WO2015070783A1 - Method for controlling pest - Google Patents

Abstract

A method for controlling sesamia inferens pests, the sesamia inferens pests contacting the Cry1A protein; the method controls the sesamia inferens pest via the Cry1A protein generated in a plant and capable of killing the sesamia inferens; compared with agricultural control methods, chemical control methods and biological control methods used in the prior art, the method of the present invention protects the whole plant during the entire growth period to prevent the sesamia inferens pest attack, has no pollution and no residue and has a stable and thorough effect, and is simple, convenient and economical.

Description

Method of controlling pests

The present application claims priority to Chinese Patent Application No. 201310578129.6, filed on Nov. 18, 2013, which is incorporated herein by reference.

Technical field

The present application relates to a method of controlling pests, and more particularly to a method for controlling a plant that is ruined by a Cry1A protein expressed in a plant.

Background technique

Sesamia inferens belongs to the family Lepidoptera, and is an omnivorous pest. In addition to harming corn, it also harms grass crops such as rice, sugar cane, wheat and sorghum. It is widely distributed in central and southeastern China and rice in Southeast Asia. Sugar cane production area. The larvae of the cockroaches are invaded into the stems of the crops, which can cause the death of the corn seedlings or the whole plant, and the dryness or white spikes of the rice. Especially in recent years, global warming has occurred, and the occurrence of big cockroaches has been increasing year by year and moving northward.

Maize and rice are important food crops in China. The annual food loss caused by the big cockroaches is huge, and even more affects the living conditions of the local population. In order to control amnesty, the main prevention methods commonly used are: agricultural control, chemical control and biological control.

Agricultural control is the comprehensive coordinated management of the multi-factors of the entire farmland ecosystem, regulating crops, pests, environmental factors, and creating a farmland ecological environment that is conducive to crop growth and is not conducive to the occurrence of large locusts. For example, the use of large-scale wintering hosts, reforming farming systems, planting large-scale varieties, planting traps and intercropping measures to reduce the damage of large cockroaches. Because agricultural control must obey the requirements of crop layout and increase production, the application has certain limitations and cannot be used as an emergency measure. It seems to be powerless when the amnesty breaks out.

Chemical control, that is, pesticide control, is the use of chemical pesticides to kill pests. It is an important part of the comprehensive management of Datun. It is characterized by rapid, convenient, simple and high economic benefits, especially in the case of large floods. , is an indispensable emergency measure, it can be destroyed before the cause of the disease. At present, the chemical control methods mainly include granules, toxic soil, liquid spray, and wintering adults in the fumigation straw. However, chemical control also has its limitations. If improper use, it will lead to phytotoxicity of crops, resistance to pests, killing natural enemies, polluting the environment, destroying farmland ecosystems and threatening the safety of humans and animals. Adverse consequences.

Biological control is the use of certain beneficial organisms or biological metabolites to control the population of pests to reduce or eliminate pests. It is characterized by safety of people and animals, less pollution to the environment, and long-term control of certain pests. However, the effect is often unstable, and the same investment is required regardless of the weight of the big cockroach.

In order to solve the limitations of agricultural control, chemical control and biological control in practical applications, scientists have discovered that insect-resistant genes encoding insecticidal proteins can be transferred into plants, and some insect-resistant transgenic plants can be obtained to control plant pests. Cry1A insecticidal protein is one of many insecticidal proteins and is an insoluble parasporal crystal protein produced by Bacillus thuringiensis subsp. kurstaki (B.t.k.).

The Cry1A protein is ingested by insects into the midgut, and the protoxin is dissolved in the alkaline pH environment of the insect midgut. The N- and C-termini of the protein are digested with alkaline protease to convert the protoxin into an active fragment; the active fragment binds to the receptor on the upper surface of the epithelial cell membrane of the insect and is inserted into the intestinal membrane, causing perforation of the cell membrane and destroying the inside and outside of the cell membrane. Changes in osmotic pressure and pH balance disrupt the insect's digestive process and ultimately lead to death.

Plants transgenic with the Cry1A gene have been shown to be resistant to Lepidoptera pests such as corn borer, cotton bollworm, and fall armyworm. However, there are few reports on the control of plant damage by the transgenic plants expressing the Cry1A protein. .

Summary of the invention

The purpose of the present application is to provide a method for controlling pests, for the first time, to provide a method for controlling the damage of plants by using transgenic plants expressing Cry1A protein, and effectively overcoming the prior art techniques of agricultural control, chemical control and biological control. defect.

A first aspect of the present application relates to a method of controlling a cockroach pest, wherein the cockroach pest is contacted with a Cry1A protein.

In some embodiments, the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein, or a Cry1A.105 protein.

In a further embodiment, the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein is present in a plant cell producing the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein, respectively, by ingesting the plant The cells are contacted with the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein.

In a further embodiment, the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein is present in a transgenic plant producing the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein, respectively, by ingesting the transgene The tissue of the plant is contacted with the Cry1Ab protein, the Cry1Ac protein or the Cry1A.105 protein, and the growth of the giant cockroach pest is inhibited and/or contacted after contact, resulting in the death of the cockroach pest, thereby realizing the control of the plant of the cockroach .

The transgenic plant can be in any growth period.

The tissue of the transgenic plant is selected from the group consisting of leaves, stems, fruits, tassels, ears, anthers, and filaments.

The control of the plants of the giant salamander does not change due to changes in the location and/or planting time.

The plant is selected from the group consisting of corn, rice, sorghum, wheat, millet, cotton, reed, sugar cane, alfalfa, broad bean or canola. Preferably, the plant is selected from the group consisting of corn or rice.

The step prior to the contacting step is the planting of a plant containing a polynucleotide encoding the Cry1A protein.

In some embodiments, the amino acid sequence of the Cry1A protein has: 1) the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, 2) and SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 has an amino acid sequence of at least 70% homology and insecticidal activity against Euphorbia, such as at least 70%, 75%, 80%, 85%, 90%, 91%, 92 %, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or 3) SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3 An amino acid sequence obtained by substituting, deleting or adding one or more amino acid residues and having insecticidal activity against Euphorbia, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 50 amino acid residues.

In some embodiments, the nucleotide sequence encoding the Cry1A protein has: 1) the nucleotide sequence set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6, 2) and SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 has a nucleotide sequence of at least about 75% homology and encodes an amino acid sequence having insecticidal activity against Euphorbia, such as at least 75%, 80%, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, 3) under stringent conditions with SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 nucleotide sequence which hybridizes and encodes an amino acid sequence having insecticidal activity against Euphorbia, 4) differs from SEQ ID NO: 4, SEQ ID NO: 5 due to codon degeneracy Or the nucleotide sequence of the amino acid sequence of SEQ ID NO: 6 encoding insecticidal activity against Euphorbia.

In some embodiments, the plant further comprises at least one second nucleotide different from the nucleotide encoding the Cry1A protein.

In a further embodiment, the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In a further embodiment, the second nucleotide encodes a Vip3A protein or a Cry2Ab protein.

In a still further embodiment, the second nucleotide has the nucleotide sequence set forth in SEQ ID NO:7 or SEQ ID NO:8.

In other embodiments, the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.

A second aspect of the present application relates to the use of a Cry1A protein for controlling cockroach pests.

In some embodiments, the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein, or a Cry1A.105 protein.

In a further embodiment, the amino acid sequence of the Cry1A protein has: 1) the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, 2) and SEQ ID NO: SEQ ID NO: 2 or SEQ ID NO: 3 has an amino acid sequence of at least 70% homology and has insecticidal activity against Euphorbia, such as at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%. , 95%, 96%, 97%, 98%, 99% or higher, or 3) the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 has been substituted, deleted and/or Or an amino acid sequence obtained by adding one or more amino acid residues and having insecticidal activity against Euphorbia, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 , 50 amino acid residues.

In a further embodiment, the nucleotide sequence encoding the Cry1A protein has: 1) the nucleotide sequence set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6, 2) and SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 has a nucleotide sequence of at least about 75% homology and encodes an amino acid sequence having insecticidal activity against Euphorbia, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, 3) under stringent conditions with SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 nucleotide sequence which hybridizes and encodes an amino acid sequence having insecticidal activity against Euphorbia, 4) is different from SEQ ID NO: 4, SEQ ID NO due to codon degeneracy: 5 or a nucleotide sequence of SEQ ID NO: 6 encoding an amino acid sequence having insecticidal activity against Euphorbia.

In some embodiments, the Cry1A protein controls the cockroach pest by dissolving the Cry1A protein in a plant cell and contacting the plant cell with the Cry1A protein by feeding the cockroach pest.

In some embodiments, the Cry1A protein controls the cockroach pest by achieving expression of the Cry1A protein in the transgenic plant and contacting the tissue of the transgenic plant with the Cry1A protein by the cockroach pest.

The transgenic plant can be in any growth period.

The tissue of the transgenic plant is selected from the group consisting of leaves, stems, fruits, tassels, ears, anthers, and filaments.

The Cry1A protein controls the cockroach pests not to change due to changes in planting location and/or planting time.

The plant is selected from the group consisting of corn, rice, sorghum, wheat, millet, cotton, reed, sugar cane, alfalfa, broad bean or canola. Preferably, the plant is selected from the group consisting of corn or rice.

In some embodiments, the plant further comprises at least one second nucleotide different from the nucleotide encoding the Cry1A protein.

In a further embodiment, the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In a further embodiment, the second nucleotide encodes a Vip3A protein or a Cry2Ab protein.

In a still further embodiment, the second nucleotide has the nucleotide sequence set forth in SEQ ID NO:7 or SEQ ID NO:8.

In some embodiments, the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.

A third aspect of the present application relates to a method for preparing a plant cell, a transgenic plant or a transgenic plant for controlling a pest of the cockroach a partial method comprising introducing a coding nucleotide sequence of a Cry1A protein into a part of the plant cell, the transgenic plant or the transgenic plant, preferably introducing a coding nucleotide sequence of the Cry1A protein into the plant cell, transgenic The genome of a part of a plant or transgenic plant.

In some embodiments, the portion of the transgenic plant is a propagation material or a non-propagating material.

The propagation material refers to the fruit, seed or callus of the plant.

The non-propagating material refers to a leaf, a stem, a tassel, an ear, an anther or a filament of a plant that does not have the ability to reproduce.

In some embodiments, the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein, or a Cry1A.105 protein.

In a further embodiment, the amino acid sequence of the Cry1A protein has: 1) the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, 2) and SEQ ID NO: SEQ ID NO: 2 or SEQ ID NO: 3 has an amino acid sequence at least 70% homologous and having insecticidal activity against Euphorbia, such as at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, or 3) SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 An amino acid sequence obtained by substituting, deleting and/or adding one or more amino acid residues and having insecticidal activity against Euphorbia, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 , 10, 15, 20, 30, 50 amino acid residues.

In a further embodiment, the nucleotide sequence encoding the Cry1A protein has: 1) the nucleotide sequence set forth in SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6, 2) and SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 has a nucleotide sequence of at least about 75% homology and encodes an amino acid sequence having insecticidal activity against Euphorbia, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher, 3) under stringent conditions with SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 nucleotide sequence which hybridizes and encodes an amino acid sequence having insecticidal activity against Euphorbia.

The plant is selected from the group consisting of corn, rice, sorghum, wheat, millet, cotton, reed, sugar cane, alfalfa, broad bean or canola. Preferably, the plant is selected from the group consisting of corn or rice.

