be used to obtain the gene of encode active fragments.Protease can be used directly to obtain the active fragment of these toxin.

The present invention can derive equivalent protein and/or the gene of these equivalent protein of encoding from B.t. separator and/or DNA library.Multiple method is had to obtain insecticidal proteins of the present invention.Such as, the present invention's antibody that is open and claimed insecticidal proteins can be used to identify from protein mixture and be separated other albumen.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then these antibody can be used exclusively to identify the equivalent protein of activity characteristic by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western immunoblot method.This area standardization program can be used to be easy to the antibody of the fragment preparing albumen or equivalent protein or this plastein disclosed in the present invention.Then the gene of these albumen of coding can be obtained from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence dna can be encoded identical amino acid sequence.Produce the alternative DNA sequence dna of the identical or substantially identical albumen of these codings just in the technical merit of those skilled in the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment retaining insecticidal activity.

The replacement of amino acid sequence in the present invention, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and the folding and/or active conserved amino acid namely significantly not affecting albumen replaces; Little disappearance, usually about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, and such as aminoterminal extends a methionine residues; Little connection peptide, such as an about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following amino acid group: basic amino acid (as arginine, lysine and histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid (as glutamine, asparagine), hydrophobic amino acid (as leucine, isoleucine and valine), ArAA (as phenyl alanine, tryptophan and tyrosine), and Small molecular amino acid (as glycine, alanine, serine, threonine and methionine).Usually those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic publishing house (Academic Press) " Protein " that publish in 1979.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region played an important role to molecular function, and still produces active peptides.For by polypeptide of the present invention, its active required amino acid residue also therefore selecting not to be substituted, can according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis carry out identifying (as see, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, thus determines the amino acid residue wanted of overstating to this molecular activity.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can be measured by technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (see, as de Vos etc., 1992, Science 255:306-312; Smith etc., 1992, J.Mol.Biol 224:899-904; Wlodaver etc., 1992, FEBS Letters 309:59-64).

In the present invention, Cry2Ab albumen includes but not limited to sequence 1, and the amino acid sequence with the amino acid sequence shown in sequence 1 with certain autoploidy is also included within the present invention.These sequences and sequence similarities/homogeny of the present invention are typically greater than 78%, are preferably greater than 85%, are preferredly greater than 90%, are even preferredly greater than 95%, and can be greater than 99%.Also can according to homogeny particularly and/or similarity scope definition preferred polynucleotides of the present invention and protein.Homogeny and/or the similarity of 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is such as had with the sequence of example of the present invention.

In the present invention, the genetically modified plants producing described Cry2Ab albumen include but not limited to Mon89034 transgenic corn events and/or comprise the vegetable material (as described by CN101495635A) of Mon89034 transgenic corn events, MON87751 transgenic soybean event and/or comprise the vegetable material (as described by USDA APHIS non-control state application 13-337-01p) of MON87751 transgenic soybean event, or Mon15985 transgenic cotton event and/or comprise the vegetable material (as described by CN101413028B) of Mon15985 transgenic cotton event, it all can to perform the methods of the present invention and/or purposes, namely by dichocrocis punctiferalis insect at least with Cry2Ab protein contact to realize the method and/or the purposes that control dichocrocis punctiferalis insect.Understood by one of ordinary skill in the art, the Cry2Ab albumen in above-mentioned transgenic event is expressed in different plant and also can realize method of the present invention and/or purposes.More specifically, described Cry2Ab albumen is present in the genetically modified plants at least producing described Cry2Ab albumen, described dichocrocis punctiferalis insect by the described genetically modified plants that ingest organize at least with described Cry2Ab protein contact, after contact, the growth of described east armyworm insect is suppressed and/or causes death, to realize the control to dichocrocis punctiferalis harm plant.

Regulating and controlling sequence described in the present invention include but not limited to promotor, transit peptides, terminator, enhancer, targeting sequencing, intron and other be operably connected to the adjustment sequence of described Cry2Ab albumen.

Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected coded sequence carries out the promotor expressed in plant cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, Ubi promotor, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression of coded sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the protease suppressor (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast, or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus leaders, as MDMV (Maize Dwarf Mosaic Virus) targeting sequencing; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4); Tobacco mosaic virus (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledon application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequential coding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and coded sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiation codon of coded sequence.Alternatively, if the connection of promotor and coded sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and connected mode make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing gene expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, integrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), the sequence of label function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. origin of replication of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).

