CN103725696B - Killing gene and uses thereof - Google Patents

Abstract

Does the present invention relates to a kind of killing gene and uses thereof, the nucleotide sequence of described killing gene comprise: (a) have SEQ? ID? nucleotide sequence shown in NO:1; not be not or nucleotide sequence isocoding (b) and (a), and SEQ? ID? NO:5; Or (c) under stringent condition, there is the nucleotide sequence of the protein of insecticidal activity with the nucleotide sequence hybridization (a) or (b) limiting and coding. Killing gene of the present invention is particularly suitable for expressing in monocotyledon, especially paddy rice, not only significantly improve expression and the stability of PIC1-01 insecticidal proteins, but also significantly strengthened the virulence of PIC1-01 insecticidal proteins to insect pest, especially lepidopterous insects insect.

Description

Killing gene and uses thereof

Technical field

The present invention relates to a kind of killing gene and uses thereof, particularly relate to a kind of PIC1-01 desinsection of transformationGene and uses thereof.

Background technology

Insect pest of the plant is the principal element that causes crop loss, causes great economic loss to peasant,Even have influence on the survival state of local population. In order to prevent and treat insect pest of the plant, people use wide spectrum conventionallyLearn pesticide and Biocidal preparation, but the two all has limitation in actual applications: chemical insecticideCan bring the problem of environmental pollution, and cause the appearance of resistance to the action of a drug insect; And Biocidal preparation is at environmentIn easily degraded, produce on need repetitive administration, greatly increased production cost.

In order to solve chemical insecticide and Biocidal preparation limitation in actual applications, scientistsFind the anti insect gene of encoding insecticidal proteins to proceed in plant through research, can obtain some pest-resistant bases that turnBecause plant is with control insect pest of the plant. PIC1 insecticidal proteins is the one in numerous insecticidal proteins, is insolubleCompanion's spore crystalline protein.

PIC1 albumen is taken in and is entered middle intestines by insect, and toxalbumin parent toxin is dissolved in the alkalescence of insect midgutUnder environment. Albumen N-and C-end, by basic protein enzymic digestion, are transformed into active fragment by parent toxin;Receptors bind on active fragment and insect midgut epithelial cell membrane upper surface, inserts goldbeater's skin, causes cell membraneThere is perforation focus, destroy cell membrane inside and outside osmotic pressure variation and pH balance etc., upset disappearing of insectChange process, finally causes its death.

Paddy rice is the main cereal crops of China, and the grain loss causing because of insect pest of the plant is every year huge, exampleAs striped rice borer, yellow rice borer, east armyworm or pink rice borer etc. Prove that PIC1 albumen can keep out multiple squamaThe infringement of homopterous insect insect (as striped rice borer, pink rice borer etc.), and rarely have at present according to the preference of plant closeResearch, especially pin that the amino acid of numeral to PIC1 insecticidal proteins and/or nucleotide sequence are transformedTo monocotyledon (as paddy rice) to improve its expression and effect in plant.

Summary of the invention

The object of this invention is to provide a kind of killing gene and uses thereof, it is the preference codon according to paddy riceAnd the Optimizing Reconstruction carrying out has PIC1-01 insecticidal proteins (being especially paddy rice) in plantHigh expression and virulence.

For achieving the above object, the invention provides a kind of killing gene, its nucleotide sequence comprises:

(a) there is the nucleotide sequence shown in SEQIDNO:1; Or

(b) nucleotide sequence isocoding and (a), and be not SEQIDNO:5; Or

(c) under stringent condition with (a) or (b), nucleotide sequence hybridization and the coding of restriction have desinsectionThe nucleotide sequence of active protein.

Described stringent condition can be the natrium citricum at 6 × SSC(), 0.5%SDS(lauryl sodium sulfate)In solution, at 65 DEG C, hybridization, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film1 time.

For achieving the above object, the present invention also provides a kind of expression cassette, is included in the regulation and control order of effective connectionDescribed killing gene under row regulation and control.

For achieving the above object, the present invention also provides a kind of described killing gene or described expression cassette of comprisingRecombinant vector.

For achieving the above object, the present invention also provides a kind of method that produces insect-killing protein, comprising:

The cell of the transformed host biology that acquisition comprises described killing gene or described expression cassette;

Under the condition that allows to produce insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

Further, described transformed host biology comprise plant cell, zooblast, bacterium, yeast,Baculoviral, nematode or algae.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

For achieving the above object, the present invention also provides a kind of method for increasing insect target scope, comprising:By the insect-killing protein of the insect-killing protein of described killing gene coding or described expression cassette coding in plant withAt least one is different from the insect-killing protein of described killing gene coding or the insecticidal proteins of described expression cassette codingThe second desinsection nucleotides of matter is expressed together.