In some embodiments, the method further comprises introducing at least one second nucleotide different from the nucleotide encoding the Cry1A protein into the plant cell, the transgenic plant, or a portion of the transgenic plant, preferably At least one second nucleotide different from the nucleotide encoding the Cry1A protein is introduced into the genome of the part of the plant cell, transgenic plant or transgenic plant.

In some embodiments, the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an alpha-amylase, or a peroxidase.

In a further embodiment, the second nucleotide encodes a Vip3A protein or a Cry2Ab protein.

In a still further embodiment, the second nucleotide has the sequence set forth in SEQ ID NO:7 or SEQ ID NO:8 Nucleotide sequence.

In other embodiments, the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.

In some embodiments, the coding nucleotide is introduced into the plant cell, the transgenic plant by Agrobacterium-mediated transformation, microprojection bombardment, direct DNA uptake into protoplasts, electroporation or whisker silicon mediated DNA introduction. Or a portion of the transgenic plant, preferably Agrobacterium-mediated transformation.

A fourth aspect of the present application relates to a part of a plant cell, a transgenic plant or a transgenic plant for controlling a pest of the cockroach obtained by the method of the above third aspect.

A fifth aspect of the present application relates to the use of a Cry1A protein for the preparation of a plant cell, a transgenic plant or a part of a transgenic plant that controls a pest of the cockroach. The definitions of "Cry1A protein", "control big cockroach pest", "plant", "plant cell", "transgenic plant", "part of transgenic plant" and extensions thereof in this aspect are as defined above.

A sixth aspect of the present application relates to a method of cultivating a plant for controlling a pest of the cockroach, comprising:

Planting at least one plant seed, the genome of the plant seed comprising a polynucleotide sequence encoding a Cry1A protein;

Planting the plant seed into a plant;

The plants are grown under conditions in which the artificial inoculation of the giant salamander pests and/or the giant salamander pests are naturally harmful, and the plants are harvested with reduced plant damage and/or have a yield compared to other plants not having the polynucleotide sequence encoding the Cry1A protein. Increased plant yield of plants.

The definitions of "Cry1A protein", "plant" and their extensions referred to in this aspect are as defined above. The meaning of "controlling the big cockroach pest" is similar to the meaning of "anti-big cockroach pest", and is specifically limited as described above.

In the present application, expression of a Cry1A protein in a transgenic plant can be accompanied by expression of one or more Cry-like insecticidal proteins and/or Vip-like insecticidal proteins. Co-expression of such more than one insecticidal toxin in the same transgenic plant can be achieved by genetic engineering to allow the plant to contain and express the desired gene. In addition, one plant (first parent) can express Cry1A protein by genetic engineering operation, and the second plant (second parent) can express Cry-like insecticidal protein and/or Vip-like insecticidal protein by genetic engineering operation. Progeny plants expressing all of the genes introduced into the first parent and the second parent are obtained by hybridization of the first parent and the second parent.

RNA interference (RNAi) refers to the phenomenon of highly-specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA), which is highly conserved during evolution. Therefore, RNAi technology can be used in this application to specifically knock out or shut down the expression of a particular gene in a target insect pest.

In some aspects, the application also relates to the following:

Section 1. A method of controlling a pest of the cockroach, characterized by comprising contacting a cockroach pest with a Cry1A protein.

The method for controlling a large cockroach pest according to paragraph 1, characterized in that the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein or a Cry1A.105 protein.

Item 3. The method for controlling a pest of the cockroach according to paragraph 2, wherein the Cry1Ab protein is present in a plant cell producing the Cry1Ab protein, the cockroach pest by feeding the plant cell and the Cry1Ab protein is contacted.

Item 4. The method for controlling a pest of the cockroach according to paragraph 3, wherein the Cry1Ab protein is present in a transgenic plant producing the Cry1Ab protein, and the cockroach pest is fed by the tissue of the transgenic plant. The Cry1Ab protein is contacted, and the growth of the cockroach pest is inhibited after the contact and eventually leads to death, so as to achieve control of the cockroach-damaging plant.

Item 5. The method for controlling a pest of the cockroach according to paragraph 2, wherein the Cry1A.105 protein is present in a plant cell producing the Cry1A.105 protein, the cockroach pest ingesting the plant The cells are contacted with the Cry1A.105 protein.

Item 6. The method of controlling a pest of the cockroach according to paragraph 5, wherein the Cry1A.105 protein is present in a transgenic plant producing the Cry1A.105 protein, the cockroach pest ingesting the transgene The tissue of the plant is contacted with the Cry1A.105 protein, and the growth of the giant cockroach pest is inhibited after the contact and eventually leads to death, so as to achieve control of the plant against the cockroach.

Item 7. The method of controlling a pest of the cockroach according to paragraph 4 or 6, wherein the transgenic plant can be in any growth period.

Item 8. The method for controlling a pest of the cockroach according to paragraph 4 or 6, wherein the tissue of the transgenic plant can be a leaf, a stem, a fruit, a tassel, an ear, an anther or a filament.

Item 9. The method of controlling a large pest according to paragraph 4 or 6, wherein the control of the plant of the giant salamander does not change due to a change in the planting location.

Item 10. The method of controlling a pest of the cockroach according to paragraph 4 or 6, wherein the control of the plant of the cockroach is not changed by the change of the planting time.

The method of controlling a pest of the cockroach according to any one of paragraphs 3 to 10, wherein the plant is derived from corn, rice, sorghum, wheat, millet, cotton, reed, sugar cane, white peony, broad bean or rape.

The method of controlling a large cockroach pest according to any one of paragraphs 1 to 11, wherein the step prior to the contacting step is planting a plant containing a polynucleotide encoding the Cry1A protein.

The method of controlling a pest of the cockroach according to any one of paragraphs 1 to 12, wherein the amino acid sequence of the Cry1A protein has SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. The amino acid sequence shown.

Item 14. The method for controlling a pest of the cockroach according to paragraph 13, characterized in that the nucleoside of the Cry1A protein The acid sequence has the nucleotide sequence shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.

The method of controlling a cockroach pest according to any one of paragraphs 3 to 14, wherein the plant further produces at least one second nucleotide different from the Cry1A protein.

The method of controlling a pest of the cockroach according to paragraph 15, wherein the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, and α. - amylase or peroxidase.

Item 17. The method of controlling a pest of the cockroach according to paragraph 16, wherein the second nucleotide encodes a Vip3A protein or a Cry2Ab protein.

The method of controlling a pest of the cockroach according to paragraph 17, wherein the second nucleotide comprises the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8.

Item 19. The method of controlling a large pest according to paragraph 15, wherein the second nucleotide is a dsRNA which inhibits an important gene in a target insect pest.

Paragraph 20, The use of a Cry1A protein to control a large pest.

DRAWINGS

1 is a flow chart showing the construction of a recombinant cloning vector DBN01-T containing a Cry1Ab-01 nucleotide sequence of the method for controlling pests of the present application;

2 is a flow chart showing the construction of a recombinant expression vector DBN100124 containing the Cry1Ab-01 nucleotide sequence of the method for controlling pests of the present application;

Figure 3 is a diagram showing the damage of leaves of the transgenic maize plants inoculated with the cockroach in the method for controlling pests of the present application;

Fig. 4 is a diagram showing the damage of leaves of the transgenic rice plants inoculated with the cockroach in the method for controlling pests of the present application.

detailed description

Sesamia inferens and Chilo suppressalis belong to the order Lepidoptera, which are omnivorous pests, but they are obviously fascinated by grasses, most commonly rice, corn, sorghum and so on. Despite this, there are at least two major differences between the two species, which are biologically distinct and distinct from the cockroach and the cockroach.

1. The genus Euphorbiaceae belongs to the family Mothidae.

2. The distribution area is different. Datun is widely distributed in the central and southeastern parts of China, especially in most of the southern and southern corn producing areas of Shaanxi and Henan. In addition to China, Datun has also distributed rice, corn and sugar cane in Southeast Asia, including Vietnam. Laos, India, etc. The stem borer is widely distributed in China. It is distributed in Keshan County of Heilongjiang Province in the north and Hainan Island in the south, but its main distribution areas are Hunan, Hubei, Sichuan, Jiangxi, Zhejiang, Fujian, Jiangsu and Jiangsu. Anhui Province, North Shaanxi, Shaanxi, Henan, Liaoning, Guizhou and Yunnan Plateau; foreign countries are distributed in North Korea, Japan, the Philippines, Vietnam, Thailand, Malaya, Indonesia, India, Egypt and so on.

3. Different habits. The larvae of the cockroach licking into the stem of the crop can cause damage to the dead seedlings or the whole plant. The pupils are generally larger, and a large amount of worms are discharged from the stems, and are often sandwiched between the sheaths and stems. The leaf sheaths are all yellow; the newly hatched larvae do not disperse, the inner side of the cluster sheaths, the foraging leaf sheaths and the young stems; after the 3rd instar larvae, the scattered neighbors are scattered and can be transferred to 5-6 strains. It is a serious damage period of Datun. In the early spring, the temperature above 10 °C comes early, then the big scorpion occurs early; the low-lying land near the village and the wheat-covered corn field are heavy; the spring corn is lighter and the summer corn is heavier. The stem borer is the enemy of rice, and the newly hatched larvae are damaged in the sheath of the larvae, causing the sheath. After the 3rd instar, the larvae are invaded into the rice plant, the rice seedlings cause the dead seedlings, the booting stage causes the dead ears, and the heading period causes white. Spikes, which cause insect damage at maturity, reduce production by 3%-5% in general years and more than 30% in severe cases.

4. Different morphological characteristics.

1) The egg shape is different: the egg of the big cockroach is round and round, and it turns grayish yellow after the initial white. The surface has fine vertical lines and horizontal lines. It is concentrated or scattered, and is often arranged in 2-3 rows. Oval, arranged in a rectangular fish scale-like egg block, covered with a transparent gelatin.

2) Different larvae morphology: the larvae of the late larvae are about 30mm in length, 4 heads are reddish brown to dark brown, and the back of the abdomen is pale purple, a total of 5-7 years old; while the stem borer is generally 6 years old, and the body length is old. 20-30 mm, the head is light brown, grayish white, with five purple-brown vertical lines on the back, the outermost longitudinal line passes through the valve, and the abdominal toe hook is double-sequenced or missing, and is gradually thinner from the inside to the outside.

3) The shape of the cockroach is different: the cockroach has a length of 13-18mm, is thick and sturdy, reddish brown, has a grayish white powder on the abdomen, and has three hooked spines on the hip spine; while the sputum is about 10-13 mm long, light brown. There are five brown vertical lines on the back of the previous period. The middle three are more obvious, and the later stage is gradually blurred, and the foot reaches the end of the wing bud.

4) Adult worms are different in shape: the adult female moth is 15mm in length and has a wingspan of about 30mm. The head and chest are light yellow-brown, and the abdomen is light yellow to grayish white. The antennae are silky, the front wings are nearly rectangular, light gray-brown, with small black spots in the middle. The four males are arranged in a quadrangular shape; the male moth is about 12 mm long, with a wingspan of 27 mm and an antennae-like shape; while the adult mites are 10-15 mm long and have a wingspan of 20-31 mm. The female moth has a rectangular shape and a grayish yellow toe. Light brown, with seven small black spots on the outer edge, the male moth is slightly smaller, the wings are darker, and there are three purple and black spots in the center, which are arranged obliquely and the hind wings are white.