" desinsection " or " pest-resistant " described in invention refers to crop pests it is poisonous, thus realizes " control " and/or " control " crop pests.Preferably, described " desinsection " or " pest-resistant " refer to and kill crop pests.More specifically, targeted insect is dichocrocis punctiferalis insect.

In the present invention, Cry2Ab albumen has toxicity to dichocrocis punctiferalis insect.Plant in the present invention, particularly soybean and corn, containing foreign DNA in its genome, described foreign DNA comprises the nucleotide sequence of coding Cry2Ab albumen, dichocrocis punctiferalis insect is by feeding plant tissue and this protein contact, and after contact, the growth of dichocrocis punctiferalis insect is suppressed and/or causes death.Suppression refers to lethal or sub-lethal.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.In addition, this plant can eliminate the needs (insecticide that described chemistry or biological insecticides are the dichocrocis punctiferalis insect for Cry2Ab albumen institute target) to chemistry or biological insecticides substantially.

In vegetable material, the expression of insecticidal crystal protein (ICP) detects by multiple method described in this area, such as undertaken quantitatively by applying the mRNA of special primer to the coded insect-killing protein produced in tissue, or the amount of the insect-killing protein of directly specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied.In the present invention, targeted insect is mainly dichocrocis punctiferalis.

In the present invention, described Cry2Ab albumen can have the amino acid sequence shown in SEQ ID NO:1 in sequence table.Except comprising the code area of Cry2Ab albumen, also can comprise other elements, the protein of such as encoding selection markers.

In addition, the expression cassette comprising the nucleotide sequence of code book invention Cry2Ab albumen can also be expressed in plant together with the protein of at least one encoding herbicide resistance gene, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), Glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of weed killer herbicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (as PPT), thus acquisition had both had high insecticidal activity, there are again the genetically modified plants of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, as by the gene of described for coding Cry2Ab albumen or expression cassette or recombinant vector importing plant cell, conventional method for transformation includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplast, electroporation or silicon whisker imports.

The invention provides a kind of purposes of insecticidal proteins, have the following advantages:

1, internal cause control.Prior art mainly controls the harm of dichocrocis punctiferalis insect by external action and external cause, as cultural control, chemical control and biological control; And the present invention controls dichocrocis punctiferalis insect by producing the Cry2Ab albumen that can kill dichocrocis punctiferalis in plant corpus, namely prevented and treated by internal cause.

2, pollution-free, noresidue.Although the chemical prevention and control method that prior art uses serves certain effect to the harm controlling dichocrocis punctiferalis insect, also pollution brought to people, animal and field ecosystem simultaneously, destroy and remain; Use the present invention to control the method for dichocrocis punctiferalis insect, above-mentioned adverse consequences can be eliminated.

3, control in the time of infertility.The method of the control dichocrocis punctiferalis insect that prior art uses is all interim; and the present invention is protection plant being carried out to the time of infertility; genetically modified plants (Cry2Ab albumen) from germination, growth, until bloom, result, the infringement suffering dichocrocis punctiferalis can be avoided.

4, whole plant control.The method of the control dichocrocis punctiferalis insect that prior art uses is locality mostly, as foliage-spray; And the present invention protects whole plant, root, blade, stem stalk, fruit, tassel, female fringe, flower pesticide, filigree etc. as genetically modified plants (Cry2Ab albumen) all can resist dichocrocis punctiferalis infringement.

5, effect stability.The biological insecticides that prior art uses need directly to spray application to crop surface, therefore cause activated crystalline protein (comprising Cry2Ab albumen) to be degraded in the environment; The present invention makes described Cry2Ab albumen express in plant corpus, efficiently avoid the defect of biological insecticides in natural world instability, and the control efficiency of genetically modified plants of the present invention (Cry2Ab albumen) in different location, different time, different genetic background is also all stable and consistent.

6, simple, convenient, economical.The biological insecticides that prior art uses easily are degraded in the environment, therefore need duplication of production and repeated application, and bring difficulty for practical application in agricultural production, substantially increase cost; The present invention only need plant the genetically modified plants can expressing Cry2Ab albumen, and does not need to adopt other measure, thus saves a large amount of human and material resources and financial resources.

