CN103636653B - Pest control method - Google Patents

Abstract

The invention relates to a method for controlling Athetis lepigone pests. The method includes contacting Athetis lepigone pests with Cry1A.105 protein. According to the invention, the Athetis lepigone pests are controlled by the Cry1A.105 protein that is generated in plants and can kill Athetis lepigone. Compared with the agricultural control method and chemical control method employed in the prior art, the method provided by the invention provides whole growth period and whole plant protection to plants so as to prevent and control disoperation of Athetis lepigone pests. Being simple, convenient and economical, the method provided by the invention has no pollution, no residue, as well as stable and thorough effects.

Description

The method of Control pests

Technical field

The present invention relates to a kind of method of Control pests, particularly relate to a kind of Cry1A.105 albumen of expressing in plant that is used in and control the method that 2 committee noctuids endanger plants.

Background technology

2 committees noctuid (Athetis lepigone) belong to Lepidoptera Noctuidae, for polyphagous pest-insect, its main harm corn crop of current discovery, is mainly distributed in China's Huang-Huai-Hai summer corn growing area, is mainly distributed in the ground such as Japan, Korea, Russia, Europe overseas.2 committee noctuids are mainly at the upper soll layer place harm corn root at corn aerial root place, bite cane or shallow top layer root on corn field broken, the corn field the lighter milpa endangered is dilapidated, and severe one causes the disconnected ridge that is short of seedling, there is the blank ground of large area in corn field, endanger serious plot and even ruin kind.

Corn is Chinese main cereal crops, on July 9th, 2011, a situation arises in China for Chinese Central Television's news hookup reported first 2 committee noctuid, 31, on Mays of autumn to 2012 in 2011, Maize Industry system Bing Chong prevention and control research department of country is by repeatedly field investigation, and find that the population quantity of surviving the winter of 2012 year, 2 committee noctuids is comparatively large, insect population radix is higher, generation Larvae Population density is large, has continue to break out the possibility caused harm at Huang-Huai-Hai Summer Corn Seedlings.In order to prevent and treat 2 committee noctuids, the prevention and controls that people mainly adopt at present has: cultural control and chemical control.

Cultural control manages the comprehensive coordination of factor multiple in whole field ecosystem, regulation and control crop, insect, environmental factor, creation one are conducive to plant growth and are unfavorable for the farmland ecological environment that 2 committee noctuids occur, as removed the coverings such as maize seedling base portion wheat straw, weeds in time to large and expose ground, so that subsequent administrations agent directly can touch 2 committee noctuids away from the corn of plant in the ranks.Because cultural control must obey the requirement of crop allocation and volume increase, application has certain limitation, as emergency measure, can not just seem helpless when 2 committee's noctuid outbursts.

Chemical control and pesticide control, utilize chemical insecticide to carry out kill pests, it is the important component part of 2 committee's noctuid comprehensive regulations, it has fast, the feature of convenient, easy and high economic benefit, particularly when 2 committee's large generations of noctuid, be absolutely necessary emergency measure, and it can reduce insect density to a certain extent before 2 committee noctuids work the mischief.Current chemical prevention and control method mainly contains bait method, pesticide-clay mixture method, perfusion method and spraying pesticide etc.But chemical control also has its limitation, as improper use often cause crops generation poisoning, insect develops immunity to drugs, and killed natural enemies, contaminated environment, make field ecosystem suffer the adverse consequencess such as destruction and the safety of residue of pesticide to people, animal constitute a threat to; And because of 2 committee's noctuid happiness humidities, dark environment, generally hide under the coverings such as wheat straw or soil table, make chemical pesticide be difficult to directly contact 2 committee noctuid polypides and make control efficiency not good.

In order to solve cultural control and chemical control limitation in actual applications, scientists finds the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some insect-resistant transgenic plants to prevent and treat insect pest of the plant.Cry1A.105 insecticidal proteins is the one in numerous insecticidal proteins, is the companion's spore crystalline protein produced by bacillus thuringiensis storehouse Stuckey subspecies (Bacillus thuringiensis subsp.kurstaki, B.t.k.).

Cry1A.105 albumen is taken in by insect and is entered middle intestines, under toxalbumin parent toxin is dissolved in the alkaline pH environment of insect midgut.Parent toxin, by basic protein enzymic digestion, is transformed into active fragment by albumen N-and C-end; Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cell membrane to occur perforation focus, destroys osmotic pressure change inside and outside cell membrane and pH balance etc., upsets the digestion process of insect, finally cause it dead.

The plant having proved to turn Cry1A.105 gene can resist the infringement of Lepidoptera (Lepidoptera) insects such as corn borer, cotton bollworm, black cutworm, but, there is no so far and control 2 committee noctuids to the report of plant hazard about by producing the transfer-gen plant of expressing Cry1A.105 albumen.

Summary of the invention

The object of this invention is to provide a kind of method of Control pests, provide first and control 2 committee noctuids to the method for plant hazard by producing the transfer-gen plant of expressing Cry1A.105 albumen, and effectively overcome the technological deficiencies such as prior art cultural control and chemical control.

For achieving the above object, the invention provides a kind of method controlling 2 committee noctuid insects, comprise 2 committee noctuid insects and Cry1A.105 protein contact.

Further, described Cry1A.105 albumen is present in the plant cell producing described Cry1A.105 albumen, and described 2 committee noctuid insects are by described plant cell and the described Cry1A.105 protein contact of ingesting.

Further, described Cry1A.105 albumen is present in the genetically modified plants producing described Cry1A.105 albumen, described 2 committee noctuid insects are by the tissue of the described genetically modified plants that ingest and described Cry1A.105 protein contact, after contact, the noctuid insect growth of described 2 committees is suppressed and finally causes death, to realize the control to 2 committee noctuid harm plants.

Described genetically modified plants can be in any breeding time.

The tissue of described genetically modified plants can be root, blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

The described control to 2 committee noctuid harm plants does not change because planting the change in place.

The described control to 2 committee noctuid harm plants does not change because of the change of implantation time.

Described plant can be corn.

Step before described contact procedure is the plant of the polynucleotides of plantation containing the described Cry1A.105 albumen of coding.

Preferably, the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:1.The nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

On the basis of technique scheme, described plant can also produce the second nucleotide that at least one is different from described Cry1A.105 albumen.