5. Growth habits and occurrence patterns are different. The 2-4 generations of cockroaches occur in a year, decreasing with increasing altitude and increasing with increasing temperature. For example, the Yunnan-Guizhou Plateau is 2-3 years old, Jiangsu and Zhejiang are 3-4 generations old, Jiangxi, Hunan, Hubei, and Sichuan are 4 generations old, Fujian, Guangxi, and Yunnan are 4-5 generations, and southern Guangdong and Taiwan are 6-8 years old. generation. In the temperate zone, the old larvae overwinter in the soil in the parasitic remnants (such as stalks or roots of rice, rice, etc.) or in the soil near the ground. In the middle of March of the next year (temperature is higher than 10 °C), phlegm is started, 15 °C When it is feathered, it will be laid in the first half of April, reaching the peak period in 3-5 days, and the peak of hatching in late April. Adults are latent in the daytime, often inhabiting plants, starting activities in the evening, weaker phototaxis, life Life is about 5 days. The female moths begin to lay eggs 2-3 days after mating, and reach the peak period of 3-5 days. They like to lay eggs on the corn seedlings and on the ground. Most of them are concentrated on the ground where the corn stalks are thin and the leaves and sheaths are not tight. The inner side of the 2 and 3rd leaf sheaths can account for more than 80% of the egg production. Each female can lay 240 eggs, the egg duration is 12 days, the 2nd and 3rd generations are 5-6 days; the larval stage is about 30 days, the second generation is about 28 days, the third generation is about 32 days; the third generation is about 32 days; . The female moth is weak in flying, and the spawning is concentrated. Near the insect source, the density of the insect population is large and harmful. The larvae of the mites are wintering, mainly in the rice; in the winter, they are easy to die if they are soaked in water. The algebra that occurs every year in the mites varies according to the latitude, and the first generation is between 36°-32° north latitude. The 2-4th generation area is between 32°-26° north latitude, the fourth generation area is between 26°-20° north latitude, the fifth generation area is within 20° north latitude, and the first generation occurs in Heilongjiang Province, Jiangsu, Zhejiang, Fujian, Anhui, Sichuan, Guizhou occur 2-4 generations a year, and Hainan Island, the southernmost part of China, occurs five times a year; in addition to latitude, altitude also affects algebra; the adult mites are lurking in the lower part of the rice plant during the day and flying at night; Most of them mate before midnight. After mating, the female moths begin to lay eggs at intervals of one day. The eggs are most prolific at 8-9 pm. The first generation of eggs is about 3-6 cm from the tip of the leaf. However, it can also lay eggs on the back of rice leaves. The second generation eggs are mostly produced in the vicinity of the leaf sheath about 3 cm from the ground. The third generation eggs are mostly produced on the outer side of the late rice sheath; one female moth can lay 2-3 eggs, many Up to 10 pieces, generally an average of 5-6 pieces, a total of 200-700 pieces; the occurrence of sorghum in the hilly mountainous areas, generally mixed rice area, single-season rice area and It is more serious in the rice-growing area, and it is relatively light in the double-season continuous cropping area in the plains; the larvae of the mites are highly viable, have wide feeding habits, and are resistant to harsh environments such as drought, humidity and low temperature, so the winter mortality rate is low; the natural enemies are paralyzed. The number of growth and decline has a certain inhibitory effect, especially the egg parasitoid is more important, should pay attention to protection and utilization.

Based on the above, it can be determined that the big cockroach and the cockroach cockroach are two kinds of pests, and the kinship is far away, and it is impossible to mate to produce offspring.

The genome of a plant, plant tissue or plant cell as referred to in this application refers to any genetic material within a plant, plant tissue or plant cell, and includes the nucleus and plastid and mitochondrial genomes.

As used in the present application, "contact" means that insects and/or pests touch, stay and/or ingest plants, plant organs, plant tissues or plant cells, and the plants, plant organs, plant tissues or plant cells can It is a pesticidal protein expressed in the body, and may also be a microorganism having a pesticidal protein on the surface of the plant, plant organ, plant tissue or plant cell and/or having a pesticidal protein.

The term "control" and/or "control" as used herein refers to the contact of the giant cockroach pest with the Cry1A protein, which is inhibited from growing and/or causing death after contact. Further, the cockroach pest is in contact with the Cry1A protein by ingesting plant tissues, and all or part of the cockroach pest growth is inhibited and/or causes death after the contact. Inhibition refers to sublethal death, that is, it has not been killed but can cause certain effects in growth, behavior, behavior, physiology, biochemistry and organization, such as slow growth and/or cessation. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, plants and/or plant seeds containing a polymorphic sequence encoding a Cry1A protein that control the pests of the cockroach, and non-transgenic wild-type plants under conditions in which the artificial vaccination of the cockroach pest and/or the cockroach pest is naturally harmful Specific manifestations include, but are not limited to, improved stem resistance, and/or increased kernel weight, and/or increased yield, etc., as compared to reduced plant damage. The "control" and/or "control" effects of the Cry1A protein on the giant salamander can exist independently and are not attenuated and/or disappeared by other substances that can "control" and/or "control" the pests of the giant salamander. Specifically, any tissue of a transgenic plant (containing a polynucleotide sequence encoding a Cry1A protein) is present and/or asynchronously, present and/or produced, a Cry1A protein and/or another substance that can control a large pest, The presence of the other substance does not affect the "control" and/or "control" effect of the Cry1A protein on the cockroach, nor does it cause the "control" and/or "control" effect to be completely caused by the other Material is achieved, but not related to Cry1A protein. In general, in Daejeon, the process of feeding plant tissues by large pests is short-lived and difficult to observe with the naked eye. Therefore, under the conditions of artificial inoculation of large pests and/or large pests, such as genetically modified plants (including Any tissue encoding a polynucleotide sequence of the Cry1A protein has a dead large cockroach pest, and/or a large cockroach pest on which growth growth is inhibited, and/or a plant having attenuated compared to a non-transgenic wild type plant Injury, i.e., the method and/or use of the present application, i.e., by contacting the Cry1A protein with a large pest, to achieve a method and/or use for controlling the pest of the giant salamander.

The polynucleotides and/or nucleotides described herein form a complete "gene" encoding a protein or polypeptide in a desired host cell. One of skill in the art will readily recognize that the polynucleotides and/or nucleotides of the present application can be placed under the control of regulatory sequences in a host of interest.

As is well known to those skilled in the art, DNA typically exists in a double stranded form. In this arrangement, one chain is complementary to the other and vice versa. Since DNA is replicated in plants, other complementary strands of DNA are produced. Thus, the application includes the use of the polynucleotides exemplified in the Sequence Listing and their complementary strands. A "coding strand" as commonly used in the art refers to a strand that binds to the antisense strand. To express a protein in vivo, one strand of DNA is typically transcribed into a complementary strand of mRNA that is used as a template to translate the protein. mRNA is actually transcribed from the "antisense" strand of DNA. A "sense" or "encoding" strand has a series of codons (codons are three nucleotides, three reads at a time to produce a particular amino acid), which can be read as an open reading frame (ORF) to form a protein or peptide of interest. The present application also includes RNA and PNA (peptide nucleic acid) having comparable functions to the exemplified DNA.

The nucleic acid molecule or fragment thereof of the present application hybridizes to the Cry1A gene of the present application under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the Cry1A gene of the present application. A nucleic acid molecule or fragment thereof is capable of specifically hybridizing to other nucleic acid molecules under certain circumstances. In the present application, if two nucleic acid molecules can form an anti-parallel double-stranded nucleic acid structure, it can be said that the two nucleic acid molecules are capable of specifically hybridizing each other. If two nucleic acid molecules exhibit complete complementarity, one of the nucleic acid molecules is said to be the "complement" of the other nucleic acid molecule. In the present application, when each nucleotide of one nucleic acid molecule is complementary to a corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "complete complementarity". Two nucleic acid molecules are said to be "minimum" if they are capable of hybridizing to each other with sufficient stability such that they anneal under at least conventional "low stringency" conditions and bind to each other. Complementary. Similarly, two nucleic acid molecules are said to be "complementary" if they are capable of hybridizing to each other with sufficient stability such that they anneal under conventional "highly stringent" conditions and bind to each other. Deviation in complete complementarity is permissible as long as such deviation does not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to act as a primer or probe, it is only necessary to ensure that it is sufficiently complementary in sequence. This results in a stable double-stranded structure at the particular solvent and salt concentrations employed.

In the present application, a substantially homologous sequence is a nucleic acid molecule that is capable of specifically hybridizing to a complementary strand of another matched nucleic acid molecule under highly stringent conditions. Suitable stringent conditions for promoting DNA hybridization, for example, treatment with 6.0 x sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by washing with 2.0 x SSC at 50 ° C, these conditions are known to those skilled in the art. It is well known. For example, the salt concentration in the washing step can be selected from about 2.0 x SSC under low stringency conditions, 50 ° C to about 0.2 x SSC, 50 ° C under highly stringent conditions. Further, the temperature conditions in the washing step can be raised from a low temperature strict room temperature of about 22 ° C to about 65 ° C under highly stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one of them remains unchanged while the other variable changes. Preferably, the stringent conditions described herein may be specific hybridization with SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 at 65 ° C in a 6 x SSC, 0.5% SDS solution, and then The membrane was washed once with 2 x SSC, 0.1% SDS, and 1 x SSC, 0.1% SDS.

Thus, sequences having insect resistance and hybridizing under stringent conditions to SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 of the present application are included in the present application. These sequences are at least about 40%-50% homologous to the sequences of the present application, about 60%, 65% or 70% homologous, and even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93. Sequence homology of %, 94%, 95%, 96%, 97%, 98%, 99% or greater.

The genes and proteins described in this application include not only specific exemplary sequences, but also portions and/or fragments that retain the insecticidal activity characteristics of the proteins of the specific examples (including internal and/or end ratios compared to full length proteins). Deletions), variants, mutants, substitutions (proteins with alternative amino acids), chimeras and fusion proteins. By "variant" or "variant" is meant a nucleotide sequence that encodes the same protein or an equivalent protein encoded with insecticidal activity. The "equivalent protein" refers to a protein having the same or substantially the same biological activity as that of the protein of the claims.

A "fragment" or "truncated" sequence of a DNA molecule or protein sequence as referred to in this application refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) involved or an artificially engineered form thereof (eg, a sequence suitable for plant expression) The length of the aforementioned sequence may vary, but is of sufficient length to ensure that the (encoding) protein is an insect toxin.

Genes can be modified and gene variants can be easily constructed using standard techniques. For example, techniques for making point mutations are well known in the art. Further, for example, U.S. Patent No. 5,605,793 describes a method of using DNA reassembly to generate other molecular diversity after random fragmentation. Fragments of full-length genes can be made using commercial endonucleases, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cut from the ends of these genes. In addition to nucleotides. A gene encoding an active fragment can also be obtained using a variety of restriction enzymes. Active fragments of these toxins can be obtained directly using proteases.