7, effect is thorough.The method of the control dichocrocis punctiferalis insect that prior art uses, its effect is halfway, only plays and alleviates effect; And genetically modified plants of the present invention (Cry2Ab albumen) can cause the mortality of dichocrocis punctiferalis newly hatched larvae, and great suppression is caused to fraction survival larvae development progress, after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, it is all obvious depauperation, and stasi, genetically modified plants are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T containing Cry2Ab nucleotide sequence of the purposes of insecticidal proteins of the present invention builds flow chart;

Fig. 2 is that the recombinant expression carrier DBN100033 containing Cry2Ab nucleotide sequence of the purposes of insecticidal proteins of the present invention builds flow chart;

Fig. 3 is the blade injury figure of the transgenic corn plant inoculation dichocrocis punctiferalis of the purposes of insecticidal proteins of the present invention;

Fig. 4 is the blade injury figure of the Transgenic soybean plants inoculation dichocrocis punctiferalis of the purposes of insecticidal proteins of the present invention.

Embodiment

The technical scheme of the purposes of insecticidal proteins of the present invention is further illustrated below by specific embodiment.

The acquisition of the first embodiment, gene and synthesis

1, nucleotide sequence is obtained

The amino acid sequence (634 amino acid) of Cry2Ab insect-killing protein, as shown in SEQ ID NO:1 in sequence table; Encode corresponding to the Cry2Ab nucleotide sequence (1905 nucleotide) of the amino acid sequence of described Cry2Ab insect-killing protein, as shown in SEQ ID NO:2 in sequence table.

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing protein, as shown in SEQ ID NO:3 in sequence table; Encode corresponding to the Cry1A.105 nucleotide sequence (3534 nucleotide) of the amino acid sequence of described Cry1A.105 insect-killing protein, as shown in SEQ ID NO:4 in sequence table.

2, above-mentioned nucleotide sequence is synthesized

Described Cry2Ab nucleotide sequence (as shown in SEQ ID NO:2 in sequence table) and as described in Cry1A.105 nucleotide sequence (as shown in SEQ ID NO:4 in sequence table) synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described Cry2Ab nucleotide sequence (SEQ ID NO:2) of synthesis is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry2Ab nucleotide sequence (SEQ ID NO:2) is also connected with SpeI restriction enzyme site; 5 ' end of the described Cry1A.105 nucleotide sequence (SEQ ID NO:4) of synthesis is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1A.105 nucleotide sequence (SEQ ID NO:4) is also connected with HindIII restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transformation Agrobacterium

1, the recombinant cloning vector containing Cry2Ab gene is built

The Cry2Ab nucleotide sequence of synthesis is connected into cloning vector pGEM-T (Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by Promega Products pGEM-T carrier specification, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the origin of replication of phage f1; LacZ is LacZ initiation codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO:2); MCS is multiple clone site).

Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake), LB flat board (the tryptone 10g/L of the ampicillin (100 mg/litre) of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro-3-indoles of the bromo-4-of 5--β-D-galactoside) is scribbled on surface, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, ampicillin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant, precipitation thalline solution I (25mM Tris-HCl, the 10mM EDTA (ethylenediamine tetra-acetic acid) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1%SDS (lauryl sodium sulfate)) that 200 μ l newly prepare, pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (3M potassium acetate, 5M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume absolute ethyl alcohols in supernatant, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant, and precipitation concentration (V/V) is dry after the ethanol washing of 70%; Add TE (10mM Tris-HCl, 1mM EDTA, the PH8.0) dissolution precipitation of 30 μ l containing RNase (20 μ g/ml); Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after EcoRV and XhoI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described Cry2Ab nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:2 in sequence table, and namely Cry2Ab nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, the described Cry1A.105 nucleotide sequence of synthesis is connected on cloning vector pGEM-T, obtain recombinant cloning vector DBN02-T, wherein, Cry1A.105 is Cry1A.105 nucleotide sequence (SEQ ID NO:4).Enzyme is cut and is correctly inserted with Cry1A.105 nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T.