Further, can encode Cry class insect-killing protein, Vip class desinsection of described the second desinsection nucleotidesProtein, protease inhibitors, agglutinin, AMS or peroxidase.

Selectively, described the second desinsection nucleotides is to suppress important gene in targeted insect insectdsRNA。

In the present invention, the expression of PIC1-01 insecticidal proteins in a kind of genetically modified plants can be accompanied by oneThe expression of individual or multiple Cry class insect-killing proteins and/or Vip class insect-killing protein. Thisly exceed a kind of killingWorm toxin co expression in same strain genetically modified plants can comprise plant and be expressed institute by genetic engineeringThe gene needing is realized. In addition, a Plants (the 1st parent) can be expressed PIC1-01 by genetic engineering procedureInsecticidal proteins, the second plant (the 2nd parent) can be expressed Cry class desinsection egg by genetic engineering procedureWhite matter and/or Vip class insect-killing protein. Hybridize to obtain to express by the 1st parent and the 2nd parent and introduce the 1stThe progeny plants of all genes of parent and the 2nd parent.

RNA disturb (RNAinterference, RNAi) refer to high conservative during evolution, byDouble-stranded RNA (double-strandedRNA, dsRNA) brings out, the efficient specificity of homologous mRNA is fallenThe phenomenon of separating. Therefore can use RNAi technology specific depletion or close the expression of specific gene.

For achieving the above object, the present invention also provides a kind of method that produces zoophobous, comprising: by instituteState killing gene or described expression cassette or described recombinant vector and import plant.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

For achieving the above object, the present invention also provides one to avoid being caused by insect pest for the protection of plantThe method of damage, comprising: described killing gene or described expression cassette or described recombinant vector are imported to plant,Make the plant generation after importing enough protect it to avoid the insect-killing protein of insect pest infringement amount.

Preferably, described plant is corn, soybean, cotton, paddy rice or wheat.

Described killing gene or described expression cassette or described recombinant vector are imported to plant, in the present inventionFor foreign DNA is imported to plant cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion,The DNA that protoplast, electroporation or silicon whisker mediation are bombarded, directly DNA taken in trace transmitting imports.

For achieving the above object, the present invention also provides a kind of method of controlling insect pest, comprising: make elder brotherInsect pest worm contacts with the insect repressible protein of being encoded by described killing gene of amount of suppression.

Preferably, described insect pest is lepidopterous insects insect.

For achieving the above object, the present invention also provides a kind of insect inhibition of being encoded by described killing geneThe purposes of protein control insect pest.

The genome of the plant described in the present invention, plant tissue or plant cell, refers to plant, plant groupKnit or plant cell in any inhereditary material, and comprise nucleus and plastid and mitochondrial genomes.

Polynucleotides described in the present invention and/or nucleotides form complete " gene ", in required host cellCoded protein or polypeptide. Those skilled in the art are easy to recognize, can be by polynucleotides of the present inventionAnd/or nucleotides is placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form. In this arrangement,, chain and another chain complementation, vice versa. Because DNA copies its that has produced DNA in plantIts complementary strand. Like this, the present invention includes polynucleotides to example in sequence table and the use of complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand. For marking protein in vivo, typical case willA chain of DNA is transcribed into the complementary strand of a mRNA, and it translates protein as template. MRNABe actually from " antisense " chain of DNA and transcribe. " there is justice " or " coding " chain has a series of codon (codonsBe three nucleotides, once read three and can produce specific amino acids), it can be used as ORFs (ORF)Read and form destination protein matter or peptide. The present invention also comprises the RNA that has suitable function with the DNA of exampleWith PNA(peptide nucleic acid).