The present application can derive equivalent proteins and/or genes encoding these equivalent proteins from B.t. isolates and/or DNA libraries. There are a number of ways to obtain the insecticidal proteins of the present application. For example, antibodies to the pesticidal proteins disclosed and claimed herein can be used to identify and isolate other proteins from protein mixtures. In particular, antibodies may be caused by protein portions that are most constant in protein and most different from other B.t. proteins. These antibodies can then be used to specifically identify a characteristically active equivalent protein by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA) or western blotting. Antibodies raised in the present application or equivalent proteins or fragments of such proteins can be readily prepared using standard procedures in the art. Genes encoding these proteins can then be obtained from microorganisms.

Due to the abundance of the genetic code, a variety of different DNA sequences can encode the same amino acid sequence. It is within the skill of the art to produce alternative DNA sequences that encode the same or substantially the same protein. These different DNA sequences are included within the scope of the present application. The "substantially identical" sequence refers to a sequence which has an amino acid substitution, deletion, addition or insertion but does not substantially affect the insecticidal activity, and also includes a fragment which retains insecticidal activity.

Substitutions, deletions or additions of amino acid sequences in the present application are conventional in the art, and it is preferred that such amino acid changes are: small changes in properties, ie, conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, Typically a deletion of about 1-30 amino acids; a small amino or carboxy terminal extension, such as a methionine residue at the amino terminus; and a small linker peptide, for example about 20-25 residues in length.

Examples of conservative substitutions are substitutions occurring within the following amino acid groups: basic amino acids (such as arginine, lysine, and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids ( Such as glutamine, asparagine, hydrophobic amino acids (such as leucine, isoleucine and valine), aromatic amino acids (such as phenylalanine, tryptophan and tyrosine), and small molecules Amino acids (such as glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that generally do not alter a particular activity are well known in the art and have been described, for example, by N. Neurath and R. L. Hill, "Protein", published at the 1979 New York Academic Press. The most common interchanges are Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their opposite interchanges.

It will be apparent to those skilled in the art that such substitutions can occur outside of the regions that are important for molecular function and still produce active polypeptides. For polypeptides of the present application, amino acid residues necessary for their activity and thus selected for unsubstitution can be identified according to methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (see, for example, Cunningham and Wells). , 1989, Science 244: 1081-1085). The latter technique involves introducing a mutation at each positively charged residue in the molecule, detecting the insecticidal activity of the resulting mutant molecule, thereby determining the molecule. Amino acid residues important for activity. The substrate-enzyme interaction site can also be determined by analysis of its three-dimensional structure, which can be determined by techniques such as nuclear magnetic resonance analysis, crystallography or photoaffinity labeling (see, eg, de Vos et al., 1992, Science 255). : 306-312; Smith et al, 1992, J. Mol. Biol 224: 899-904; Wlodaver et al, 1992, FEBS Letters 309: 59-64).

In the present application, Cry1A protein includes, but is not limited to, Cry1Ab, Cry1A.105 or Cry1Ac protein, or an insecticidal fragment or functional region having at least 70% homology to the amino acid sequence of the above protein and having insecticidal activity against Euphorbia.

Thus, amino acid sequences having some homology to the amino acid sequences shown in Sequences 1, 2 and/or 3 are also included in the present application. These sequences are typically greater than 60%, preferably greater than 75%, more preferably greater than 80%, even more preferably greater than 90%, and may be greater than 95%, similar to the sequence of the present application. Preferred polynucleotides and proteins of the present application may also be defined according to a more specific range of identity and/or similarity. For example, the sequence of the examples of the present application is 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79% , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99% identity and/or similarity.

Regulatory sequences as described herein include, but are not limited to, promoters, transit peptides, terminators, enhancers, leader sequences, introns, and other regulatory operably linked to the Cry1A protein, Vip3A protein, and other Cry-like proteins. sequence.

The promoter is a promoter expressible in a plant, and the "promoter expressible in a plant" refers to a promoter which ensures expression of a coding sequence linked thereto in a plant cell. A promoter expressible in a plant can be a constitutive promoter. Examples of promoters that direct constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, the promoter of the rice GOS2 gene, and the like. Alternatively, a promoter expressible in a plant may be a tissue-specific promoter, ie the promoter directs the expression level of the coding sequence in some tissues of the plant, such as in green tissue, to be higher than other tissues of the plant (through conventional The RNA assay is performed), such as the PEP carboxylase promoter. Alternatively, a promoter expressible in a plant can be a wound-inducible promoter. A wound-inducible promoter or a promoter that directs a wound-inducible expression pattern means that when the plant is subjected to mechanical or wounding by insect foraging, the expression of the coding sequence under the control of the promoter is significantly improved compared to normal growth conditions. Examples of wound-inducible promoters include, but are not limited to, promoters of protease inhibitory genes (pinI and pinII) and maize protease inhibitory genes (MPI) of potato and tomato.

The transit peptide (also known as a secretion signal sequence or targeting sequence) directs the transgene product to a particular organelle or cell compartment, and for the receptor protein, the transit peptide can be heterologous, for example, using a coding chloroplast transporter Peptide The sequence targets the chloroplast, either targeting the endoplasmic reticulum using the 'KDEL' retention sequence, or targeting the vacuole with the CTPP of the barley plant lectin gene.

The leader sequence includes, but is not limited to, a picornavirus leader sequence, such as an EMCV leader sequence (5' non-coding region of encephalomyocarditis virus); a potato virus group leader sequence, such as a MDMV (maize dwarf mosaic virus) leader sequence; Human immunoglobulin protein heavy chain binding protein (BiP); untranslated leader sequence of the coat protein mRNA of alfalfa mosaic virus (AMV RNA4); tobacco mosaic virus (TMV) leader sequence.

The enhancer includes, but is not limited to, a cauliflower mosaic virus (CaMV) enhancer, a figwort mosaic virus (FMV) enhancer, a carnation weathering ring virus (CERV) enhancer, and a cassava vein mosaic virus (CsVMV) enhancer. , Purple Jasmine Mosaic Virus (MMV) enhancer, Night fragrant yellow leaf curl virus (CmYLCV) enhancer, Multan cotton leaf curl virus (CLCuMV), Acanthus yellow mottle virus (CoYMV) and peanut chlorotic line flower Leaf virus (PCLSV) enhancer.

For monocot applications, the introns include, but are not limited to, maize hsp70 introns, maize ubiquitin introns, Adh introns 1, sucrose synthase introns, or rice Actl introns. For dicotyledonous applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.

The terminator may be a suitable polyadenylation signal sequence that functions in plants, including but not limited to, a polyadenylation signal sequence derived from the Agrobacterium tumefaciens nopaline synthase (NOS) gene. a polyadenylation signal sequence derived from the protease inhibitor II (pin II) gene, a polyadenylation signal sequence derived from the pea ssRUBISCO E9 gene, and a gene derived from the α-tubulin gene. Polyadenylation signal sequence.

As used herein, "operably linked" refers to the joining of nucleic acid sequences that allow one sequence to provide the function required for the linked sequence. As used herein, "operably linked" can be such that a promoter is ligated to a sequence of interest such that transcription of the sequence of interest is controlled and regulated by the promoter. "Effective ligation" when a sequence of interest encodes a protein and is intended to obtain expression of the protein means that the promoter is ligated to the sequence in a manner that allows efficient translation of the resulting transcript. If the linker of the promoter to the coding sequence is a transcript fusion and it is desired to effect expression of the encoded protein, such ligation is made such that the first translation initiation codon in the resulting transcript is the start codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and it is desired to effect expression of the encoded protein, such linkage is made such that the first translation initiation codon and promoter contained in the 5' untranslated sequence Linked and linked such that the resulting translation product is in frame with the translational open reading frame encoding the desired protein. Nucleic acid sequences that may be "operably linked" include, but are not limited to, sequences that provide for gene expression functions (i.e., gene expression elements such as promoters, 5' untranslated regions, introns, protein coding regions, 3' untranslated regions, a polyadenylation site and/or a transcription terminator), a sequence that provides DNA transfer and/or integration functions (ie, a T-DNA border sequence, a site-specific recombinase recognition site, an integrase recognition site), Selectively functional sequences (ie, antibiotic resistance markers, biosynthetic genes), sequences that provide for the function of scoring markers, sequences that facilitate sequence manipulation in vitro or in vivo (ie, polylinker sequences, site-specific recombination sequences) and A sequence that provides replication (ie, a bacterial origin of replication, an autonomously replicating sequence, a centromeric sequence).

As used herein, "insecticidal" or "insect-resistant" means toxic to crop pests, thereby achieving "control" and/or "control" of crop pests. Preferably, said "insecticide" or "insect-resistant" means killing crop pests. More specifically, the target insect is a large insect pest.

The Cry1A protein in this application is toxic to the cockroach pest. The plants of the present application, particularly sorghum and maize, contain exogenous DNA in their genome, the exogenous DNA comprising a nucleotide sequence encoding a Cry1A protein, which is contacted by the plant pest tissue by ingestion of the plant tissue, after contact The growth of the pests of the giant salamander is inhibited and eventually leads to death. Inhibition refers to death or sub-lethal death. At the same time, the plants should be morphologically normal and can be cultured under conventional methods for consumption and/or production of the product. In addition, the plant substantially eliminates the need for chemical or biological insecticides that are insecticides against the giant cockroach pests targeted by the Cry1A protein.

The expression level of insecticidal crystal protein (ICP) in plant material can be detected by various methods described in the art, for example, by using specific primers to quantify the mRNA encoding the insecticidal protein produced in the tissue, or directly specific The amount of insecticidal protein produced is detected.

Different tests can be applied to determine the insecticidal effect of ICP in plants. The target insects in this application are mainly large cockroaches.

In the present application, the Cry1A protein may have the amino acid sequence shown by SEQ ID NO: 1, SEQ ID NO: 2, and/or SEQ ID NO: 3 in the Sequence Listing. In addition to the coding region comprising the Cry1A protein, other elements may be included, such as a protein encoding a selectable marker.

Furthermore, an expression cassette comprising a nucleotide sequence encoding a Cry1A protein of the present application may also be expressed in a plant together with at least one protein encoding a herbicide resistance gene including, but not limited to, oxalic acid Phospho-resistant genes (such as bar gene, pat gene), benthamiana resistance genes (such as pmph gene), glyphosate resistance genes (such as EPSPS gene), bromoxynil resistance gene, sulfonylurea Resistance gene, resistance gene to herbicide tortoise, resistance gene to cyanamide or glutamine synthetase inhibitor (such as PPT), thereby obtaining high insecticidal activity and weeding Agent-resistant transgenic plants.

In the present application, the foreign DNA is introduced into a plant, such as a gene encoding the Cry1A protein or an expression cassette or a recombinant vector, and the conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, micro-launch bombardment, Direct DNA uptake into protoplast, electroporation or whisker silicon-mediated DNA introduction.

The present application provides a method of controlling pests, which has the following advantages:

1. Internal cause prevention. The prior art mainly controls the harm of the giant cockroach pest through external action, ie external cause, such as agricultural control, chemical control and biological control; and the present application controls the cockroach pest by producing a Cry1A protein capable of killing the big cockroach in the plant. That is, through internal factors to prevent and cure.

2, no pollution, no residue. Although the chemical control method used in the prior art plays a certain role in controlling the harm of the giant cockroach pest, it also brings pollution, damage and residue to the human, livestock and farmland ecosystems; the method of controlling the cockroach pest using the present application Can eliminate the above negative consequences.