2, the recombinant expression carrier containing Cry2Ab gene is built

With restriction enzyme NcoI and SpeI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), between NcoI and the SpeI site Cry2Ab nucleotide sequence fragment cut being inserted into expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression carrier DBN100033, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; CaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:5); Cry2Ab:Cry2Ab nucleotide sequence (SEQ ID NO:2); Nos: the terminator (SEQ ID NO:6) of rouge alkali synthetase gene; Hpt: hygromycin phosphotransferase gene (SEQ ID NO:7); LB: left margin).

By recombinant expression carrier DBN100033 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100033), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl 10g/L, kanamycin 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme NcoI of extraction and SpeI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression carrier DBN100033 between NcoI and SpeI site is classified as nucleotide sequence, i.e. Cry2Ab nucleotide sequence shown in SEQ ID NO:2 in sequence table.

According to the method for above-mentioned structure recombinant expression carrier DBN100033, by NcoI and SpeI, NcoI and HindIII respectively enzyme cut described Cry2Ab nucleotide sequence that recombinant cloning vector DBN01-T and DBN02-T cut and Cry1A.105 nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression carrier DBN100029.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression carrier DBN100029 containing nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:4 in promising sequence table, i.e. Cry2Ab nucleotide sequence and Cry1A.105 nucleotide sequence, described Cry2Ab nucleotide sequence can be connected described CaMV35S promotor and Nos terminator with described Cry1A.105 nucleotide sequence.

3, recombinant expression carrier transformation Agrobacterium

To oneself through building correct recombinant expression carrier DBN100033 and DBN100029 liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression carrier); Be placed in liquid nitrogen 10 minutes, 37 DEG C of tepidarium 10 minutes; Agrobacterium LBA4404 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the rifampin (Rifampicin) of 50mg/L and the kanamycin (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, carry out digestion verification after recombinant expression carrier DBN100033 and DBN100029 enzyme being cut with restriction enzyme A hdI and XhoI, result show recombinant expression carrier DBN100033 and DBN100029 structure entirely true.

The acquisition of the 3rd embodiment, transfer-gen plant

1, genetically modified milpa is obtained

The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the rataria of comprehensive for the corn variety of aseptic culture 31 (Z31) and the second embodiment described in 3, so that the T-DNA in 2 recombinant expression carrier DBN100033 and DBN100029 built in the second embodiment (is comprised CaMV35S promoter sequence, Cry2Ab nucleotide sequence, Cry1A.105 nucleotide sequence, Hpt gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa proceeding to Cry2Ab nucleotide sequence and the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence, in contrast with wild-type corn plant simultaneously.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein Cry2Ab nucleotide sequence and/or Cry2Ab-Cry1A.105 nucleotide sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephalosporin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having antibiotic but is not having the solid culture medium of selective agent is cultivated, to eliminate Agrobacterium and to provide convalescence for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the medium containing selective agent (hygromycin).Preferably, rataria is having the screening solid culture medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, hygromycin 50mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid culture medium (MS differential medium and MS root media) containing the callus that the medium of selective agent grows.

Screen the resistant calli obtained and transfer to described MS differential medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, hygromycin 50mg/L, plant gel 3g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, plant gel 3g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.

2, Transgenic soybean plants is obtained

The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the cotyledonary node tissue of Huang 13 in the soybean varieties of aseptic culture and the second embodiment described in 3, so that the T-DNA in 2 recombinant expression carrier DBN100033 and DBN100029 built in the second embodiment (is comprised CaMV35S promoter sequence, Cry2Ab nucleotide sequence, Cry1A.105 nucleotide sequence, Hpt gene and Nos terminator sequence) be transferred in soybean chromosome set, obtain the soybean plant strain proceeding to Cry2Ab nucleotide sequence, proceed to the soybean plant strain of Cry2Ab-Cry1A.105 nucleotide sequence, in contrast with Wild-type soy plant simultaneously.