Amplifying nucleic acid molecule of the present invention or its fragment are hybridized with killing gene of the present invention under stringent condition. Any routineNucleic acid hybridization or amplification method may be used to identify the existence of killing gene of the present invention. Nucleic acid molecules or its sheetUnder Duan Yi stable condition, can carry out specific hybrid with other nucleic acid molecules. In the present invention, if two nucleic acidMolecular energy forms antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecules can carry out spy to each otherOpposite sex hybridization. If two nucleic acid molecules demonstrate complementarity completely, claim that one of them nucleic acid molecules is another" complement " of a nucleic acid molecules. In the present invention, when each nucleotides and another of a nucleic acid moleculesWhen the corresponding nucleotides of individual nucleic acid molecules is complementary, claim these two nucleic acid molecules to demonstrate " complete complementary ". AsThereby two nucleic acid molecules of fruit can make them with enough stability phase mutual crosses, at least conventional, " minuent is tightLattice " annealing and being bonded to each other under condition, claim these two nucleic acid molecules for " minimum level complementation ". Similarly, asThereby two nucleic acid molecules of fruit can make their " highly strict " bars in routine with enough stability phase mutual crossesUnder part, anneal and be bonded to each other, claiming these two nucleic acid molecules to there is " complementarity ". From complete complementary, depart fromCan allow, depart from two molecules of incomplete prevention as long as this and form duplex structure. In order to make a coreAcid molecule can be served as primer or probe, only needs to ensure that it has sufficient complementarity in sequence, to makeUnder the specific solvent adopting and salinity, can form stable duplex structure.

In the present invention, the sequence of basic homology is one section of nucleic acid molecules, and this nucleic acid molecules is at height stringent conditionDown can with the complementary strand generation specific hybrid of another section of nucleic acid molecules matching. Promote what DNA was hybridizedApplicable stringent condition for example, is located by 6.0 × sodium chloride/sodium citrate (SSC) greatly under 45 DEG C of conditionsReason is then washed with 2.0 × SSC under 50 DEG C of conditions, and these conditions are known to those skilled in the art.For example, the salinity in washing step can be selected from low stringent condition approximately 2.0 × SSC, 50 DEG C are to heightApproximately 0.2 × the SSC of stringent condition, 50 DEG C. In addition, the temperature conditions in washing step can be from the strict bar of minuentApproximately 22 DEG C of the room temperatures of part, are elevated to height approximately 65 DEG C of stringent condition. Temperature conditions and salinity can be allChange, also can one of them remain unchanged and another variable changes. Preferably, the present inventionDescribed stringent condition can be in 6 × SSC, 0.5%SDS solution, at 65 DEG C, occurs with SEQIDNO:1Specific hybrid, then uses 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, there is anti-insect activity and the sequence of hybridizing with sequence 1 of the present invention is included in this under stringent conditionIn invention. These sequences and sequence of the present invention be 40%-50% homology at least approximately, and about 60%, 65% or 70%Homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%,96%, 97%, 98%, 99% or more homology. The scope that is sequence homogeneity is distributed at least about40%-50%, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

" fragment " or " brachymemma " of the DNA molecular described in the present invention or protein sequence refer to relate to originalA part or its artificial reconstructed form of DNA or protein sequence (nucleotides or amino acid) (are for example applicable to plantingThe sequence that thing is expressed), can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) albumenMatter is insect toxins.

When the polypeptide of nucleic acid sequence encoding with have identical amino acid sequence with reference to the polypeptide of nucleic acid sequence encodingTime, this nucleotide sequence be " isocoding " of the present invention with reference to nucleotide sequence.

Regulating and controlling sequence described in the present invention includes but not limited to promoter, transit peptides, terminator, enhancer,Targeting sequencing, introne and other are operably connected to the adjusting sequence of described killing gene.

Described promoter is effable promoter in plant, and described " effable promoter in plant " refers toGuarantee the promoter that connected coded sequence is expressed in plant cell. Effable opening in plantMover can be constitutive promoter. Instruct the example of the promoter of constitutive expression in plant to include but not limited to,Derive from 35S promoter, the ubi promoter of maize of cauliflower mosaic virus, the startup of paddy rice GOS2 geneSon etc. Alternatively, in plant, effable promoter can be tissue-specific promoter, and this promoter existsSome tissues of plant are interior as instructed the expression of coded sequence higher than other groups of plant in chlorenchymaKnit (can measure by conventional RNA test), as PEP carboxylase promoter. Alternatively, in plantEffable promoter can be wound-induced promoter. Wound-induced promoter or instruct the expression of wound-inducedThe promoter of pattern refers in the time that plant is stood machinery or gnaws by insect the wound causing, under promoter regulationThe expression compared with normal growth conditions of coded sequence under be significantly increased. The example of wound-induced promoter comprisesBut be not limited to, the protease suppressor (pin I and pin II) of potato and tomato and zein enzyme press downThe promoter of gene processed (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specificallyOrganelle or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, profitWith coding chloroplast transit peptide sequence target chloroplaset, or utilize ' KDEL ' reservation queue target endoplasmic reticulum,Or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described targeting sequencing including but not limited to, picornavirus targeting sequencing, as EMCV targeting sequencing(encephalomyocarditis virus 5 ' noncoding region); Potyvirus group targeting sequencing, as short in MDMV(cornContracting mosaic virus) targeting sequencing; Human immunoglobulin matter heavy chain conjugated protein (BiP); Lucerne flowers and leavesThe coat protein mRNA of virus does not translate targeting sequencing (AMVRNA4); Tobacco mosaic virus (TMV)(TMV) targeting sequencing.