3. Prevention and control during the whole growth period. The methods used in the prior art for controlling giant cockroaches are staged, and the present application protects plants from the whole growth period, and the transgenic plants (Cry1A protein) can be avoided from germination and growth until flowering and fruiting. Suffered from amnesty.

4. Whole plant control. The methods used in the prior art for controlling large pests are mostly local, such as foliar application; and the present application protects whole plants, such as leaves, stems, tassels, and females of transgenic plants (Cry1A protein). Ears, anthers, filigrees, etc. are all resistant to cockroaches.

5, the effect is stable. The biocide used in the prior art needs to be directly sprayed onto the surface of the crop, thus causing the active crystalline protein (including the Cry1A protein) to be degraded in the environment; the present application is to make the Cry1A protein expressed in plants, effective The defect of biopesticide instability in nature is avoided, and the control effect of the transgenic plant (Cry1A protein) of the present application is stable at different locations, at different times, and in different genetic backgrounds.

6, simple, convenient and economical. The biocides used in the prior art are easily degraded in the environment, and thus require repeated production and repeated application, and bring difficulties to practical application in agricultural production, which greatly increases the cost; Transgenic plants of the Cry1A protein can be used without any other measures, saving a lot of manpower, material resources and financial resources.

7, the effect is thorough. The method for controlling cockroach pests used in the prior art has an incomplete effect and only serves to alleviate the effect; and the transgenic plant (Cry1A protein) of the present application can cause a large number of deaths of the newly hatched larvae and survive to a small portion. The larval development progress was greatly inhibited. After 3 days, the larvae were still in the initial hatching state, all of which were obviously dysplastic, and had stopped development, while the transgenic plants were generally only slightly damaged.

The technical solution of the method for controlling pests of the present application is further illustrated by specific embodiments below.

Example

First Example, Acquisition and Synthesis of Cry1A Gene

1. Obtain the Cry1A nucleotide sequence

The amino acid sequence of Cry1Ab-01 insecticidal protein (818 amino acids), as shown in SEQ ID NO: 1 in the Sequence Listing; Cry1Ab-01 encoding the amino acid sequence (818 amino acids) corresponding to the Cry1Ab-01 insecticidal protein Nucleotide sequence (2457 nucleotides) as shown in SEQ ID NO: 4 in the Sequence Listing. Cry1Ab-02 insecticidal protein Amino acid sequence (615 amino acids), as shown in SEQ ID NO: 2 in the Sequence Listing; Cry1Ab-02 nucleotide sequence encoding the amino acid sequence (615 amino acids) corresponding to the Cry1Ab-02 insecticidal protein (1848 Nucleotide), as shown in SEQ ID NO: 5 in the Sequence Listing.

The amino acid sequence of Cry1A.105 insecticidal protein (1177 amino acids), as shown in SEQ ID NO: 3 in the Sequence Listing; Cry1A.105 encoding the amino acid sequence (1177 amino acids) corresponding to the Cry1A.105 insecticidal protein Nucleotide sequence (3534 nucleotides) as shown in SEQ ID NO: 6 in the Sequence Listing.

2. Obtain a Vip nucleotide sequence

A Vip3Aa nucleotide sequence (2370 nucleotides) encoding the amino acid sequence (789 amino acids) of the Vip3Aa insecticidal protein, as set forth in SEQ ID NO: 7 of the Sequence Listing.

3. Obtain a Cry-like nucleotide sequence

The Cry2Ab nucleotide sequence (1905 nucleotides) encoding the amino acid sequence (634 amino acids) of the Cry2Ab insecticidal protein is shown in SEQ ID NO: 8 of the Sequence Listing.

4. Synthesize the above nucleotide sequence

The Cry1Ab-01 nucleotide sequence (as shown in SEQ ID NO: 4 in the Sequence Listing), the Cry1Ab-02 nucleotide sequence (as shown in SEQ ID NO: 5 in the Sequence Listing), and the Cry1A. 105 nucleotide sequence (as shown in SEQ ID NO: 6 in the Sequence Listing), the Vip3Aa nucleotide sequence (as shown in SEQ ID NO: 7 in the Sequence Listing), and the Cry2Ab nucleotide sequence (eg, SEQ ID NO: 8 in the list) was synthesized by Nanjing Kingsray Biotechnology Co., Ltd. The 5' end of the synthesized Cry1Ab-01 nucleotide sequence (SEQ ID NO: 4) is also ligated with an NcoI cleavage site, and the 3' of the Cry1Ab-01 nucleotide sequence (SEQ ID NO: 4) The SpeI cleavage site is also ligated to the end; the 5' end of the synthesized Cry1Ab-02 nucleotide sequence (SEQ ID NO: 5) is further ligated with an NcoI cleavage site, and the Cry1Ab-02 nucleotide sequence The 3' end of (SEQ ID NO: 5) is also ligated with a SpeI cleavage site; the 5' end of the synthesized Cry1A.105 nucleotide sequence (SEQ ID NO: 6) is also ligated with an NcoI cleavage site The 3' end of the Cry1A.105 nucleotide sequence (SEQ ID NO: 6) is further ligated with a HindIII cleavage site; the 5' end of the synthesized Vip3Aa nucleotide sequence (SEQ ID NO: 7) is further The ScaI cleavage site is ligated, and the 3' end of the Vip3Aa nucleotide sequence (SEQ ID NO: 7) is further ligated with a SpeI cleavage site; the synthesized Cry2Ab nucleotide sequence (SEQ ID NO: 8) The 5' end of the Cry2Ab nucleotide sequence (SEQ ID NO: 8) is also ligated with a SpeI cleavage site.

Second embodiment, construction of recombinant expression vector and recombinant expression vector for transformation of Agrobacterium

1. Construction of a recombinant cloning vector containing the Cry1A gene

The synthetic Cry1Ab-01 nucleotide sequence was ligated into the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the procedure was carried out according to the Promega product pGEM-T vector specification to obtain a recombinant gram. The vector of DBN01-T is constructed as shown in Figure 1 (wherein Amp represents the ampicillin resistance gene; f1 represents the origin of replication of phage f1; LacZ is the LacZ initiation codon; and SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase promoter; Cry1Ab-01 is the Cry1Ab-01 nucleotide sequence (SEQ ID NO: 4); MCS is the multiple cloning site).

The recombinant cloning vector DBN01-T was then transformed into E. coli T1 competent cells by heat shock method (Transgen, Beijing, China, CAT: CD501) under heat shock conditions: 50 μl E. coli T1 competent cells, 10 μl plasmid DNA (recombinant) Cloning vector DBN01-T), water bath at 42 ° C for 30 seconds; shaking culture at 37 ° C for 1 hour (shake at 100 rpm), coated with IPTG (isopropylthio-β-D-galactoside) and X -gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) ampicillin (100 mg/L) in LB plate (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L, adjusted to pH 7.5 with NaOH) was grown overnight. White colonies were picked and cultured in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, ampicillin 100 mg/L, pH adjusted to 7.5 with NaOH) at 37 °C. overnight. The plasmid was extracted by alkaline method: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was removed, and the precipitated cells were pre-cooled with 100 μl of ice (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose. , pH 8.0) suspension; add 150 μl of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times, mix, set on ice for 3-5 min; add 150 μl ice cold Solution III (4M potassium acetate, 2M acetic acid), mix well immediately, place on ice for 5-10 min; centrifuge at 5 ° C, 12000 rpm for 5 min, add 2 volumes of absolute ethanol to the supernatant, mix After homogenization, let it stand at room temperature for 5 min; centrifuge at 5 ° C, 12000 rpm for 5 min, discard the supernatant, and wash the precipitate with 70% ethanol (V/V) and dry it; add 30 μl of RNase (20 μg/ml). The TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) was dissolved in the precipitate; the RNA was digested in a water bath at 37 ° C for 30 min; and stored at -20 ° C until use.

After the extracted plasmid was identified by KpnI and BglI digestion, the positive clone was verified by sequencing, and the result showed that the Cry1Ab-01 nucleotide sequence inserted into the recombinant cloning vector DBN01-T was represented by SEQ ID NO: 4 in the sequence listing. The nucleotide sequence, ie the Cry1Ab-01 nucleotide sequence, was correctly inserted.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1Ab-02 nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN02-T, wherein Cry1Ab-02 was Cry1Ab-02. Nucleotide sequence (SEQ ID NO: 5). The Cry1Ab-02 nucleotide sequence in the recombinant cloning vector DBN02-T was correctly inserted by restriction enzyme digestion and sequencing.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry1A.105 nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN03-T, wherein Cry1A.105 was Cry1A.105. Nucleotide sequence (SEQ ID NO: 6). The Cry1A.105 nucleotide sequence in the recombinant cloning vector DBN03-T was correctly inserted by restriction enzyme digestion and sequencing.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Vip3Aa nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN04-T, wherein Vip3Aa was a Vip3Aa nucleotide sequence (SEQ ID NO: 7). The correct insertion of the Vip3Aa nucleotide sequence in the recombinant cloning vector DBN04-T was confirmed by restriction enzyme digestion and sequencing.

According to the above method for constructing the recombinant cloning vector DBN01-T, the synthesized Cry2Ab nucleotide sequence was ligated into the cloning vector pGEM-T to obtain a recombinant cloning vector DBN05-T, wherein the Cry2Ab was a Cry2Ab nucleotide sequence (SEQ ID NO: 8). The Cry2Ab nucleotide sequence in the recombinant cloning vector DBN05-T was correctly inserted by restriction enzyme digestion and sequencing.

2. Construction of a recombinant expression vector containing the Cry1A gene

Recombinant cloning vector DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from CAMBIA)) were digested with restriction endonucleases NcoI and SpeI, respectively, and the cut Cry1Ab-01 nucleotide sequence fragment was inserted. Between the NcoI and SpeI sites of the expression vector DBNBC-01, the construction of the vector by conventional enzymatic cleavage method is well known to those skilled in the art, and the recombinant expression vector DBN100124 is constructed. The construction process is shown in Figure 2 (Kan: Kanamycin gene; RB: right border; Ubi: maize Ubiquitin (ubiquitin) gene promoter (SEQ ID NO: 9); Cry1Ab-01: Cry1Ab-01 nucleotide sequence (SEQ ID NO: 4); Nos : terminator of the nopaline synthase gene (SEQ ID NO: 10); PMI: phosphomannose isomerase gene (SEQ ID NO: 11); LB: left border).

The recombinant expression vector DBN100124 was transformed into E. coli T1 competent cells by heat shock method. The heat shock conditions were: 50 μl of E. coli T1 competent cells, 10 μl of plasmid DNA (recombinant expression vector DBN100124), 42 ° C water bath for 30 seconds; 37 ° C oscillation Incubate for 1 hour (shake shake at 100 rpm); then LB solid plate containing 50 mg/L kanamycin (trypeptin 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g) /L, adjust the pH to 7.5 with NaOH and incubate at 37 °C for 12 hours, pick white colonies, in LB liquid medium (tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, Kanamycin 50 mg/L was adjusted to pH 7.5 with NaOH and incubated overnight at 37 °C. The plasmid was extracted by an alkali method. The extracted plasmid was digested with restriction endonucleases NcoI and SpeI, and the positive clones were sequenced. The results showed that the nucleotide sequence between the NcoI and SpeI sites of the recombinant expression vector DBN100124 was SEQ ID in the sequence listing. NO: The nucleotide sequence shown in 4, that is, the Cry1Ab-01 nucleotide sequence.