Further, described the second nucleotide can be encoded Cry class insect-killing protein, Vip class insect-killing protein, protease inhibitors, agglutinin, α-amylase or peroxidase.

Preferably, described the second nucleotide can be encoded Cry2Ab albumen or Vip3A albumen.

Further, described the second nucleotide comprises SEQ ID NO:3 or the nucleotide sequence shown in SEQ ID NO:4.

Selectively, described the second nucleotide is the dsRNA suppressing important gene in target insect pests.

For achieving the above object, present invention also offers the purposes that a kind of Cry1A.105 protein controls 2 committee noctuid insects.

In the present invention, the expression of Cry1A.105 albumen in a kind of genetically modified plants can along with the expression of one or more Cry class insect-killing protein and/or Vip class insect-killing protein.This kind of Pesticidal toxins co expression in same strain genetically modified plants that exceedes can make plant comprise by genetic engineering and gene needed for expressing realizes.In addition, a Plants (the 1st parent) can express Cry1A.105 protein by genetic engineering procedure, and the second plant (the 2nd parent) can express Cry class insect-killing protein and/or Vip class insect-killing protein by genetic engineering procedure.The progeny plants of all genes of expressing introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.

RNA interference (RNA interference, RNAi) refer to high conservative during evolution, brought out by double-stranded RNA (double-stranded RNA, dsRNA), the phenomenon of the efficient selective degradation of homologous mRNA.Therefore the expression of specific gene in RNAi technology specific depletion or closedown target insect pests can be used in the present invention.

2 committees noctuid (Athetis lepigone) belong to Lepidoptera Noctuidae together with black cutworm (Agrotis ypsilon Rottemberg), although it encroaches in position and form close, but 2 committee noctuids and black cutworm be biologically clearly, distinct two species, at least there is the following main distinction:

1, feeding habits are different.2 committee noctuids, except serious threat summer corn, still work the mischief to peanut and soybean; And black cutworm is polyphagous pest-insect, that very large soil insect is endangered to agriculture, forest seedling, except harm corn, Chinese sorghum, grain etc. make beyond the region of objective existence, the nursery stock such as main harm larch, Korean pine, Manchurian ash, Juglans mandshurica northeastward, nursery stocks such as south harm masson pine, China fir, mulberry, tea, nursery stocks such as northwest harm Chinese pine, arrow-leaved oleaster, fruit trees.

2, distributed areas are different.Current 2 committee noctuids mainly in the Hebei in Huang-Huai-Hai summer corn district, Shandong, Henan, Shanxi, Jiangsu, Anhui totally 6 province 47 ground (city), 297 counties (city, district) break out harm; And the Yangtze river basin that black cutworm is enriched with rainfall in China, weather is moistening and southeastern coast generating capacity are greatly, mostly occur at east and southern humid region in the Northeast.

3, Damage habits is different.2 committee noctuids are at Part of Hebei Province summer corn, and the corn field especially broadcast with wheat cover occurs heavy, under the broken wheat straw of mainly hiding around corn seedling with larva or at the topsoil harm maize seedling of 2-5 centimetre, a general strain has worm 1-2 head, and many reaches 10-20 head; In the plot of corn seedling 3-5 leaf phase, larva mainly stings food Maize Stem base portion, forms 3-4 millimeter circle or oval hole, cuts off nutrient delivery, cause overground part corn core leaf withering withered; Mainly bite corn root broken the plot larva of maize seedling comparatively large (8-10 leaf phase), comprise aerial root and main root, cause corn lodging, severe patient is withered.Harm strain rate is generally at 1%-5%, and serious plot reaches 15%-20%.And black cutworm 1-2 instar larvae all can be clustered in round the clock seedling top heart tender leaf place take food harm; Disperse after 3 ages, larva Quick off the mark, have seemingly-dead habit, very responsive to light, be subject to agitation and namely crispatura agglomerating, hide daytime between the dry wet layer of table soil, be unearthed night from ground, seedling plants to be bitten broken and pull soil pit into or sting the seed that food is not unearthed, food tender leaf and blade and growing point is changed after the sclerosis of seedling stem, when inanition or searching hibernacle, there is transport phenomena.

4, morphological feature is different.

1) form of ovum is different: two ovum selecting committee noctuid become steamed bun shape, above have longitudinal ridge, primiparity yellow green, rear khaki; And the ovum of black cutworm also becomes steamed bun shape, tool is carina in length and breadth, primiparity milky, and gradual change is yellow, ovum one top tool stain before hatching.

2) form of larva is different: long about the 20mm of mature larva body of 2 committee noctuids, body colour lark, head brown, larva 14-18mm is long, yellow-gray or pitchy, obvious feature is the dark brown speckle that a body segment has an inverted triangle, and there are two brown dorsopleural lines at the belly back side, disappears to pereonite; And black cutworm larvae cylindrical shape, the long 37-50mm of mature larva body, head brown, the irregular reticulate pattern of tool pitchy, body ash is brown to crineous, the particle that body surface is coarse, cloth is not of uniform size and separated from one another, lineback, sub-lineback and the equal pitchy of spiracular line, pronotary crineous, tool two obvious dark brown longitudinal bands, pereiopoda and abdominal foot yellowish-brown on yellowish-brown podical plate.

3) form of pupa is different: long about the 10mm of pupa of 2 committee noctuids, and the initial stage of pupating is khaki, gradually becomes brown, and mature larva buries and is a silk quality Tu Jianbao and pupated by interior; And the long 18-24mm of the pupa of black cutworm, russet have light, mouthpart is mutually neat with wing bud end, all stretch and reach the 4th uromere trailing edge, belly 4-7 saves back side leading edge central authorities dark brown, and has thick punctum, and the tiny punctum of both sides extends near valve, 5-7 ventrite leading edge also has tiny punctum, and abdomen end tool short cremaster 1 is right.