Described enhancer including but not limited to, cauliflower mosaic virus (CaMV) enhancer, radix scrophulariae mosaic diseasePoison (FMV) enhancer, carnation weathering circovirus virus (CERV) enhancer, cassava vein mosaic virus (CsVMV)Enhancer, Mirabilis jalapa mosaic virus (MMV) enhancer, dama de noche tomato yellow leaf curl China virus (CmYLCV)Enhancer, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) andPeanut chlorisis streak mosaic virus (PCLSV) enhancer.

For monocotyledon application, described introne including but not limited to, corn hsp70 introne,Corn ubiquitin introne, Adh introne 1, sucrose synthase introne or paddy rice Act1 introne. For twoCotyledon plant application, described introne including but not limited to, CAT-1 introne, pKANNIBALIntrone, PIV2 introne and " super ubiquitin " introne.

Described terminator can be the applicable polyadenylation signal sequence that works in plant, comprise butBe not limited to, derive from Agrobacterium (Agrobacteriumtumefaciens) rouge alkali synthetase (NOS) baseThe polyadenylation signal sequence of cause, derive from the poly adenosine of protease inhibitors II (pin II) geneAcidifying burst, derive from pea ssRUBISCOE9 gene polyadenylation signal sequence and comeCome from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection can be put forward a sequenceFor the function needing concerning the sequence that is connected. Described " effectively connecting " can be by promoter and sense in the present inventionThe sequence of interest is connected, and makes transcribing of this interested sequence be subject to this promoter control and regulation and control. Work as senseThe sequential coding albumen of interest and while going for the expression of this albumen " effectively connecting " represent: promoter and instituteState sequence and be connected, connected mode is efficiently translated the transcript obtaining. If promoter and coded sequenceConnection be transcript when merging and wanting to realize the expression of albumen of coding, manufacture such connection, makeIn the transcript that must obtain, the first translation initiation codon is the initiation codon of coded sequence. Alternatively, asWhen fruit promoter is translation fusion and the expression of albumen of wanting realization coding with being connected of coded sequence, systemMake such connection, the first translation initiation codon containing in 5 ' non-translated sequence is connected with promoterKnot, and connected mode makes the translation opening code-reading frame of albumen that the translation product that obtains and coding wantRelation meets reading frame. The nucleotide sequence that can " effectively connect " includes but not limited to: gene expression is providedThe sequence of function (be gene expression element, for example promoter, 5 ' untranslated region, introne, encoding histoneRegion, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), provide DNA to shift and/orThe sequence of integration function (is T-DNA border sequence, site-specific recombinase recognition site, integrase knowledgeOther site), provide selectivity function sequence (being antibiotic resistance markers, biosynthesis gene),It (is polylinker order that the sequence of the label function of can scoring, sequence external or the interior assistance of body series of operations are providedRow, locus specificity recombination sequence) and the sequence of copy function is provided (is the origin of replication of bacterium, independentlyReplication sequence, centromeric sequence).

It is poisonous that " desinsection " described in the present invention refers to crop pests. More specifically, targeted insect isInsect, such as, but not limited to, most of lepidoptera pest, as corn borer, yellow rice borer, east armyworm,Striped rice borer or pink rice borer etc.

In the present invention, described killing gene is PIC1-01 gene order, as SEQ ID NO:1Shown in. Described killing gene is for plant, particularly corn transform DNA sequence dna, except comprise byOutside the code area of the protein of PIC1-01 gene order coding, also can comprise other elements, for example coding transhipmentThe code area of code area, the protein of codes selection mark or the protein of conferring herbicide resistance of peptide.

In the present invention, PIC1-01 gene order has toxicity to most of lepidoptera pests of harm corn. ThisPlant in invention, particularly corn contain foreign DNA in its genome, described foreign DNA bagContaining PIC1-01 gene order, protect its threat of avoiding insect or control by this albumen of expression inhibiting amountInsect. Amount of suppression refers to lethal or semilethal dosage. Meanwhile, plant should be normal in form,And can under conventional method, cultivate consumption and/or the generation for product. In addition, this plant can be eliminated substantially(described chemistry or biological insecticides are for by PIC1-01 gene order for needs to chemistry or biological insecticidesThe pesticide of the insect of the protein institute target of coding).