According to the above method for constructing the recombinant expression vector DBN100124, the Cry1Ab-02 nucleotide sequence excised from the recombinant cloning vector DBN02-T by NcoI and SpeI was inserted into the expression vector DBNBC-01 to obtain a recombinant expression vector DBN100053. The nucleotide sequence in the recombinant expression vector DBN100053 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 5 in the sequence listing, that is, the Cry1Ab-02 nucleotide sequence, and the Cry1Ab-02 nucleotide sequence was digested and sequenced. The Ubi promoter and the Nos terminator can be ligated.

According to the above method for constructing the recombinant expression vector DBN100124, the Cry1Ab-01 nucleotide sequence and the Vip3Aa nucleotide sequence excised by the recombinant cloning vectors DBN01-T and DBN04-T, respectively, were digested with NcoI and SpeI, ScaI and SpeI, respectively. The expression vector DBNBC-01 was obtained to obtain a recombinant expression vector DBN100003. The nucleotide sequence in the recombinant expression vector DBN100003 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 4 and SEQ ID NO: 7 in the sequence listing, namely Cry1Ab-01 nucleotide sequence and Vip3Aa nucleoside. The acid sequence, the Cry1Ab-01 nucleotide sequence and the Vip3Aa nucleotide sequence can be ligated to the Ubi promoter and the Nos terminator.

According to the above method for constructing the recombinant expression vector DBN100124, the Cry1A.105 nucleotide sequence excised by NcoI and HindIII digestion recombinant cloning vector DBN03-T was inserted into the expression vector DBNBC-01 to obtain a recombinant expression vector DBN100029. The nucleotide sequence in the recombinant expression vector DBN100029 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 6 in the sequence listing, that is, the Cry1A.105 nucleotide sequence, and the Cry1A.105 nucleotide sequence was digested and sequenced. The Ubi promoter and the Nos terminator can be ligated.

According to the above method for constructing the recombinant expression vector DBN100124, the Cry1A.105 nucleotide sequence and the Cry2Ab nucleotide sequence excised by the recombinant cloning vectors DBN03-T and DBN05-T, respectively, were digested with NcoI and HindIII, NcoI and SpeI, respectively. The expression vector DBNBC-01 was obtained to obtain a recombinant expression vector DBN100076. The nucleotide sequence in the recombinant expression vector DBN100076 was confirmed to be the nucleotide sequence shown by SEQ ID NO: 6 and SEQ ID NO: 8 in the sequence listing, that is, the Cry1A.105 nucleotide sequence and the Cry2Ab nucleoside. The acid sequence, the Cry1A.105 nucleotide sequence and the Cry2Ab nucleotide sequence can be ligated to the Ubi promoter and the Nos terminator.

3. Recombinant expression vector transforming Agrobacterium

The recombinant expression vectors DBN100124, DBN100053, DBN100003, DBN100029 and DBN100076, which have been constructed correctly, were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by liquid nitrogen method, and the transformation conditions were: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, 37 ° C warm water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated in LB test tube at a temperature of 28 ° C, rotation speed of 200 rpm 2 Hour, apply to LB plates containing 50 mg/L of Rifampicin and 100 mg/L of Kanamycin until a positive monoclonal grows, pick a monoclonal culture and extract the plasmid for restriction The restriction endonucleases AhdI and XbaI were used to recombine the recombinant expression vectors DBN10029 and DBN100003 with restriction endonucleases AhdI and XhoI, and the recombinant expression vectors DBN100029 and DBN100076 were digested with restriction endonucleases StyI and XhoI. The results of restriction enzyme digestion showed that the recombinant expression vectors DBN100124, DBN100003, DBN100053, DBN100029 and DBN100076 were completely correct.

Third embodiment, obtaining and verifying corn plants transferred into Cry1A gene

1. Obtain corn plants that have been transferred into the Cry1A gene.

According to the conventional Agrobacterium infection method, the immature embryos of the aseptically cultivated maize variety 31 (Z31) and the second real The Agrobacterium described in Example 3 was co-cultured to use the T-DNA (including the promoter sequence of the maize Ubiquitin gene, Cry1Ab) in the recombinant expression vectors DBN100124, DBN100053, DBN100003, DBN100029 and DBN100076 constructed in the second embodiment. -01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1A.105 nucleotide sequence, Vip3Aa nucleotide sequence, Cry2Ab nucleotide sequence, PMI gene and Nos terminator sequence) were transferred into the maize genome A maize plant transformed with the Cry1Ab-01 nucleotide sequence, a maize plant transformed with the Cry1Ab-02 nucleotide sequence, a maize plant transformed with the Cry1Ab-01-Vip3Aa nucleotide sequence, and a Cry1A.105 core were obtained. Maize plants with a nucleotide sequence and maize plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence; wild type maize plants were used as controls.

For Agrobacterium-mediated transformation of maize, briefly, immature immature embryos are isolated from maize, and the immature embryos are contacted with Agrobacterium suspension, wherein Agrobacterium can express Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide The sequence, the Cry1Ab-01-Vip3Aa nucleotide sequence, the Cry1A.105 nucleotide sequence, and/or the Cry1A.105-Cry2Ab nucleotide sequence are delivered to at least one cell of one of the young embryos (step 1: infection step), In this step, the immature embryo is preferably immersed in an Agrobacterium suspension (OD ₆₆₀ = 0.4-0.6, infecting medium (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 68.5 g/L, glucose) Inoculation was initiated with 36 g/L, acetosyringone (AS) 40 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, pH 5.3)). The immature embryo is co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Preferably, the immature embryo is in solid medium after the infection step (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 20 g/L, glucose 10 g/L, acetosyringone (AS) 100 mg/L) It was cultured on 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, the medium was restored (MS salt 4.3 g / L, MS vitamin, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / At least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium is present in L, agar 8 g/L, pH 5.8), and no selection agent for plant transformants is added (step 3: recovery step). Preferably, the immature embryos are cultured on a solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selective agent (mannose) and the grown transformed callus is selected (step 4: selection step). Preferably, the immature embryo is screened in solid medium with selective agent (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 5 g/L, mannose 12.5 g/L, 2,4-dichlorobenzene). Incubation with oxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH 5.8) resulted in selective growth of transformed cells. Then, the callus regenerates the plant (step 5: regeneration step), preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) Recycled plants.

The selected resistant callus was transferred to the MS differentiation medium (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 30 g/L, 6-benzyl adenine 2 mg/L, mannose) 5g/L, agar 8g/L, pH 5.8), cultured and differentiated at 25 °C. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g/L, MS Vista) Life, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH 5.8), cultured at 25 ° C to about 10 cm high, moved to the greenhouse to grow to firm. In the greenhouse, the cells were cultured at 28 ° C for 16 hours and then at 20 ° C for 8 hours.

2. TaqMan was used to verify the maize plants transferred to the Cry1A gene.

Maize plants transfected with Cry1Ab-01 nucleotide sequence, maize plants transfected with Cry1Ab-02 nucleotide sequence, maize plants transfected with Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred into Cry1A.105 nucleoside The acid sequence of the maize plant and the leaves of the maize plant transformed with the Cry1A.105-Cry2Ab nucleotide sequence were approximately 100 mg as samples, and the genomic DNA was extracted with Qiagen's DNeasy Plant Maxi Kit, and the Cry1A gene was detected by Taqman probe fluorescent quantitative PCR. , the copy number of the Vip3Aa gene and the Cry2Ab gene. At the same time, the wild type corn plants were used as a control, and the detection and analysis were carried out according to the above method. The experiment was set to repeat 3 times and averaged.

The specific methods for detecting the copy number of the Cry1A gene, the Vip3Aa gene and the Cry2Ab gene are as follows:

Step 11. The maize plants transfected into the Cry1Ab-01 nucleotide sequence, the maize plants transformed into the Cry1Ab-02 nucleotide sequence, the maize plants transformed into the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred into Cry1A. The maize plants of the 105 nucleotide sequence, the maize plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence, and the leaves of the wild-type maize plants were each 100 mg, which were respectively homogenized with liquid nitrogen in a mortar, and each sample was taken. 3 repetitions;

Step 12. Extract the genomic DNA of the above sample using Qiagen's DNeasy Plant Mini Kit, and refer to the product manual for the specific method;

Step 13. Determine the genomic DNA concentration of the above sample using NanoDrop 2000 (Thermo Scientific);

Step 14, adjusting the genomic DNA concentration of the above sample to the same concentration value, the concentration value ranges from 80 to 100 ng / μl;

Step 15. The Taqman probe real-time PCR method is used to identify the copy number of the sample, and the sample with the known copy number is used as a standard, and the sample of the wild type corn plant is used as a control, and each sample has 3 replicates, and the average is taken. Value; the fluorescent PCR primers and probe sequences are:

The following primers and probes were used to detect the Cry1Ab-01 nucleotide sequence:

Primer 1 (CF1): CGAACTACGACTCCCGCAC is shown in SEQ ID NO: 12 in the Sequence Listing;

Primer 2 (CR1): GTAGATTTCGCGGGTCAGTTG is shown in SEQ ID NO: 13 in the Sequence Listing;

Probe 1 (CP1): CTACCCGATCCGCACCGTGTCC as shown in SEQ ID NO: 14 in the Sequence Listing;

The following primers and probes were used to detect the Cry1Ab-02 nucleotide sequence:

Primer 3 (CF2): TGCGTATTCAATTCAACGACATG is shown in SEQ ID NO: 15 in the Sequence Listing;

Primer 4 (CR2): CTTGGTAGTTCTGGACTGCGAAC as shown in SEQ ID NO: 16 in the Sequence Listing;

Probe 2 (CP2): CAGCGCCTTGACCACAGCTATCCC as shown in SEQ ID NO: 17 of the Sequence Listing Show

The following primers and probes were used to detect the Vip3Aa nucleotide sequence:

Primer 5 (VF1): ATTCTCGAAATCTCCCCTAGCG is shown in SEQ ID NO: 18 in the Sequence Listing;

Primer 6 (VR1): GCTGCCAGTGGATGTCCAG is shown in SEQ ID NO: 19 in the Sequence Listing;

Probe 3 (VP1): CTCCTGAGCCCCGAGCTGATTAACACC as shown in SEQ ID NO: 20 in the Sequence Listing;

The following primers and probes were used to detect the Cry1A.105 nucleotide sequence:

Primer 7 (CF3): GCGCATCCAGTTCAACGAC is shown in SEQ ID NO: 21 in the Sequence Listing;

Primer 8 (CR3): GTTCTGGACGGCGAAGAGTG as shown in SEQ ID NO: 22 in the Sequence Listing;

Probe 4 (CP3): TGAACAGCGCCCTGACCACCG is shown in SEQ ID NO: 23 in the Sequence Listing;

The following primers and probes were used to detect the Cry2Ab nucleotide sequence:

Primer 9 (CF4): CTGATACCCTTGCTCGCGTC is shown in SEQ ID NO: 24 in the Sequence Listing;

Primer 10 (CR4): CACTTGGCGGTTGAACTCCTC is shown in SEQ ID NO: 25 in the Sequence Listing;

Probe 5 (CP4): CGCTGAGCTGACGGGTCTGCAAG as shown in SEQ ID NO: 26 in the Sequence Listing;

The PCR reaction system is:

The 50× primer/probe mixture contained 45 μl of each primer at a concentration of 1 mM, 50 μl of a probe at a concentration of 100 μM, and 860 μl of 1×TE buffer, and stored at 4° C. in an amber tube.