4) form of adult is different: 2 committee noctuids become the long 10-12mm of polypide, wing expanse 20mm, and female worm can slightly larger than male worm, head, chest, abdomen taupe, fore wing taupe, has crineous choice refreshments, interior lines, outside line crineous, ring grain is a stain, kidney line is little, the edge be made up of stain, outside concave, there is a white point, outside line undaform, wing outer rim has a row stain, and hind wing white is micro-brown, petiolarea crineous, belly taupe, the valvae end halves of male moth genitalia is wide, back of the body emargination, there is a hamulus at middle part, has thorn-like cornuti in adeagus, and the long 17-23mm of Agrotis Ypsilon body, wing expanse 40-54mm, head, chest back side crineous, foot brown, front foot shin, digitus outer rim taupe, middle metapedes respectively saves end taupe ring grain, fore wing brown, costal field pitchy, many crineous within outer rim, baseline is light brown, horizontal line two-wire in black waveform, a circle greyness is had in black ring grain, kidney shape line black tool black surround, its outer middle part has the black line of a wedge shape to extend outer horizontal line, middle horizontal line crineous waveform, the outer horizontal line brown of two-wire waveform, the sub-border line grey of irregular zigzag, its inner rim has three pointed tooths between middle arteries and veins, on each arteries and veins, pore is had between sub-border line and outer horizontal line, border line black, filbert between outer horizontal line and sub-border line, pitchy beyond sub-border line, hind wing canescence, longitudinal vein and edge line brown, belly back side grey.

5, habit of growth is different with pests occurrence rule.2 committee's exigua larvaes had for 6 ages altogether, and about 18 days larval phases, the resistance of larva is stronger; 2 committee noctuid adults have two obvious moth peaks: occur the 1st moth peak before at the beginning of 7 months, mid or late July to August, the 2nd moth peak appearred in early and middle ten days; Adult has stronger fecundity: average single female egg laying amount can reach 300-500 grain, sustainable 3-7 days of laying eggs, and the incubation rate of ovum is close to 100%; Rotation of crops corn field in cotton field occurs serious than continuous cropping corn field, it is serious that the large ratio of wheat bran Wheat-straw mulching area does not have wheat straw wheat bran to cover, evening sowing time serious more Zao than the sowing time, little serious of the large humidity ratio of field humidity, 2 committee noctuids like dark and damp environment, often hide in wheat straw or soil, cause great inconvenience to spraying pesticide.And 3-4 generation occurs black cutworm for 1 year, mature larva or pupa are survived the winter in soil; Early spring, early March adult started to occur, generally mid or late March and April early and middle ten days there will be two moth appearances and contain the phases; Adult inertia on daytime, contains most to the activity first half of the night at dusk, likes eating acid, the fermentation product of sweet, vinosity and various nectar, and having phototaxis, larva was divided into for 6 ages, and 1,2 instar larvaes first hide volt in the lobus cardiacus of assorted leather or plant, take food round the clock, at this moment appetite is very little, causes harm also very not remarkable; After 3 ages, daytime hides under table soil, and night out causes harm; 5,6 instar larvae appetite increase, and every bar larva one can bite dish seedling 4-5 strain broken night, and many reaches more than l0 strain; Larva 3 significantly increases the resistance of medicament after age; The serious period of 1st generation larva harm by the end of March to mid-April; Occur all to see occurrence and harm from October in April, the 2nd from generation to generation; The Northwest two is to three generations, and to the north of Great Wall, general year two arrives three generations, year three generations to the north of the Yellow River on the south Great Wall, the Yellow River to reach Nian Sidai along the Yangtze River in the south, generation in year four to five on the south the Changjiang river, generation in South Subtropical Area of China year six to seven; No matter generation is how many year, causes the first brood of larvae that is of serious harm on producing; South the winter generation adult February occur, the national most area emergence Sheng phase late March on April, the middle ten days, Ningxia, the Inner Mongol are late April; Agrotis Ypsilon is many 3 to sprout wings in the afternoon up to evening 10 time, hides daytime in the place such as foreign material and gap, starts to circle in the air, look for food after dusk, mating after 3-4 days, to lay eggs; Ovum fall apart originate on the close weeds of short leaf and seedling, minority originates in dead leaf, in soil seam, the place near the ground ovum that falls is maximum, often female 800-1000 grain of laying eggs, nearly 2000; About about 5 days ovum phase, larva 6 age, indivedual 7-8 age, larval phase, differs greatly in various places, but the first generation is about 30-40 days; Pupate in dark about 5cm soil room after larva is aging, pupa time is about 9-19 days; To the growth of black cutworm and disadvantage of reproduction, thus there is negligible amounts in high temperature summer, suitable survival temperature is 15 DEG C-25 DEG C; Winter temperature is too low, and the lethality of black cutworm larvae increases; All physical features low humidities, the place that rainfall is abundant, occurs more; The first year autumn rain many, soil moisture is large, weedy to be conducive to Adult worms producting eggs and larval feeding movable, is the omen of the large generation of Second Year; But precipitation is too much, and humidity is excessive, is unfavorable for larvae development, very easily dead after first instar larvae waterflooding; It is heavier in the harm of the area of 15-20% that Adult worms producting eggs contains phase soil moisture content; Sandy loam, easily permeable, draining is rapid, is suitable for black cutworm breeding, and heavy clay and sandy soil then occur lighter.

Comprehensively above-mentioned, can determine that 2 committee noctuids and black cutworm are two kinds of insects, and affiliation is comparatively far away, mating cannot produces offspring.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to any genetic material in plant, plant tissue or plant cell, and comprises cell nucleus and plastid and mitochondrial genomes.

Polynucleotides described in the present invention and/or nucleotide are formed complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, under polynucleotides of the present invention and/or nucleotide can being placed in the regulating and controlling sequence control of object host.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand creating DNA in plant.Like this, the present invention includes the use of polynucleotides to example in sequence table and complementary strand thereof." coding strand " that this area often uses refers to the chain be combined with antisense strand.In order to marking protein in vivo, DNA chain is transcribed into the complementary strand of a mRNA by typical case, and it translates protein as template.MRNA is actually and transcribes from " antisense " chain of DNA." have justice " or " coding " chain has a series of codon (codon is three nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form destination protein matter or peptide.The present invention also comprises RNA and the PNA(peptide nucleic acid having suitable function with the DNA of example).