For agriculture bacillus mediated transformation of soybean, briefly, by the soya seeds of maturation at soybean germination medium (B5 salt 3.1g/L, B5 vitamin, sucrose 20g/L, agar 8g/L, pH5.6) in sprout, seed is inoculated on germination medium, by following CMC model: temperature 25 ± 1 DEG C; Photoperiod (light/dark) is 16/8h.Sprout and get the soybean aseptic seedling of expanding at bud green cotyledonary node place after 4-6 days, under cotyledonary node, 3-4 millimeter place cuts hypocotyl, longitudinally cuts cotyledon, removes terminal bud, lateral bud and seminal root.Wound is carried out at cotyledonary node place with the knife back of scalpel, with the cotyledonary node tissue that agrobacterium suspension contact wound is crossed, wherein Cry2Ab nucleotide sequence and/or Cry2Ab-Cry1A.105 nucleotide sequence can be passed to cotyledonary node tissue (step 1: infect step) that wound crosses in this step by Agrobacterium, and cotyledonary node is organized and preferably immersed agrobacterium suspension (OD ₆₆₀=0.5-0.8, infect in medium (MS salt 2.15g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, MES (MES) 4g/L, zeatin (ZT) 2mg/L, pH5.3) to start inoculation.Cotyledonary node tissue and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, cotyledonary node is above cultivated at solid culture medium (MS salt 4.3g/L, B5 vitamin, sucrose 20g/L, glucose 10g/L, MES (MES) 4g/L, zeatin 2mg/L, agar 8g/L, pH5.6) after being organized in and infecting step.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 2mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, pH5.6) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephalosporin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, the tissue block of cotyledon node regeneration is having antibiotic but is not having the solid culture medium of selective agent is cultivated, to eliminate Agrobacterium and to provide convalescence for infected cell.Then, the tissue block of cotyledon node regeneration cultivates the transformed calli (step 4: select step) that also growth selection on the medium containing selective agent (hygromycin).Preferably, the tissue block of cotyledon node regeneration is having screening solid culture medium (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, 6-benzyladenine (6-BAP) 1mg/L, the agar 8g/L of selective agent, cephalosporin 150mg/L, glutamic acid 100mg/L, aspartic acid 100mg/L, hygromycin 50mg/L, pH5.6) upper cultivation, cause the cell selective growth transformed.Then, the cytothesis transformed becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid culture medium (B5 differential medium and B5 root media) at the tissue block containing the cotyledon node regeneration that the medium of selective agent grows.

Screen the resistant tissues block obtained and transfer to described B5 differential medium (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, zeatin (ZT) 1mg/L, agar 8g/L, cephalosporin 150mg/L, glutamic acid 50mg/L, aspartic acid 50mg/L, gibberellin 1mg/L, growth hormone 1mg/L, hygromycin 50mg/L, pH5.6), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described B5 root media (B5 salt 3.1g/L, B5 vitamin, MES (MES) 1g/L, sucrose 30g/L, agar 8g/L, cephalosporin 150mg/L, indole-3-butyric acid (IBA) 1mg/L), in culture of rootage, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 26 DEG C, then cultivates 8 hours at 20 DEG C.

4th embodiment, verify transfer-gen plant with TaqMan

The blade getting the milpa proceeding to Cry2Ab nucleotide sequence and the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence is respectively about 100mg as sample, extract its genomic DNA with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of Cry2Ab gene and Cry1A.105 gene by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

The concrete grammar detecting Cry2Ab gene and Cry1A.105 gene copy number is as follows:

Step 11, get each 100mg of blade of the milpa proceeding to Cry2Ab nucleotide sequence, the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence and wild-type corn plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, measure the genomic DNA concentration of above-mentioned sample with NanoDrop 2000 (Thermo Scientific);

Step 14, adjust the genomic DNA concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard items, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry2Ab nucleotide sequence:

Primer 1:CTGATACCCTTGCTCGCGTC is as shown in SEQ ID NO:8 in sequence table;

Primer 2: CACTTGGCGGTTGAACTCCTC is as shown in SEQ ID NO:9 in sequence table;

Probe 1:CGCTGAGCTGACGGGTCTGCAAG is as shown in SEQ ID NO:10 in sequence table;

Following primer and probe are used for detecting Cry1A.105 nucleotide sequence:

Primer 3:GCGCATCCAGTTCAACGAC is as shown in SEQ ID NO:11 in sequence table;

Primer 4:GTTCTGGACGGCGAAGAGTG is as shown in SEQ ID NO:12 in sequence table;

Probe 2:TGAACAGCGCCCTGACCACCG is as shown in SEQ ID NO:13 in sequence table;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l 1 × TE buffer solutions, and at 4 DEG C, is housed in amber tube.