The PCR reaction conditions are:

Data were analyzed using SDS2.3 software (Applied Biosystems).

The results showed that the Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ab-01-Vp3Aa nucleotide sequence, Cry1A.105 nucleotide sequence and Cry1A.105-Cry2Ab nucleotide sequence were integrated. To the detected Maize plants in the genome of maize plants, and transferred to the Cry1Ab-01 nucleotide sequence of maize plants, maize plants transfected with Cry1Ab-02 nucleotide sequence, maize plants transfected with Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred Transgenic maize plants containing a single copy of the Cry1A gene, the Vip3Aa gene and/or the Cry2Ab gene were obtained from both the maize plant into the Cry1A.105 nucleotide sequence and the maize plant transformed into the Cry1A.105-Cry2Ab nucleotide sequence.

Fourth embodiment, detection of insect resistance of transgenic corn plants

A maize plant transformed with the Cry1Ab-01 nucleotide sequence, a maize plant transformed with the Cry1Ab-02 nucleotide sequence, a maize plant transformed with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to Cry1A.105 nucleotides Sequence maize plants, maize plants transfected with Cry1A.105-Cry2Ab nucleotide sequence, wild-type maize plants, and non-transgenic maize plants identified by Taqman were tested for insect resistance.

Maize plants transfected with Cry1Ab-01 nucleotide sequence, maize plants transfected with Cry1Ab-02 nucleotide sequence, maize plants transfected with Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred into Cry1A.105 nucleoside Acidic sequence of maize plants, maize plants transferred to the Cry1A.105-Cry2Ab nucleotide sequence, wild-type maize plants, and fresh leaves (hearts) of non-transgenic maize plants (V3-V4 phase) identified by Taqman Rinse with sterile water and use gauze to blot the water on the leaves. Then remove the veins from the corn leaves and cut into strips of about 1cm × 4cm. Take 3 pieces of cut long leaves into a round plastic culture. On the filter paper at the bottom of the dish, the filter paper is wetted with distilled water, and 10 artificially reared cockroaches (initial hatching larvae) are placed in each dish, and the insect test dishes are covered and placed in a box with wet gauze on the bottom. In the temperature range of 25-28 ° C, relative humidity 70% -80%, photoperiod (light / dark) 16:8, after three days, according to the three larvae development progress, mortality and leaf damage rate , get the total score of resistance: total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / Total worm) + 60 × (newly hatched - number of negative control insects / the total number insects) + 10 × (number of negative control / the total insect pest)] + 100 × (1- leaf damage rate). A total of 3 lines (S1, S2 and S3) transfected into the Cry1Ab-01 nucleotide sequence were transferred into the Cry1Ab-02 nucleotide sequence (S4, S5 and S6) and transferred to Cry1Ab- A total of 3 strains (S7, S8 and S9) of the nucleotide sequence of 01-Vip3Aa were transferred into Cry1A.105 nucleotide sequence of 3 lines (S10, S11 and S12) and transferred to Cry1A.105- A total of 3 strains of the Cry2Ab nucleotide sequence (S13, S14 and S15), identified by Taqman as a non-transgenic (NGM1) strain, and a wild-type (CK1) a total of 1 strain; Three strains of the strain were selected for testing, and each plant was repeated 6 times. The results are shown in Table 1 and Figure 3.

Table 1. Results of insect resistance test of inoculated sorghum in transgenic maize plants

The results in Table 1 indicate that a maize plant transformed with the Cry1Ab-01 nucleotide sequence, a maize plant transformed with the Cry1Ab-02 nucleotide sequence, a maize plant transformed with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to Cry1A The total score of the .105 nucleotide sequence of maize plants and the maize plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence was about 280 or more; and the non-transgenic maize plants and wild type identified by Taqman were identified. The total score of the corn plants is generally below 20 points.

The results in Figure 3 indicate that maize plants transfected with the Cry1Ab-01 nucleotide sequence, maize plants transfected with the Cry1Ab-02 nucleotide sequence, and transferred to the Cry1Ab-01-Vip3Aa nucleotide were compared to wild-type maize plants. Sequence maize plants, maize plants transferred to the Cry1A.105 nucleotide sequence, and maize plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence can cause a large number of deaths of the newly hatched larvae and develop a small number of surviving larvae. The progress was greatly inhibited. After 3 days, the larvae were still in the initial incubation state, and the maize plants transferred to the Cry1Ab-01 nucleotide sequence, the maize plants transferred to the Cry1Ab-02 nucleotide sequence, and transferred to Cry1Ab-01- Vip3Aa nucleotide sequence of maize plants, transferred to Cry1A.105 The nucleotide sequence of the maize plant and the maize plant transformed into the Cry1A.105-Cry2Ab nucleotide sequence were only slightly damaged, and only a small amount of pinhole-like damage was observed on the leaf, and the leaf damage rate was 3% or less. .

Thus, the maize plant transformed into the Cry1Ab-01 nucleotide sequence, the maize plant transformed into the Cry1Ab-02 nucleotide sequence, the maize plant transformed into the Cry1Ab-01-Vip3Aa nucleotide sequence, and the Cry1A.105 nucleus were transferred. The maize plants of the nucleotide sequence and the maize plants transformed into the nucleotide sequence of the Cry1A.105-Cry2Ab showed high activity against cockroaches, which was sufficient to exert an adverse effect on the growth of the cockroach to control it.

Fifth embodiment, obtaining and verifying rice plants transferred into Cry1A gene

1. Obtain rice plants that have been transferred into the Cry1A gene.

The callus of the aseptically cultivated indica rice variety Nipponbare is co-cultured with the Agrobacterium described in the third embodiment in accordance with the conventional Agrobacterium infection method to construct the recombinant expression vector constructed in the second embodiment. T-DNA in DBN100124, DBN100053, DBN100003, DBN100029 and DBN100076 (including promoter sequence of maize Ubiquitin gene, Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1A.105 nucleotide sequence, Vip3Aa core) The nucleotide sequence, Cry2Ab nucleotide sequence, PMI gene and Nos terminator sequence were transferred into the rice genome, and the rice plant transformed into the Cry1Ab-01 nucleotide sequence was obtained and transferred into the Cry1Ab-02 nucleotide sequence. Rice plants, rice plants transformed into the Cry1Ab-01-Vip3Aa nucleotide sequence, rice plants transformed into the Cry1A.105 nucleotide sequence, and rice plants transformed into the Cry1A.105-Cry2Ab nucleotide sequence; Type rice plants were used as controls.

For Agrobacterium-mediated rice transformation, rice seeds were briefly inoculated in induction medium (N6 salt, N6 vitamin, casein 300 mg/L, sucrose 30 g/L, 2,4-dichlorophenoxyacetic acid (2, 4-D) 2 mg/L, plant gel 3 g/L, pH 5.8), callus was induced from rice mature embryos (step 1: callus induction step), after which callus was preferably used, with Agrobacterium The suspension contacts the callus, wherein the Agrobacterium is capable of expressing the Cry1Ab-01 nucleotide sequence, the Cry1Ab-02 nucleotide sequence, the Cry1Ab-01-Vip3Aa nucleotide sequence, the Cry1A.105 nucleotide sequence, and/or Cry1A. The 105-Cry2Ab nucleotide sequence is delivered to at least one cell on the callus (step 2: infection step). In this step, the callus is preferably immersed in the Agrobacterium suspension (OD660=0.3, infecting medium (N6 salt, N6 vitamin, casein 300 mg/L, sucrose 30 g/L, glucose 10 g/L, acetosyringone) (AS) 40 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 2 mg/L, pH 5.4)) to initiate infection. The callus was co-cultured with Agrobacterium for a period of time (3 days) (Step 3: co-cultivation step). Preferably, the callus is in a solid medium (N6 salt, N6 vitamin, casein 300 mg/L, sucrose 30 g/L, glucose 10 g/L, acetosyringone (AS) 40 mg/L, 2 after the infection step). 4-Dichlorophenoxyacetic acid (2,4-D) 2 mg/L, plant gel 3 g/L, pH 5.8). After this co-cultivation phase, there is a "recovery" step. In the "recovery" step, restore the medium (N6 salt, N6 vitamins, casein 300mg / L, sucrose 30g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 2mg / L, plant condensation At least one kind of glue 3g/L, pH 5.8) Antibiotics (cephalosporins) which inhibit the growth of Agrobacterium are known, and no selection agent for plant transformants is added (step 4: recovery step). Preferably, the callus is cultured on a solid medium with antibiotics but no selection agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated callus is cultured on a medium containing a selective agent (mannose) and the grown transformed callus is selected (step 5: selection step). Preferably, the callus is in a selective solid medium (N6 salt, N6 vitamin, casein 300 mg/L, sucrose 10 g/L, mannose 10 g/L, 2,4-dichlorophenoxyacetic acid (2). , 4-D) 2 mg / L, plant gel 3 g / L, pH 5.8) culture, resulting in selective growth of transformed cells. Then, the callus regenerates the plant (step 6: regeneration step), preferably, the callus grown on the medium containing the selection agent is cultured on a solid medium (N6 differentiation medium and MS rooting medium) Recycled plants.

The selected resistant callus was transferred to the N6 differentiation medium (N6 salt, N6 vitamin, casein 300 mg/L, sucrose 20 g/L, 6-benzylaminoadenine 2 mg/L, nafacetic acid 1 mg/L, Plant gel 3g/L, pH 5.8) was cultured and differentiated at 25 °C. The differentiated seedlings were transferred to the MS rooting medium (MS salt, MS vitamin, casein 300 mg/L, sucrose 15 g/L, plant gel 3 g/L, pH 5.8), and cultured at 25 ° C to about 10 cm. High, moved to the greenhouse to grow to firm. In a greenhouse, culture is carried out at 30 ° C per day.

2. TaqMan was used to verify the rice plants transferred into the Cry1A gene.

Rice plants transformed with the Cry1Ab-01 nucleotide sequence, rice plants transfected with the Cry1Ab-02 nucleotide sequence, rice plants transfected with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to the Cry1A.105 nucleoside The acid sequence of the rice plant and the leaves of the rice plant transformed with the Cry1A.105-Cry2Ab nucleotide sequence were used as samples. The genomic DNA was extracted with Qiagen's DNeasy Plant Maxi Kit, and the Cry1A gene was detected by Taqman probe fluorescent quantitative PCR. , the copy number of the Vip3Aa gene and the Cry2Ab gene. At the same time, the wild type rice plants were used as a control, and the detection and analysis were carried out according to the method of verifying the corn plants transferred to the Cry1A gene by TaqMan in the above third embodiment. The experiment was set to repeat 3 times and averaged.

The results showed that the Cry1Ab-01 nucleotide sequence, Cry1Ab-02 nucleotide sequence, Cry1Ab-01-Vp3Aa nucleotide sequence, Cry1A.105 nucleotide sequence and Cry1A.105-Cry2Ab nucleotide sequence were integrated. To the rice genome of the tested rice plant, and the rice plant transformed into the Cry1Ab-01 nucleotide sequence, the rice plant transformed into the Cry1Ab-02 nucleotide sequence, and the Cry1Ab-01-Vip3Aa nucleotide sequence. Transgenic rice plants containing a single copy of the Cry1A gene, the Vip3Aa gene and/or the Cry2Ab gene were obtained from rice plants, rice plants transformed with the Cry1A.105 nucleotide sequence, and rice plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence. .