Nucleic acid molecule of the present invention or its fragment under strict conditions with Cry1A.105 gene recombination of the present invention.The nucleic acid hybridization of any routine or amplification method may be used to the existence identifying Cry1A.105 gene of the present invention.Nucleic acid molecules or its fragment can carry out specific hybrid with other nucleic acid molecules in any case.In the present invention, if two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecules can carry out specific hybrid to each other.If two nucleic acid molecules demonstrate complementary completely, then one of them nucleic acid molecules is claimed to be another nucleic acid molecules " complement ".In the present invention, when corresponding nucleotide complementary with another nucleic acid molecules of each nucleotide of a nucleic acid molecules, then these two nucleic acid molecules are claimed to demonstrate " complete complementary ".If two nucleic acid molecules can make their annealing and being bonded to each other under at least conventional " low strict " condition with enough stability phase mutual crosses, then claim these two nucleic acid molecules for " minimum level is complementary ".Similarly, if two nucleic acid molecules can make them anneal under " highly strict " condition of routine and be bonded to each other with enough stability phase mutual crosses, then these two nucleic acid molecules are claimed to have " complementarity ".Depart from from complete complementary and can allow, depart from as long as this and not exclusively stop two molecules to form duplex structure.In order to enable a nucleic acid molecules as primer or probe, only need to ensure that it has sufficient complementarity in sequence, to make form stable duplex structure under adopted specific solvent and salinity.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, this nucleic acid molecules under high stringency can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matched.Promote the stringent condition be applicable to of DNA hybridization, such as, process greatly under 45 DEG C of conditions by 6.0 × sodium chloride/sodium citrate (SSC), then wash with 2.0 × SSC under 50 DEG C of conditions, these conditions are known to those skilled in the art.Such as, the salinity in washing step can be selected from Low stringency conditions about 2.0 × SSC, 50 DEG C to high stringency about 0.2 × SSC, 50 DEG C.In addition, the temperature condition in washing step from the room temperature of Low stringency conditions about 22 DEG C, can be elevated to about 65 DEG C of high stringency.Temperature condition and salinity can all change, and also can one of them to remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C, with SEQ ID NO:2, specific hybrid occurs, and then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and the sequence of hybridizing with SEQ ID NO:2 of the present invention under strict conditions comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about sequence homology of 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger.

Gene described in the present invention and protein not only comprise specific exemplary sequence, the part also comprising the insecticidal activity feature of the protein saving described particular example with/fragment (comprising compared with full length protein and/or terminal deletion), variant, mutant, substituent (having alternative amino acid whose protein), chimera and fusion.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the equivalent protein of insecticidal activity.Described " equivalent protein " refers to the bioactive albumen with the albumen of claim with identical or substantially identical anti-2 noctuid insects of entrusting.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refers to a part or its artificial reconstructed form (being such as applicable to the sequence of expression of plants) of original DNA or the protein sequence (nucleotide or amino acid) related to, can there is change in the length of foregoing sequences, but length is enough to guarantee that (coding) protein is insect toxins.

Use standard technique can build gene variant with being easy to by modifier gene.Such as, the technology of well known manufacturing place sudden change.Such as U.S. Patent number 5605793 describes and after random fracture, to use DNA to reassembly produce the method for other molecular diversity again.Commercialization endonuclease can be used to manufacture the fragment of full-length gene, and exonuclease can be used according to standardization program.Such as, enzyme such as Bal31 or direct mutagenesis can be used to excise nucleotide from the end system of these genes.Multiple restriction enzyme can also be used to obtain the gene of encode active fragments.Protease can be used directly to obtain the active fragment of these toxin.

The present invention can derive equivalent protein and/or the gene of these equivalent protein of encoding from B.t. separator and/or DNA library.Multiple method is had to obtain insecticidal proteins of the present invention.Such as, the present invention's antibody that is open and claimed insecticidal proteins can be used to identify from protein mixture and be separated other albumen.Especially, antibody may be that the most constant by albumen and the most different from other B.t. albumen protein parts causes.Then these antibody can be used exclusively to identify the equivalent protein of activity characteristic by immunoprecipitation, enzyme linked immunosorbent assay (ELISA) (ELISA) or western immunoblot method.This area standardization program can be used to be easy to the antibody of the fragment preparing albumen or equivalent protein or this plastein disclosed in the present invention.Then the gene of these albumen of coding can be obtained from microorganism.

Due to the Feng Yuxing of genetic codon, multiple different DNA sequence dna can be encoded identical amino acid sequence.Produce the alternative DNA sequence dna of the identical or substantially identical albumen of these codings just in the technical merit of those skilled in the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, disappearance, interpolation or insertion but does not affect in fact the sequence of insecticidal activity, also comprises the fragment retaining insecticidal activity.

The replacement of amino acid sequence in the present invention, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, and the folding and/or active conserved amino acid namely significantly not affecting albumen replaces; Little disappearance, usually about 1-30 amino acid whose disappearance; Little amino or c-terminus extend, and such as aminoterminal extends a methionine residues; Little connection peptide, such as an about 20-25 residue is long.

The conservative example replaced is the replacement occurred in following amino acid group: basic amino acid (as arginine, lysine and histidine), acidic amino acid (as glutamic acid and aspartic acid), polar amino acid (as glutamine, asparagine), hydrophobic amino acid (as leucine, isoleucine and valine), ArAA (as phenyl alanine, tryptophan and tyrosine), and Small molecular amino acid (as glycine, alanine, serine, threonine and methionine).Usually those 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors not changing given activity are well-known in this area, and by, such as, N.Neurath and R.L.Hill was described in new york academic publishing house (Academic Press) " Protein " that publish in 1979.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region played an important role to molecular function, and still produces active peptides.For by polypeptide of the present invention, it is active required and therefore select amino acid residue of not being substituted, can according to methods known in the art, as direct mutagenesis or alanine scanning mutagenesis carry out identifying (as see, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in the molecule, detects the anti-insect activity of gained mutating molecule, thus determines the amino acid residue wanted of overstating to this molecular activity.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can be measured by technology such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (see, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

In the present invention, Cry1A.105 albumen includes but not limited to Cry1A.105 albumen, or has at least 70% autoploidy with the amino acid sequence of above-mentioned albumen and 2 noctuids of entrusting had to desinsection fragment or the functional area of insecticidal activity.

Therefore, the amino acid sequence having certain autoploidy with the amino acid sequence shown in sequence 1 is also included within the present invention.These sequences and sequence similarities/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can according to homogeny particularly and/or similarity scope definition preferred polynucleotides of the present invention and protein.Homogeny and/or the similarity of 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% is such as had with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhancer, targeting sequencing, intron and other be operably connected to the adjustment sequence of described Cry1A.105 albumen.

Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected coded sequence carries out the promotor expressed in plant cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression of coded sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the coded sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the protease suppressor (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).

Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast, or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing (encephalomyocarditis virus 5 ' noncoding region); Potyvirus leaders, as MDMV(Maize Dwarf Mosaic Virus) targeting sequencing; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate targeting sequencing (AMV RNA4); Tobacco mosaic virus (TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, figwort mosaic virus (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV) enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV) enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledon application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequential coding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and coded sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiation codon of coded sequence.Alternatively, if the connection of promotor and coded sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and connected mode make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing gene expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, integrase recognition site), sequence (the i.e. antibiotic resistance markers of selectivity function is provided, biosynthesis gene), the sequence of label function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. origin of replication of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests.More specifically, targeted insect is 2 committee noctuid insects.

In the present invention, Cry1A.105 albumen has toxicity to 2 committee noctuid insects.Plant in the present invention, particularly corn, containing foreign DNA in its genome, described foreign DNA comprises the nucleotide sequence of coding Cry1A.105 albumen, 2 committee noctuid insects, by feeding plant tissue and this protein contact, contact the noctuid insect growth of rear 2 committees and are suppressed and finally cause death.Suppression refers to lethal or sub-lethal.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.In addition, this plant can eliminate the needs (insecticide that described chemistry or biological insecticides are 2 committee noctuid insects for Cry1A.105 albumen institute target) to chemistry or biological insecticides substantially.

In vegetable material, the expression of insecticidal crystal protein (ICP) detects by multiple method described in this area, such as undertaken quantitatively by applying the mRNA of special primer to the coded insect-killing protein produced in tissue, or the amount of the insect-killing protein of directly specific detection generation.

The insecticidal effect of ICP in different test determination plants can be applied.In the present invention, targeted insect is mainly 2 committee noctuids.

In the present invention, described Cry1A.105 albumen can have the amino acid sequence shown in SEQ ID NO:1 in sequence table.Except comprising the code area of Cry1A.105 albumen, also can comprise other elements, the code area of such as encode the second desinsection nucleotide, the protein of encoding selection markers or the protein of conferring herbicide resistance.

In addition, the expression cassette comprising the nucleotide sequence of code book invention Cry1A.105 albumen can also be expressed in plant together with the protein of at least one encoding herbicide resistance gene, described herbicide resistance gene includes but not limited to, phosphine oxamate resistant gene is (as bar gene, pat gene), phenmedipham resistant gene (as pmph gene), Glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene, sulfonylurea resistance gene, to the resistant gene of weed killer herbicide dalapon, to the resistant gene of cyanamide or the resistant gene of glutamine synthetase inhibitor (as PPT), thus acquisition had both had high insecticidal activity, there are again the genetically modified plants of Herbicid resistant.

In the present invention, by Exogenous DNA transfered plant, as by the gene of described for coding Cry1A.105 albumen or expression cassette or recombinant vector importing plant cell, conventional method for transformation includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplast, electroporation or silicon whisker imports.

The invention provides a kind of method of Control pests, have the following advantages:

1, internal cause control.Prior art mainly controls the harm of 2 committee noctuid insects by external action and external cause, as cultural control and chemical control; And the present invention controls 2 committee noctuid insects by producing the Cry1A.105 albumen that can kill 2 committee noctuids in plant corpus, namely prevented and treated by internal cause.

2, pollution-free, noresidue.Although the harm of the chemical prevention and control method that prior art uses to control 2 committee noctuid insect serves certain effect, also pollution brought to people, animal and field ecosystem simultaneously, destroy and remain; Use the present invention to control the method for 2 committee noctuid insects, above-mentioned adverse consequences can be eliminated.

3, control in the time of infertility.The method of control 2 the committee noctuid insect that prior art uses is all interim; and the present invention is protection plant being carried out to the time of infertility; genetically modified plants (Cry1A.105 albumen) from germination, growth, until bloom, result, can avoid suffering the infringement of 2 noctuids of entrusting.

4, whole plant control.The method of control 2 the committee noctuid insect that prior art uses is locality mostly, as foliage-spray; And the present invention protects whole plant, root, blade, stem stalk, tassel, female fringe, flower pesticide, filigree etc. as genetically modified plants (Cry1A.105 albumen) all can resist 2 committee's noctuid infringements.

5, effect stability.The method of the spraying pesticide that prior art uses needs directly to spray application to crop surface, easily causes situations such as spraying uneven or drain spray; The present invention makes described Cry1A.105 albumen express in plant corpus, expression is stable and consistent substantially, and the control efficiency of genetically modified plants of the present invention (Cry1A.105 albumen) in different location, different time, different genetic background is also all stable and consistent.

6, simple, convenient, economical.Due to the hidden occurrence and infection feature that 2 committee noctuids are special, cause the Supervise prevention and cure of its harm comparatively difficult, substantially increase planting cost; The present invention only need plant the genetically modified plants can expressing Cry1A.105 albumen, and does not need to adopt other measure, thus saves a large amount of human and material resources and financial resources.

7, effect is thorough.The method of control 2 the committee noctuid insect that prior art uses, its effect is halfway, only plays and alleviates effect; And genetically modified plants of the present invention (Cry1A.105 albumen) can cause the mortality of just incubating 2 committee's exigua larvaes, and great suppression is caused to fraction survival larvae development progress, it is all obvious depauperation, and stasi, be difficult to work the mischief to corn again, and genetically modified plants are only subject to slight damage substantially.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T containing Cry1A.105 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 2 is that the recombinant expression carrier DBN100032 containing Cry1A.105 nucleotide sequence of the method for Control pests of the present invention builds flow chart;

Fig. 3 is the blade injury figure that the transgenic corn plant of the method for Control pests of the present invention inoculates 2 committee noctuids.

Embodiment

The technical scheme of the method for Control pests of the present invention is further illustrated below by specific embodiment.

The acquisition of the first embodiment, Cry1A.105 gene and synthesis

1, Cry1A.105 nucleotide sequence is obtained

The amino acid sequence (1177 amino acid) of Cry1A.105 insect-killing protein, as shown in SEQ IDNO:1 in sequence table; Encode corresponding to the Cry1A.105 nucleotide sequence (3534 nucleotide) of the amino acid sequence (1177 amino acid) of described Cry1A.105 insect-killing protein, as shown in SEQ ID NO:2 in sequence table.