PCR reaction condition is:

SDS2.3 software (Applied Biosystems) is utilized to analyze data.

Experimental result shows, all oneself is incorporated in the chromosome set of detected milpa for Cry2Ab nucleotide sequence and Cry2Ab-Cry1A.105 nucleotide sequence, and the milpa proceeding to Cry2Ab nucleotide sequence all obtains single transgenic corn plant copied with the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence.

Verify the method for transgenic corn plant according to above-mentioned TaqMan, detection is carried out to Transgenic soybean plants and analyzes.Experimental result shows, all oneself is incorporated in the chromosome set of detected soybean plant strain respectively for Cry2Ab nucleotide sequence and Cry2Ab-Cry1A.105 nucleotide sequence, and the soybean plant strain proceeding to Cry2Ab nucleotide all obtains single Transgenic soybean plants copied with the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence.

The insect resistant effect of the 5th embodiment, transfer-gen plant detects

By proceed to Cry2Ab nucleotide sequence milpa, proceed to Cry2Ab-Cry1A.105 nucleotide sequence milpa, proceed to the soybean plant strain of Cry2Ab nucleotide sequence, proceed to the soybean plant strain of Cry2Ab-Cry1A.105 nucleotide sequence; Corresponding wild-type corn plant and soybean plant strain, and be accredited as not genetically modified milpa through Taqman and soybean plant strain carries out insect resistant effect detection to dichocrocis punctiferalis.

1, the insect resistant effect of transgenic corn plant detects

Get the milpa proceeding to Cry2Ab nucleotide sequence respectively, proceed to the milpa of Cry2Ab-Cry1A.105 nucleotide sequence, wild-type corn plant and be accredited as the fresh blade of not genetically modified milpa (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into the strip of about 1cm × 4cm simultaneously, get 1 cut after strip blade put on the moisturizing filter paper bottom round plastic culture dish, described filter paper distilled water soaks, 10 dichocrocis punctiferalis (newly hatched larvae) are put in each culture dish, after worm examination culture dish is added a cover, at temperature 25-28 DEG C, relative moisture 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to dichocrocis punctiferalis larvae development progress, lethality and blade injury rate three indexs, obtain resistance total score (full marks 300 points): resistance total score=100 × lethality+[100 × lethality+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 transformation event strains (S1, S2 and S3) of Cry2Ab nucleotide sequence, proceed to totally 3 transformation event strains (S4, S5 and S6) of Cry2Ab-Cry1A.105 nucleotide sequence, not genetically modified (NGM1) totally 1 strain is accredited as, (CK1) totally 1 strain of wild type through Taqman; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic corn plant inoculation dichocrocis punctiferalis

The result of table 1 shows: the milpa proceeding to Cry2Ab nucleotide sequence and the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence all have good insecticidal effect to dichocrocis punctiferalis, the average mortality of dichocrocis punctiferalis is all more than 70%, and its resistance total score is also all more than 240 points; And be accredited as the resistance total score of not genetically modified milpa and wild-type corn plant generally at about 30 points through Taqman.

The result of Fig. 3 shows: compared with wild-type corn plant, and the milpa proceeding to Cry2Ab nucleotide sequence and the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence can cause the mortality of dichocrocis punctiferalis newly hatched larvae.And great suppression is caused to fraction survival larvae development progress, after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, the insect of this suppressed growth cannot survive under field conditions (factors).And the milpa proceeding to Cry2Ab nucleotide sequence is only subject to slight damage substantially with the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence, be only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 25%.Especially the damage proceeded on the milpa of Cry2Ab-Cry1A.105 nucleotide sequence is almost the sightless states of naked eyes.

The milpa proving thus to proceed to Cry2Ab nucleotide sequence and the milpa proceeding to Cry2Ab-Cry1A.105 nucleotide sequence all demonstrate the activity of high resistance dichocrocis punctiferalis, and this activity is enough to the growth of dichocrocis punctiferalis is produced to ill effect thus makes it be controlled.Causing harm by controlling taking food of dichocrocis punctiferalis simultaneously, also likely reducing the generation of disease on corn, improving the Yield and qualities of corn greatly.