The expression of insecticidal crystal protein in vegetable material (ICP) can be by described multiple in this areaMethod detects, for example by application special primer to organizing the coded insect-killing protein of interior generationMRNA carries out quantitatively, or the amount of the insect-killing protein that directly specific detection produces.

Can apply the insecticidal effect of ICP in different test determination plants. In the present invention, targeted insect is mainFor lepidoptera pest, be more specifically pink rice borer or striped rice borer etc.

In addition the expression cassette that, comprises killing gene of the present invention (PIC1-01 gene) sequence is all right in plantWith at least one coding herbicide resistance gene protein together with express, described herbicide resistance gene comprisesBut be not limited to, phosphine oxamate resistant gene (as bar gene, pat gene), phenmedipham resistant gene are (as pmphGene), glyphosate resistance gene (as EPSPS gene), Brominal (bromoxynil) resistant gene,Sulfonylureas resistant gene, the resistant gene to herbicide Dalapon, resistant gene or the glutamine to cyanamideThe resistant gene of synthetase inhibitors (as PPT), had not only had high insecticidal activity, but also has and remove thereby obtainThe genetically modified plants of grass agent resistance.

The invention provides a kind of killing gene and uses thereof, have the following advantages:

1, expression is high. Killing gene PIC1-01 of the present invention is that preference codon according to paddy rice is to desinsectionThe optimization that protein PIC1-01 carries out, has removed simultaneously the unsettled sequence of mRNA, PolyA is addedTail signal and introne are sheared similar site, and have improved GC content, meet the spy of paddy gene completelyProperty, make killing gene of the present invention be particularly suitable for expressing in monocotyledon, especially corn, its tableHigh and the good stability of the amount of reaching.

2, virulence is strong. Killing gene PIC1-01 of the present invention is that preference codon according to paddy rice is to desinsection eggThe optimization that white matter PIC1-01 carries out, has removed simultaneously and has made the unsettled sequence of mRNA, PolyA tailingSignal and introne are sheared similar site, and have improved GC content, make killing gene of the present invention not onlyBe particularly suitable for expressing in monocotyledon, especially paddy rice, kills but also significantly strengthened PIC1-01The virulence of worm albumen to insect pest, especially lepidopterous insects insect.

3, insecticidal spectrum is wide. Insect-killing protein PIC1-01 albumen of the present invention not only shows higher to striped rice borerResistance, and pink rice borer is also had to higher activity, therefore on plant, have a extensive future.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Brief description of the drawings

Fig. 1 is that the recombinant clone that contains PIC1-01 nucleotide sequence of killing gene of the present invention and uses thereof carriesBody DBN01-T builds flow chart;

Fig. 2 is contain PIC1-01 nucleotide sequence recombinant expressed year of killing gene of the present invention and uses thereofBody DBN100074 builds flow chart;

Fig. 3 is the pest-resistant effect of the transgenic rice plant inoculation striped rice borer of killing gene of the present invention and uses thereofFigure;

Fig. 4 is the pest-resistant design sketch of the transgenic rice plant inoculation pink rice borer of killing gene of the present invention and uses thereof.

Detailed description of the invention

Further illustrate the technical scheme of killing gene of the present invention and uses thereof below by specific embodiment.

Synthesizing of the first embodiment, PIC1 gene

Obtain killing gene PIC1-01 of the present invention, its nucleotide sequence is as shown in SEQ ID NO:1;Described PIC1-01 nucleotide sequence (as shown in SEQ ID NO:1) is by Nanjing Jin Sirui biologyScience and Technology Ltd. is synthetic; 5 ' end of synthetic described PIC1-01 gene order (SEQIDNO:1) also connectsBe connected to NcoI restriction enzyme site, 3 ' end of described PIC1-01 gene order (SEQIDNO:1) is also connected withBamHI restriction enzyme site.

The structure of the second embodiment, recombinant expression carrier and recombinant expression carrier transform Agrobacterium

1, build the recombinant cloning vector DBN01-T that contains PIC1-01 nucleotide sequence

Synthetic PIC1-01 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison,USA, CAT:A3600) upper, operating procedure is pressed the explanation of the product pGEM-T of Promega company carrierBook carries out, and obtains recombinant cloning vector DBN01-T, and it builds flow process (wherein, Amp table as shown in Figure 1Show ampicillin resistance gene; F1 represents the origin of replication of bacteriophage f1; LacZ is LacZ initiation codonSon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promoter; PIC1-01 isPIC1-01 nucleotide sequence (SEQIDNO:1); MCS is MCS).