2, Cry2Ab and Vip3A nucleotide sequence is obtained

The Cry2Ab nucleotide sequence (1905 nucleotide) of the amino acid sequence (634 amino acid) of coding Cry2Ab insect-killing protein, as shown in SEQ ID NO:3 in sequence table; The Vip3A nucleotide sequence (2370 nucleotide) of the amino acid sequence (789 amino acid) of coding Vip3A insect-killing protein, as shown in SEQ ID NO:4 in sequence table.

3, above-mentioned nucleotide sequence is synthesized

Described Cry1A.105 nucleotide sequence (as shown in SEQ ID NO:2 in sequence table), as described in Cry2Ab nucleotide sequence (as shown in SEQ ID NO:3 in sequence table) and as described in Vip3A nucleotide sequence (as shown in SEQ ID NO:4 in sequence table) synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of the described Cry1A.105 nucleotide sequence (SEQ ID NO:2) of synthesis is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry1A.105 nucleotide sequence (SEQ ID NO:2) is also connected with HindIII restriction enzyme site; 5 ' end of the described Cry2Ab nucleotide sequence (SEQ ID NO:3) of synthesis is also connected with NcoI restriction enzyme site, and 3 ' end of described Cry2Ab nucleotide sequence (SEQ ID NO:3) is also connected with SpeI restriction enzyme site; 5 ' end of the described Vip3A nucleotide sequence (SEQ ID NO:4) of synthesis is also connected with ScaI restriction enzyme site, and 3 ' end of described Vip3A nucleotide sequence (SEQ ID NO:4) is also connected with SpeI restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transformation Agrobacterium

1, the recombinant cloning vector containing Cry1A.105 gene is built

The Cry1A.105 nucleotide sequence of synthesis is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operating procedure is undertaken by Promega Products pGEM-T carrier specification, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the origin of replication of phage f1; LacZ is LacZ initiation codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; Cry1A.105 is Cry1A.105 nucleotide sequence (SEQ ID NO:2); MCS is multiple clone site).

Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake), scribble IPTG(isopropylthio-β-D-galactoside on surface) and the chloro-3-indoles of the bromo-4-of X-gal(5--β-D-galactoside) LB flat board (the tryptone 10g/L of ampicillin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ampicillin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant, the precipitation thalline solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetra-acetic acid) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1%SDS(lauryl sodium sulfate) that 150 μ l newly prepare), pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ l (4M potassium acetate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume absolute ethyl alcohols in supernatant, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant, and precipitation concentration (V/V) is dry after the ethanol washing of 70%; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.

The plasmid extracted is after EcoRI and XhoI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described Cry1A.105 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:2 in sequence table, and namely Cry1A.105 nucleotide sequence correctly inserts.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, be connected on cloning vector pGEM-T by the described Cry2Ab nucleotide sequence of synthesis, obtain recombinant cloning vector DBN02-T, wherein, Cry2Ab is Cry2Ab nucleotide sequence (SEQ ID NO:3).Enzyme is cut and is correctly inserted with Cry2Ab nucleotide sequence described in sequence verification recombinant cloning vector DBN02-T.

According to the method for above-mentioned structure recombinant cloning vector DBN01-T, be connected on cloning vector pGEM-T by the described Vip3A nucleotide sequence of synthesis, obtain recombinant cloning vector DBN03-T, wherein, Vip3A is Vip3A nucleotide sequence (SEQ ID NO:4).Enzyme is cut and is correctly inserted with Vip3A nucleotide sequence described in sequence verification recombinant cloning vector DBN03-T.

2, the recombinant expression carrier containing Cry1A.105 gene is built

With restriction enzyme NcoI and HindIII respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), between NcoI and the HindIII site Cry1A.105 nucleotide sequence fragment cut being inserted into expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression carrier DBN100032, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQ ID NO:5); Cry1A.105:Cry1A.105 nucleotide sequence (SEQ ID NO:2); Nos: the terminator (SEQID NO:6) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:7); LB: left margin).

By recombinant expression carrier DBN100032 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l plasmid DNA (recombinant expression carrier DBN100032), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaken cultivation 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the tryptone 10g/L containing 50mg/L kanamycin (Kanamycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycin 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme NcoI of extraction and HindIII enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression carrier DBN100032 between NcoI and HindIII site is classified as nucleotide sequence, i.e. Cry1A.105 nucleotide sequence shown in SEQ ID NO:2 in sequence table.

According to the method for above-mentioned structure recombinant expression carrier DBN100032, by NcoI and HindIII, NcoI and SpeI respectively enzyme cut described Cry1A.105 nucleotide sequence that recombinant cloning vector DBN01-T and DBN02-T cut and Cry2Ab nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression carrier DBN100076.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression carrier DBN100076 containing nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:3 in promising sequence table, i.e. Cry1A.105 nucleotide sequence and Cry2Ab nucleotide sequence, described Cry1A.105 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Cry2Ab nucleotide sequence.

According to the method for above-mentioned structure recombinant expression carrier DBN100032, by NcoI and HindIII, ScaI and SpeI respectively enzyme cut described Cry1A.105 nucleotide sequence that recombinant cloning vector DBN01-T and DBN03-T cut and Vip3A nucleotide sequence inserts expression vector DBNBC-01, obtain recombinant expression carrier DBN100029.Enzyme is cut with the nucleotide sequence in sequence verification recombinant expression carrier DBN100029 containing nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:4 in promising sequence table, i.e. Cry1A.105 nucleotide sequence and Vip3A nucleotide sequence, described Cry1A.105 nucleotide sequence can be connected described Ubi promotor and Nos terminator with described Vip3A nucleotide sequence.

3, recombinant expression carrier transformation Agrobacterium

Through building correct recombinant expression carrier DBN100032, DBN100076 and DBN100029 liquid nitrogen method, Agrobacterium LBA4404 (Invitrgen is transformed into oneself, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression carrier), be placed in liquid nitrogen 10 minutes, 37 DEG C of tepidarium 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in temperature 28 DEG C, rotating speed is cultivate 2 hours under 200rpm condition, be applied on the LB flat board containing the rifampin (Rifampicin) of 50mg/L and the kanamycin (Kanamycin) of 100mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, with restriction enzyme A hdI and XhoI to recombinant expression carrier DBN100032, DBN100076 and DBN100029 enzyme carries out digestion verification after cutting, result shows recombinant expression carrier DBN100032, DBN100076 and DBN100029 structure is entirely true.