2. the insect resistant effect of Transgenic soybean plants detects

Get the soybean plant strain proceeding to Cry2Ab nucleotide sequence respectively, proceed to the soybean plant strain of Cry2Ab-Cry1A.105 nucleotide sequence, Wild-type soy plant and be accredited as the fresh blade of not genetically modified soybean plant strain (Seedling Stage) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then soybean leaves is cut into the strip of about 2cm × 4cm, get 1 cut after strip blade put on the moisturizing filter paper bottom round plastic culture dish, 10 dichocrocis punctiferalis (newly hatched larvae) are put in each culture dish, after worm examination culture dish is added a cover, at temperature 25-28 DEG C, relative moisture 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to dichocrocis punctiferalis larvae development progress, lethality and blade injury rate three indexs, obtain resistance total score (full marks 300 points): resistance total score=100 × lethality+[100 × lethality+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 transformation event strains (S7, S8 and S9) of Cry2Ab nucleotide sequence, proceed to totally 3 transformation event strains (S10, S11 and S12) of Cry2Ab-Cry1A.105 nucleotide sequence, not genetically modified (NGM2) totally 1 strain is accredited as, (CK2) totally 1 strain of wild type through Taqman; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 2 and Fig. 4.

The pest-resistant experimental result of table 2, Transgenic soybean plants inoculation dichocrocis punctiferalis

The result of table 2 shows: the soybean plant strain proceeding to Cry2Ab nucleotide sequence and the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence all have good insecticidal effect to dichocrocis punctiferalis, the average mortality of dichocrocis punctiferalis is all more than 70%, and its resistance total score is also all more than 230 points; And be accredited as the resistance total score of not genetically modified soybean plant strain and Wild-type soy plant generally at about 50 points through Taqman.

The result of Fig. 4 shows: compared with Wild-type soy plant, the soybean plant strain proceeding to Cry2Ab nucleotide sequence and the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence all can cause the mortality of dichocrocis punctiferalis newly hatched larvae, and great suppression is caused to fraction survival larvae development progress, the insect of this suppressed growth cannot survive under field conditions (factors), after 3 days larva be substantially still in state of just incubating or between just incubating-negative control state between, and the soybean plant strain proceeding to Cry2Ab nucleotide sequence is only subject to slight damage substantially with the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence, be only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 35%, especially proceeding to the damage that the soybean plant strain of Cry2Ab-Cry1A.105 nucleotide sequence is formed is almost the sightless states of naked eyes.

The soybean plant strain proving thus to proceed to Cry2Ab nucleotide sequence and the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence all demonstrate the activity of high resistance dichocrocis punctiferalis, and this activity is enough to the growth of dichocrocis punctiferalis is produced to ill effect thus makes it be controlled.Causing harm by controlling taking food of dichocrocis punctiferalis simultaneously, also likely reducing the generation of disease on soybean, improving the Yield and qualities of soybean greatly.

Above-mentioned experimental result also shows the milpa proceeding to Cry2Ab nucleotide sequence, proceed to the milpa of Cry2Ab-Cry1A.105 nucleotide sequence, the soybean plant strain proceeding to Cry2Ab nucleotide sequence and the control/control of the soybean plant strain proceeding to Cry2Ab-Cry1A.105 nucleotide sequence to dichocrocis punctiferalis are obviously because plant itself can produce Cry2Ab albumen, so, well known to those skilled in the art, according to the identical toxic action of Cry2Ab albumen to dichocrocis punctiferalis, the transfer-gen plant that can produce similar expressed Cry2Ab albumen can be used in the harm preventing and treating dichocrocis punctiferalis.In the present invention, Cry2Ab albumen includes but not limited to the Cry2Ab albumen of given amino acid sequence in embodiment, transfer-gen plant can also produce the second insect-killing protein that at least one is different from Cry2Ab albumen, as Vip plastein, Cry plastein etc. simultaneously.

In sum, the purposes of insecticidal proteins of the present invention controls dichocrocis punctiferalis insect by producing the Cry2Ab albumen that can kill dichocrocis punctiferalis in plant corpus; The cultural control method used with prior art, chemical prevention and control method are compared with biological control method; the present invention to plant carry out the time of infertility, whole plant protection to prevent and treat the infringement of dichocrocis punctiferalis insect; and pollution-free, noresidue, effect stability, thoroughly, simple, convenient, economical.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims (20)

1. control a method for dichocrocis punctiferalis insect, it is characterized in that, comprise by dichocrocis punctiferalis insect at least with Cry2Ab protein contact.