Then recombinant cloning vector DBN01-T is transformed to Escherichia coli T1 competent cell by heat shock method(Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l large intestine barsBacterium T1 competent cell, 10 μ l DNAs (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30Second; 37 DEG C of shaken cultivation 1 hour (shaking table shake under 100rpm rotating speed), scribble IPTG(on surface differentPropyl dithiocarbamate-β-D-galactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) ammonia benzylLB flat board (tryptone 10g/L, yeast extract 5g/L, the NaCl of penicillin (100 mg/litre)10g/L, agar 15g/L, with NaOH tune pH to 7.5) upper grow overnight. Picking white colony,LB fluid nutrient medium (tryptone 10g/L, yeast extract 5g/L, NaCl10g/L, ammonia benzyl mouldElement 100mg/L, with NaOH adjust pH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Alkaline process is carriedGet its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant, precipitation 100 μ l for thallineThe solution I (25mMTris-HCl, 10mMEDTA(ethylenediamine tetra-acetic acid) of ice precooling, 50mM PortugalGrape sugar, pH8.0) suspend; Add solution II (0.2MNaOH, the 1%SDS(ten of the new preparation of 200 μ lSodium dialkyl sulfate)), pipe is put upside down 4 times, mix, put 3-5min on ice; Add 150 μ l iceCold solution III (3M potassium acetate, 5M acetic acid), fully mixes immediately, places 5-10min on ice;Centrifugal 5min under 4 DEG C of temperature, rotating speed 12000rpm condition, in supernatant, add 2 times of volumes withoutWater-ethanol, mixes rear room temperature and places 5min; Centrifugal 5min under 4 DEG C of temperature, rotating speed 12000rpm condition,Abandon supernatant, after the ethanol washing that precipitation is 70% by concentration (V/V), dry; Add 30 μ l containing RNaseThe TE(10mMTris-HCl of (20 μ g/ml), 1mMEDTA, PH8.0) dissolution precipitation; Yu WenWater-bath 30min at spending 37 DEG C, digestion RNA; DEG C save backup in temperature-20.

The plasmid extracting is cut after qualification through XhoI and BamHI enzyme, and positive colony is carried out to sequence verification, knotFruit shows that the described PIC1-01 nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies as in sequence tableNucleotide sequence shown in SEQIDNO:1, PIC1-01 nucleotide sequence correctly inserts.

2, build the recombinant expression carrier DBN100074 that contains PIC1-01 nucleotide sequence

With restriction enzyme NcoI and BamHI respectively enzyme cut recombinant cloning vector DBN01-T and express and carryBody DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), will cutUnder PIC1-01 nucleotide sequence fragment be inserted into NcoI and the BamHI site of expression vector DBNBC-01Between, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, is built into restructuringExpression vector DBN100074, it builds flow process (Kan: kanamycin gene as shown in Figure 2; RB: the right sideBorder; Ubi: corn Ubiquitin(ubiquitin) gene promoter (SEQIDNO:2); PIC1-01:PIC1-01 nucleotide sequence (SEQIDNO:1); Nos: the terminator (SEQ of rouge alkali synthetase geneIDNO:3); PMI: Phophomannose isomerase gene (SEQIDNO:4); LB: left margin).

Recombinant expression carrier DBN100074 is transformed to Escherichia coli T1 competent cell by heat shock method, itsHot shock condition is: 50 μ l Escherichia coli T1 competent cells, 10 μ l DNA (recombinant expression carriersDBN100074), 42 DEG C of water-baths 30 seconds; 1 hour (shaking table under 100rpm rotating speed of 37 DEG C of shaken cultivationShake); Then at the LB solid plate (tryptone containing 50mg/L kanamycins (Kanamycin)10g/L, yeast extract 5g/L, NaCl10g/L, agar 15g/L, with NaOH tune pH to 7.5)Above under 37 DEG C of conditions of temperature, cultivate 12 hours, picking white colony, at LB fluid nutrient medium (pancreas eggWhite peptone 10g/L, yeast extract 5g/L, NaCl10g/L, kanamycins 50mg/L, adjusts with NaOHPH to 7.5) under 37 DEG C of conditions of temperature overnight incubation. Alkaline process extracts its plasmid. By the plasmid extractingCut rear qualification with restriction enzyme XhoI and BamHI enzyme, and by the positive colony qualification of checking order, knotFruit shows that the nucleotides sequence of recombinant expression carrier DBN100074 between NcoI and BamHI site classify sequence asNucleotide sequence shown in SEQIDNO:1 in table, i.e. PIC1-01 nucleotide sequence.