3rd embodiment, the acquisition proceeding to the milpa of Cry1A.105 gene and checking

1, the milpa proceeding to Cry1A.105 gene is obtained

The Agrobacterium infestation method conveniently adopted, the corn variety of aseptic culture is combined 31(Z31) rataria and the second embodiment in Agrobacterium Dual culture described in 3, with the recombinant expression carrier DBN100032 by 2 structures in the second embodiment, T-DNA(in DBN100076 and DBN100029 comprises the promoter sequence of corn Ubiquitin gene, Cry1A.105 nucleotide sequence, Cry2Ab nucleotide sequence, Vip3A nucleotide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain the milpa proceeding to Cry1A.105 nucleotide sequence, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to the milpa of Cry1A.105-Vip3A nucleotide sequence, in contrast with wild-type corn plant simultaneously.

For agriculture bacillus mediated corn transformation, briefly, immature rataria is separated from corn, rataria is contacted with agrobacterium suspension, wherein Cry1A.105 nucleotide sequence, Cry2Ab nucleotide sequence and/or Vip3A nucleotide sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium, in this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, acetosyringone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth antibiotic (cephalosporin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having antibiotic but is not having the solid culture medium of selective agent is cultivated, to eliminate Agrobacterium and to provide convalescence for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the medium containing selective agent (mannose).Preferably, rataria is having the screening solid culture medium of selective agent (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 5g/L, mannose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid culture medium (MS differential medium and MS root media) containing the callus that the medium of selective agent grows.

Screen the resistant calli obtained and transfer to described MS differential medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, mannose 5g/L, agar 8g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.

2, the milpa of Cry1A.105 gene is proceeded to TaqMan checking

The blade getting the milpa proceeding to Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence is respectively about 100mg as sample, extract its genomic DNA with the DNeasy Plant Maxi Kit of Qiagen, detected the copy number of Cry1A.105 gene, Cry2Ab gene and Vip3A gene by Taqman fluorescence probe quantitative PCR method.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.

The concrete grammar detecting Cry1A.105 gene copy number is as follows:

Step 11, get each 100mg of blade of the milpa proceeding to Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence, the milpa proceeding to Cry1A.105-Vip3A nucleotide sequence and wild-type corn plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic DNA concentration of above-mentioned sample;

Step 14, adjust the genomic DNA concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard items, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting Cry1A.105 nucleotide sequence:

Primer 1(CF1): GCGCATCCAGTTCAACGAC is as shown in SEQ ID NO:8 in sequence table;

Primer 2 (CR1): GTTCTGGACGGCGAAGAGTG is as shown in SEQ ID NO:9 in sequence table;

Probe 1(CP1): TGAACAGCGCCCTGACCACCG is as shown in SEQ ID NO:10 in sequence table;

Following primer and probe are used for detecting Cry2Ab nucleotide sequence:

Primer 3(CF2): CTGATACCCTTGCTCGCGTC is as shown in SEQ ID NO:11 in sequence table;

Primer 4(CR2): CACTTGGCGGTTGAACTCCTC is as shown in SEQ ID NO:12 in sequence table;

Probe 2(CP2): CGCTGAGCTGACGGGTCTGCAAG is as shown in SEQ IDNO:13 in sequence table;

Following primer and probe are used for detecting Vip3A nucleotide sequence:

Primer 5(VF1): ATTCTCGAAATCTCCCCTAGCG is as shown in SEQ ID NO:14 in sequence table;

Primer 6(VR1): GCTGCCAGTGGATGTCCAG is as shown in SEQ ID NO:15 in sequence table;

Probe 3(VP1): CTCCTGAGCCCCGAGCTGATTAACACC is as shown in SEQ ID NO:16;

PCR reaction system is:

Described 50 × primer/probe mixture comprises each 45 μ l of often kind of primer of 1mM concentration, the probe 50 μ l of 100 μMs of concentration and 860 μ l1 × TE buffer solutions, and at 4 DEG C, is housed in amber tube.

PCR reaction condition is:

SDS2.3 software (Applied Biosystems) is utilized to analyze data.

Experimental result shows, all oneself is incorporated in the chromosome set of detected milpa for Cry1A.105 nucleotide sequence, Cry1A.105-Cry2Ab nucleotide sequence and Cry1A.105-Vip3A nucleotide sequence, and proceeds to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and the milpa that proceeds to Cry1A.105-Vip3A nucleotide sequence and all obtain transgenic corn plant containing single copy Cry1A.105 gene.

The insect resistant effect of the 4th embodiment, transgenic corn plant detects

By proceeding to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence, the milpa proceeding to Cry1A.105-Vip3A nucleotide sequence, wild-type corn plant and being accredited as not genetically modified milpa through Taqman, insect resistant effect detection is carried out to 2 committee noctuids.

Get the milpa proceeding to Cry1A.105 nucleotide sequence respectively, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequence, proceed to the milpa of Cry1A.105-Vip3A nucleotide sequence, wild-type corn plant and be accredited as the fresh blade of not genetically modified milpa (V3-V4 phase) through Taqman, clean and with gauze, the water on blade is blotted with aseptic water washing, then maize leaf is removed vein, be cut into the strip of about 1cm × 4cm simultaneously, get 2 cut after strip blade put on the filter paper bottom round plastic culture dish, described filter paper distilled water soaks, 2 committees noctuid (newly hatched larvae) of 10 artificial feedings are put in each culture dish, after worm examination culture dish is added a cover, at temperature 25-28 DEG C, relative moisture 70%-80%, place after 3 days under the condition of photoperiod (light/dark) 16:8, according to 2 committee's exigua larvae development progresses, lethality and blade injury rate three indexs, obtain resistance total score: total score=100 × lethality+[100 × lethality+90 × (just incubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1-blade injury rate).Proceed to totally 3 strains (S1, S2 and S3) of Cry1A.105 nucleotide sequence, proceed to totally 3 strains (S4, S5 and S6) of Cry1A.105-Cry2Ab nucleotide sequence, proceed to totally 3 strains (S7, S8 and S9) of Cry1A.105-Vip3A nucleotide sequence, not genetically modified (NGM) totally 1 strain is accredited as, (CK) totally 1 strain of wild type through Taqman; Select 3 strains to test from each strain, every strain repeats 6 times.Result is as shown in table 1 and Fig. 3.