Sixth embodiment, detection of insect resistance of transgenic rice plants

A rice plant transformed into a Cry1Ab-01 nucleotide sequence, a rice plant transformed into a Cry1Ab-02 nucleotide sequence, a rice plant transformed into a Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to a Cry1A.105 nucleotide Sequence of rice plants, rice plants transformed into Cry1A.105-Cry2Ab nucleotide sequence, wild type rice plants and non-transformed by Taqman The rice plants of the gene tested the insect resistance of the giant salamander.

Rice plants transformed with the Cry1Ab-01 nucleotide sequence, rice plants transfected with the Cry1Ab-02 nucleotide sequence, rice plants transfected with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to the Cry1A.105 nucleoside Rice plants with acid sequence, rice plants transfected with Cry1A.105-Cry2Ab nucleotide sequence, wild type rice plants and fresh leaves of rice plants identified as non-transgenic by Taqman (tillering stage), rinsed with sterile water and used The gauze sucks the water on the leaves, then removes the veins of the rice leaves, and cuts into strips of about 1 cm × 4 cm. Take a piece of the cut strips into the filter paper on the bottom of the round plastic dish. The filter paper is wetted with distilled water, and 10 artificially reared cockroaches (initial hatching larvae) are placed in each petri dish, and the temperature is 26-28 ° C and the relative humidity is 70%-80% after the worm test dish is capped. After 3 days of photoperiod (light/dark) 16:8, the total score of resistance was obtained according to the three indicators of development progress, mortality and leaf damage rate of the larvae: total score = 100 × mortality + [100 × mortality + 90 × (number of initial hatching / total number of insects) + 60 × (number of initial hatching - negative control insects / Total worm) + 10 × (number of negative control insects / the total insect)] + 100 × (1- leaf damage rate). A total of 3 lines (S16, S17 and S18) transfected into the Cry1Ab-01 nucleotide sequence were transferred into the Cry1Ab-02 nucleotide sequence (S19, S20 and S21) and transferred to Cry1Ab- A total of 3 strains (S22, S23 and S24) of the nucleotide sequence of 01-Vip3Aa were transferred into Cry1A.105 nucleotide sequence of 3 lines (S25, S26 and S27) and transferred to Cry1A.105- A total of 3 strains of the Cry2Ab nucleotide sequence (S28, S29 and S30), identified by Taqman as a non-transgenic (NGM2) strain, and a wild-type (CK2) a total of 1 strain; Three strains of the strain were selected for testing, and each plant was repeated 6 times. The results are shown in Table 2 and Figure 4.

Table 2. Results of insect resistance test of inoculated cockroaches in transgenic rice plants

The results in Table 2 indicate that a rice plant transformed with the Cry1Ab-01 nucleotide sequence, a rice plant transformed with the Cry1Ab-02 nucleotide sequence, a rice plant transformed with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to Cry1A The total scores of the .105 nucleotide sequence of rice plants and the rice plants transferred to the Cry1A.105-Cry2Ab nucleotide sequence were all around 260 points or more; and the non-transgenic rice plants and wild type identified by Taqman were identified. The total score of the rice plants is generally around 60 points.

The results in Figure 4 indicate that a rice plant transformed with the Cry1Ab-01 nucleotide sequence, a rice plant transformed with the Cry1Ab-02 nucleotide sequence, and a Cry1Ab-01-Vip3Aa nucleotide were transferred to the wild type rice plant. Sequence rice plants, rice plants transferred to the Cry1A.105 nucleotide sequence, and rice plants transformed into the Cry1A.105-Cry2Ab nucleotide sequence can cause a large number of deaths of the newly hatched larvae and develop a small number of surviving larvae. The progress was greatly inhibited. After 3 days, the larvae were still in the initial incubation state, and the rice plants transferred to the Cry1Ab-01 nucleotide sequence, the rice plants transferred to the Cry1Ab-02 nucleotide sequence, and transferred to Cry1Ab-01- Rice plants with the Vip3Aa nucleotide sequence, rice plants transferred to the Cry1A.105 nucleotide sequence, and rice plants transfected with the Cry1A.105-Cry2Ab nucleotide sequence were only slightly damaged, and only a few needles were present on the leaves. For the hole-like damage, the leaf damage rate is 5% or less.

This confirmed that the rice plant transformed into the Cry1Ab-01 nucleotide sequence, the rice plant transformed into the Cry1Ab-02 nucleotide sequence, the rice plant transformed into the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred into the Cry1A.105 core. The rice plants of the nucleotide sequence and the rice plants transformed into the nucleotide sequence of the Cry1A.105-Cry2Ab showed high activity against cockroaches, which was sufficient to exert an adverse effect on the growth of the cockroach and thereby control it.

The above experimental results also showed that the maize plant transformed with the Cry1Ab-01 nucleotide sequence, the maize plant transformed with the Cry1Ab-02 nucleotide sequence, the maize plant transformed with the Cry1Ab-01-Vip3Aa nucleotide sequence, and transferred to Cry1A. Maize plant with 105 nucleotide sequence, maize plant transferred into Cry1A.105-Cry2Ab nucleotide sequence, transferred into Cry1Ab-01 nucleus Rice plants with a nucleotide sequence, rice plants transfected with the Cry1Ab-02 nucleotide sequence, rice plants transfected with the Cry1Ab-01-Vip3Aa nucleotide sequence, rice plants transferred to the Cry1A.105 nucleotide sequence, and transferred into The control of the rice plant of the Cry1A.105-Cry2Ab nucleotide sequence against the cockroach is apparently because the plant itself can produce the Cry1A protein, so it is well known to those skilled in the art that the same toxic effect of the Cry1A protein on the cockroach can be produced. Similar transgenic plants expressing the Cry1A protein can be used to control the damage of the giant salamander. The Cry1A protein in the present application includes, but is not limited to, the Cry1A protein of the amino acid sequence given in the specific embodiment, and the transgenic plant can also produce at least one second insecticidal protein different from the Cry1A protein, such as Vip3A protein or Cry2Ab protein. .

In summary, the method for controlling pests of the present invention controls the cockroach pest by producing a Cry1A protein capable of killing the cockroach in the plant; compared with the agricultural control method, the chemical control method and the biological control method used in the prior art, Apply for the protection of plants during the whole growth period and whole plants to prevent the infestation of giant insect pests, and no pollution, no residue, stable, thorough, simple, convenient and economical.

It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application and are not intended to be limiting, although the present application is described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technology of the present application can be applied. Modifications or equivalents are made without departing from the spirit and scope of the technical solutions of the present application.

Claims (19)

1. A method of controlling a pest of the cockroach, wherein the cockroach pest is in contact with the Cry1A protein.
2. The method of controlling cockroach pests according to claim 1, wherein the Cry1A protein is a Cry1Ab protein, a Cry1Ac protein or a Cry1A.105 protein.
3. The method for controlling a cockroach pest according to claim 2, wherein the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein is present in a plant cell producing the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein, respectively, The giant salamander is in contact with the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein by ingesting the plant cell.
4. The method for controlling a cockroach pest according to claim 3, wherein the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein is present in a transgenic plant producing the Cry1Ab protein, Cry1Ac protein or Cry1A.105 protein, respectively, The cockroach pest is contacted with the Cry1Ab protein, the Cry1Ac protein or the Cry1A.105 protein by ingesting the tissue of the transgenic plant, and the growth of the cockroach pest is inhibited and/or contacted after the contact, thereby causing the cockroach pest to die. Realize the control of plants that are harmful to the earthworms.
5. A method of controlling a pest of the cockroach according to claim 4, wherein said transgenic plant can be in any growth period.
6. The method of controlling cockroach pests according to claim 4, wherein the tissue of the transgenic plant is selected from the group consisting of a leaf, a stem, a fruit, a tassel, an ear, an anther, and a filament.
7. The method of controlling cockroach pests according to claim 4, wherein the control of the cockroach-damaged plant is not changed by the change of the planting site and/or the planting time.
8. The method for controlling cockroach pests according to any one of claims 3 to 7, wherein the plant is selected from the group consisting of corn, rice, sorghum, wheat, millet, cotton, reed, sugar cane, alfalfa, broad bean or canola, preferably, The plant is selected from the group consisting of corn or rice.
9. The method of controlling cockroach pests according to any one of claims 1 to 7, wherein the step prior to the contacting step is planting a plant containing a polynucleotide encoding the Cry1A protein.
10. The method for controlling a cockroach pest according to any one of claims 1 to 9, wherein the amino acid sequence of the Cry1A protein has: 1) SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 Amino acid sequence, 2) an amino acid sequence having at least 70% homology to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and having insecticidal activity against Euphorbia, or 3) SEQ ID NO: 1. An amino acid sequence obtained by substituting, deleting and/or adding one or more amino acid residues of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3 and having insecticidal activity against Euphorbia.
11. The method for controlling a cockroach pest according to claim 10, wherein the nucleotide sequence encoding the Cry1A protein has: 1) a nucleus represented by SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: a nucleotide sequence, 2) a nucleotide sequence having at least about 75% homology to SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and encoding an amino acid sequence having insecticidal activity against Euphorbia, 3) a nucleotide sequence which hybridizes under stringent conditions to SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and which encodes an amino acid sequence having insecticidal activity against Euphorbia, 4) due to codon degeneracy A nucleotide sequence which is different from SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 which encodes an amino acid sequence having insecticidal activity against Euphorbia.
12. The method of controlling a cockroach pest according to any one of claims 3 to 11, wherein the plant further comprises at least one second nucleotide different from the nucleotide encoding the Cry1A protein.
13. The method of controlling cockroach pests according to claim 12, wherein said second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, a lectin, an α-amylase or a peroxidation. Enzyme.
14. The method of controlling a pest of the cockroach according to claim 13, wherein the second nucleotide encodes a Vip3A protein or a Cry2Ab protein.
15. The method of controlling a pest of the cockroach according to claim 14, wherein the second nucleotide has the nucleotide sequence shown by SEQ ID NO: 7 or SEQ ID NO: 8.
16. The method of controlling cockroach pests according to claim 12, wherein said second nucleotide is a dsRNA which inhibits an important gene in a target insect pest.
17. A method of preparing a plant cell, a transgenic plant, or a portion of a transgenic plant that controls a pest of the cockroach pest, comprising introducing a coding nucleotide sequence of the Cry1A protein into the plant cell, the transgenic plant, or a portion of the transgenic plant, preferably, The coding nucleotide sequence of the Cry1A protein is introduced into the genome of a part of the plant cell, transgenic plant or transgenic plant.
18. Use of the Cry1A protein in the preparation of a plant cell, transgenic plant or part of a transgenic plant that controls a pest.
19. A method of cultivating a plant for controlling a pest of the cockroach, comprising:

    Planting at least one plant seed, the genome of the plant seed comprising a polynucleotide sequence encoding a Cry1A protein;

    Planting the plant seed into a plant;

    The plants are grown under conditions in which the artificial inoculation of the giant salamander pests and/or the giant salamander pests are naturally harmful, and the plants are harvested with reduced plant damage and/or have a yield compared to other plants not having the polynucleotide sequence encoding the Cry1A protein. Increased plant yield of plants.

Images