3, build the recombinant expression carrier DBN100074N(positive control that contains known array)

According to the recombinant clone that in second embodiment of the invention, the structure described in 1 contains PIC1-01 nucleotide sequenceThe method of carrier DBN01-T, utilizes known array (SEQIDNO:5) to build the weight that contains known arrayGroup cloning vector DBN01R-T. Positive colony is carried out to sequence verification, and result shows recombinant cloning vectorThe known array inserting in DBN01R-T is the nucleotide sequence shown in SEQ ID NO:5,Known array correctly inserts.

Contain the recombinant expressed of PIC1-01 nucleotide sequence according to the structure described in 2 in second embodiment of the inventionThe method of carrier DBN100074, utilizes known array to build the recombinant expression carrier that contains known arrayDBN100074N. Positive colony is carried out to sequence verification, and result shows recombinant expression carrier DBN100074NThe known array of middle insertion is the nucleotide sequence shown in SEQ ID NO:5, and known array justReally insert.

4, recombinant expression carrier transforms Agrobacterium

To oneself through building correct recombinant expression carrier DBN100074 and DBN100074N(known array)Be transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) by liquid nitrogen methodIn, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L DNAs (recombinant expression carrier);Be placed in liquid nitrogen 10 minutes, 37 DEG C of tepidarium 10 minutes; Agrobacterium LBA4404 after transforming is inoculated inIn LB test tube, be under 200rpm condition, to cultivate 2 hours in 28 DEG C of temperature, rotating speed, be applied to containing 50mg/L'sOn the LB flat board of the kanamycins (Kanamycin) of rifampin (Rifampicin) and 100mg/L untilGrow positive monoclonal, its plasmid is cultivated and extracted to picking monoclonal, with restriction enzyme XhoI and EcoRIEnzyme carries out enzyme after cutting and cuts checking, and result has shown recombinant expression carrier DBN100074 and DBN100074N(Know sequence) structure is entirely true.

The 3rd embodiment, proceed to acquisition and the checking of the rice plant of PIC1-01 nucleotide sequence

1, obtain the rice plant that proceeds to PIC1-01 gene order

The Agrobacterium infestation method adopting according to routine, by the fine callus of japonica rice variety Japan of sterile cultureCultivate altogether with the Agrobacterium described in 4 in the second embodiment, with by the second embodiment 2 and 3 build restructuringExpression vector DBN100074 and DBN100074N(known array) in T-DNA(comprise cornPromoter sequence, PIC1-01 nucleotide sequence, known array, PMI gene and the Nos of Ubiquitin geneTerminator sequence) be transferred in rice chromosome group, obtain the corn that proceeds to PIC1-01 nucleotide sequence and plantedStrain and proceed to the milpa (positive control) of known array; Simultaneously using wild type milpa as negative contrast.

For agriculture bacillus mediated rice conversion, briefly, rice paddy seed is seeded in to inducing culture (N6Salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L,Plant gel 3g/L, pH5.8) upper, induce callus (step 1: callus of induce from Mature Embryos of RiceStep), afterwards, preferably callus, contacts callus, wherein Agrobacterium energy with agrobacterium suspensionEnough PIC1-01 nucleotide sequence and/or known array are passed to at least one cell (step on callusRapid 2: infect step). In this step, callus preferably immerse agrobacterium suspension (OD660=0.3,Infect culture medium (N6 salt, N6 vitamin, casein 300mg/L, sucrose 30g/L, glucose 10g/L,Acetosyringone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, pH5.4)) inStartup is infected. Callus and Agrobacterium are cultivated one period (3 days) (step 3: incubation step altogether) altogether.Preferably, callus is infecting after step at solid medium (N6 salt, N6 vitamin, casein300mg/L, sucrose 30g/L, glucose 10g/L, acetosyringone (AS) 40mg/L, 2,4-dichloro-benzenesFluoroacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation. After this common cultivation stage,There is " recovery " step. In " recovery " step, recovery media (N6 salt, N6 vitamin, casein300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8)In at least exist a kind of oneself know the antibiotic (cephalosporin) that suppresses Agrobacterium growth, do not add Plant TransformationThe selective agent (step 4: recovering step) of body. Preferably, callus is having antibiotic but there is no selective agentSolid medium on cultivate, to eliminate Agrobacterium and to provide convalescence as infected cell. Then, inoculationThe transformed calli of growing is being cultivated and selected to callus containing on the culture medium of selective agent (mannose)(step 5: select step). Preferably, callus is having the screening solid medium (N6 of selective agentSalt, N6 vitamin, casein 300mg/L, sucrose 10g/L, mannose 10g/L, 2,4-Dichlorophenoxy secondAcid (2,4-D) 2mg/L, plant gel 3g/L, pH5.8) upper cultivation, cause the cell selective life transformingLong. Then, callus regeneration becomes plant (step 6: regeneration step), preferably, and containing selective agentThe callus of growing on culture medium is on solid medium (N6 differential medium and MS root media)Cultivate with aftergrowth.