Table 1, transgenic corn plant inoculate the pest-resistant experimental result of 2 committee noctuids

The result of table 1 shows: milpa raw proceeding to the milpa of Cry1A.105 nucleotide sequence, proceed to the milpa of Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence surveys total score all at about 280 points or more; And be accredited as the raw total score of surveying of not genetically modified milpa and wild-type corn plant generally at about 130 points through Taqman.

The result of Fig. 3 shows: compared with wild-type corn plant, proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and the milpa proceeding to Cry1A.105-Vip3A nucleotide sequence can cause the mortality of 2 noctuid newly hatched larvaes of entrusting, and great suppression is caused to fraction survival larvae development progress, after 3 days, larva is substantially still in and just incubates state, and proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and the milpa proceeding to Cry1A.105-Vip3A nucleotide sequence are only subject to pole slight damage substantially, blade is only the damage of minute quantity Pinhole-shaped, its blade injury rate is all below 2%.

Prove that the milpa proceeding to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and proceed to Cry1A.105-Vip3A nucleotide sequence all demonstrates the activity of high resistance 2 committee noctuid thus, this activity is enough to the growth of 2 committee noctuids is produced to ill effect thus makes it be controlled.

Above-mentioned experimental result also shows to proceed to the milpa of Cry1A.105 nucleotide sequence, the milpa proceeding to Cry1A.105-Cry2Ab nucleotide sequence and the control of milpa to 2 committee noctuids that proceed to Cry1A.105-Vip3A nucleotide sequence is obviously because plant itself can produce Cry1A.105 albumen, so, well known to those skilled in the art, according to the identical toxic action of Cry1A.105 albumen to 2 committee noctuids, the transfer-gen plant that can produce similar expressed Cry1A.105 albumen can be used in the harm of control 2 committee noctuid.In the present invention, Cry1A.105 albumen includes but not limited to the Cry1A.105 albumen of given amino acid sequence in embodiment, transfer-gen plant can also produce the second insect-killing protein that at least one is different from Cry1A.105 albumen, as Vip plastein, Cry plastein simultaneously.

In sum, the method for Control pests of the present invention controls 2 committee noctuid insects by producing the Cry1A.105 albumen that can kill 2 committee noctuids in plant corpus; The cultural control method used with prior art is compared with chemical prevention and control method; the present invention to plant carry out the time of infertility, whole plant protection to prevent and treat the infringement of 2 committee noctuid insects; and pollution-free, noresidue, effect stability, thoroughly, simple, convenient, economical.

It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims (17)

1. one kind controls the method for 2 committee noctuid insects, it is characterized in that, Cry1A.105 albumen and Cry2Ab albumen are present in the plant cell producing described Cry1A.105 albumen and described Cry2Ab albumen, described 2 committee noctuid insects are by described plant cell and described Cry1A.105 albumen and the described Cry2Ab protein contact of ingesting, and the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:1.

2. the method for control according to claim 12 committee noctuid insect, it is characterized in that, described Cry1A.105 albumen and described Cry2Ab albumen are present in the genetically modified plants producing described Cry1A.105 albumen and described Cry2Ab albumen, described 2 committee noctuid insects are by the tissue of the described genetically modified plants that ingest and described Cry1A.105 albumen and described Cry2Ab protein contact, after contact, the noctuid insect growth of described 2 committees is suppressed and/or causes death, to realize the control to 2 committee noctuid harm plants.

3. the method for control according to claim 22 committee noctuid insect, it is characterized in that, described genetically modified plants can be in any breeding time.

4. the method for control according to claim 22 committee noctuid insect, is characterized in that, described genetically modified plants be organized as root, blade, stem stalk, tassel, female fringe, flower pesticide or filigree.

5. the method for control according to claim 22 committee noctuid insect, is characterized in that, the described control to 2 committee noctuid harm plants does not change because planting the change in place.

6. the method for control according to claim 22 committee noctuid insect, is characterized in that, the described control to 2 committee noctuid harm plants does not change because of the change of implantation time.

7. the method for the control according to any one of claim 1 to 62 committee noctuid insect, it is characterized in that, described plant is corn.

8. the method for control according to claim 72 committee noctuid insect, is characterized in that, the step before described contact procedure is the plant of the polynucleotides of plantation containing encode described Cry1A.105 albumen and described Cry2Ab albumen.

9. the method for control according to claim 82 committee noctuid insect, it is characterized in that, the nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

10. the method for control according to claim 92 committee noctuid insect, it is characterized in that, the nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:3.

The method of 11. control according to claim 82 committee noctuid insects, it is characterized in that, the nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:3.

The method of 12. control according to claim 72 committee noctuid insects, it is characterized in that, the nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:3.

The method of 13. control according to claim 72 committee noctuid insects, it is characterized in that, the nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

The method of 14. control 2 committee noctuid insects according to any one of claim 1 to 6, it is characterized in that, the nucleotide sequence of described Cry2Ab albumen has the nucleotide sequence shown in SEQ ID NO:3.

The method of 15. control 2 committee noctuid insects according to any one of claim 1 to 6, it is characterized in that, the nucleotide sequence of described Cry1A.105 albumen has the nucleotide sequence shown in SEQ ID NO:2.

The method of 16. control 2 committee noctuid insects according to any one of claim 1 to 6, is characterized in that, the plant of the polynucleotides that the step before described contact procedure is plantation containing the described Cry1A.105 albumen of coding and described Cry2Ab albumen.

17. 1 kinds of Cry1A.105 protein and Cry2Ab protein control the purposes of 2 committee noctuid insects, it is characterized in that, described Cry1A.105 protein and described Cry2Ab protein are present in the plant cell and/or genetically modified plants producing described Cry1A.105 protein and described Cry2Ab protein, and the amino acid sequence of described Cry1A.105 albumen has the amino acid sequence shown in SEQ ID NO:1.