2. the method for control dichocrocis punctiferalis insect according to claim 1, it is characterized in that, described Cry2Ab albumen is present in the host cell at least producing described Cry2Ab albumen, described dichocrocis punctiferalis insect by ingest described host cell at least with described Cry2Ab protein contact.

3. the method for control dichocrocis punctiferalis insect according to claim 2, it is characterized in that, described Cry2Ab albumen is present in the bacterium or genetically modified plants at least producing described Cry2Ab albumen, described dichocrocis punctiferalis insect by ingest described bacterium or described genetically modified plants organize at least with described Cry2Ab protein contact, after contact, described dichocrocis punctiferalis insect growth is suppressed and/or causes death, to realize the control to dichocrocis punctiferalis harm plant.

4. the method for control dichocrocis punctiferalis insect according to claim 3, it is characterized in that, described genetically modified plants can be in any breeding time.

5. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, described genetically modified plants be organized as root, blade, stem stalk, fruit, tassel, female fringe, flower pesticide or filigree.

6. the method for control dichocrocis punctiferalis insect according to claim 3, is characterized in that, the described control to dichocrocis punctiferalis harm plant does not change because planting the change in place and/or implantation time.

7. the method for the control dichocrocis punctiferalis insect according to any one of claim 3 to 6, it is characterized in that, described plant is from corn, sunflower, soybean, Chinese sorghum, Chinese chestnut, peach, pomegranate, apple, tomato, eggplant, sugarcane, turfgrass, cotton, rape or strawberry.

8. the method for the control dichocrocis punctiferalis insect according to any one of claim 2 to 7, is characterized in that, the step before described contact procedure is the plant of the polynucleotides of plantation containing the described Cry2Ab albumen of coding.

9. the method for the control dichocrocis punctiferalis insect according to any one of claim 1 to 8, is characterized in that, the amino acid sequence of described Cry2Ab albumen has the amino acid sequence shown in SEQ ID NO:1.

10. the method for control dichocrocis punctiferalis insect according to claim 9, it is characterized in that, the nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:2.

The method of 11. control dichocrocis punctiferalis insects according to any one of claim 2 to 10, it is characterized in that, described plant can also comprise the second nucleotide that at least one is different from the nucleotide of described Cry2Ab albumen of encoding.

The method of 12. control dichocrocis punctiferalis insects according to claim 11, is characterized in that, described the second nucleotide coding Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase.

The method of 13. control dichocrocis punctiferalis insects according to claim 12, is characterized in that, described the second nucleotide coding Cry1A.105 albumen or Vip3A albumen.

The method of 14. control dichocrocis punctiferalis insects according to claim 13, it is characterized in that, the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:3.

The method of 15. control dichocrocis punctiferalis insects according to claim 14, it is characterized in that, described the second nucleotide has the nucleotide sequence of SEQ ID NO:4.

The method of 16. control dichocrocis punctiferalis insects according to claim 11, it is characterized in that, described the second nucleotide is the dsRNA suppressing important gene in target insect pests.

17. 1 kinds of Cry2Ab protein control the purposes of dichocrocis punctiferalis insect.

18. 1 kinds of methods producing the plant controlling dichocrocis punctiferalis insect, is characterized in that, comprise the polynucleotide sequence introducing coding Cry2Ab albumen in the genome of described plant.

19. 1 kinds of methods producing the plant seed controlling dichocrocis punctiferalis insect, is characterized in that, comprise and the first plant obtained by method described in claim 18 and the second plant hybridizes, thus produce the seed of the polynucleotide sequence containing Cry2Ab albumen of encoding.

20. 1 kinds of methods of cultivating the plant controlling dichocrocis punctiferalis insect, is characterized in that, comprising:

Plant at least one plant seed, the genome of described plant seed comprises the polynucleotide sequence of coding Cry2Ab albumen;

Described plant seed is made to grow up to plant;

Described plant is grown under the condition of artificial infection dichocrocis punctiferalis insect and/or dichocrocis punctiferalis insect naturally-occurring harm, there is compared with the plant of gathering in the crops the polynucleotide sequence with other without Cry2Ab albumen of encoding the plant of the plant injury weakened and/or the plant products with increase.