The resistant calli that obtains of screening transfer to described N6 differential medium (N6 salt, N6 vitamin,Casein 300mg/L, sucrose 20g/L, 6-benzyl aminoadenine 2mg/L, naa 1mg/L, plant coagulateGlue 3g/L, pH5.8) upper, cultivate differentiation at 25 DEG C. Seedling out of differentiation is transferred to the described MS training of taking rootSupport base (MS salt, MS vitamin, casein 300mg/L, sucrose 15g/L, plant gel 3g/L, pH5.8)Upper, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid. In greenhouse, every day is in 30 DEG CLower cultivation.

2, proceed to the rice plant of PIC1-01 nucleotide sequence with TaqMan checking

Get respectively the rice plant that proceeds to PIC1-01 nucleotide sequence and the rice plant that proceeds to known arrayThe about 100mg of blade is as sample, extracts its genomic DNA with the DNeasyPlantMaxiKit of Qiagen,Detect the copy number of PIC1 gene by Taqman fluorescence probe quantitative PCR method. Simultaneously with wild type waterRice plants, as negative contrast, detects analysis according to the method described above. 3 repetitions are established in experiment, average.

The concrete grammar that detects PIC1 gene copy number is as follows:

Step 11, respectively get proceed to PIC1-01 nucleotide sequence rice plant, proceed to the water of known arrayThe each 100mg of blade of rice plants and wild type rice plant is ground into homogenate with liquid nitrogen respectively in mortar, everyIndividual sample is got 3 repetitions;

The DNeasyPlantMiniKit of step 12, use Qiagen extracts the genomic DNA of above-mentioned sample,Concrete grammar is with reference to its product description;

Step 13, with NanoDrop2000(ThermoScientific) measure the genomic DNA of above-mentioned sampleConcentration;

Step 14, adjust above-mentioned sample genomic DNA concentration to same concentration value, the model of described concentration valueEnclose the l for 80-100ng/ μ;

The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, to pass throughThe sample of qualification known copy number is as standard items, with the sample of wild type rice plant in contrast, each3 repetitions of sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting PIC1-01 nucleotide sequence:

Primer 1(CF1): TCGGCACAGTCTCCAGCTTC is as SEQ ID NO:6Shown in;

Primer 2 (CR1): CCACAGCTCACTGAGAATCCG is as SEQ ID NO:7Shown in;

Probe 1(CP1): CCTGAAGAAGGTCGGCTCGCTGATC is as SEQ IDShown in NO:8;

Following primer and probe are used for detecting known array:

Primer 3(CF2): CTCTACGCCAGCGGTTCC is as SEQ ID NO:9 instituteShow;

Primer 4(CR2): GGCTGTAGAGGAAGGGCCAG is as SEQ ID NO:10Shown in;

Probe 2(CP2): CCCACAGCAAACCCAGAGCTTCACC is as SEQ IDShown in NO:11;

PCR reaction system is:

The each 45 μ l of every kind of primer that described 50 × primer/probe mixture comprises 1mM concentration, 100 μ M concentrationProbe 50 μ l and 860 μ l1 × TE buffer solution, and at 4 DEG C, be housed in amber test tube.

PCR reaction condition is:

Utilize SDS2.3 software (AppliedBiosystems) to analyze data.

Experimental result shows, all oneself is incorporated into detected paddy rice and plants for PIC1-01 nucleotide sequence and known arrayIn the genome of strain, and proceed to the rice plant of PIC1-01 nucleotide sequence and proceed to the water of known arrayRice plants has all obtained the transgenic rice plant that contains single copy PIC1 gene.

The pest-resistant effect detection of the 4th embodiment, transgenic rice plant

The rice plant of PIC1-01 nucleotide sequence, the rice plant that proceeds to known array, wild type will be proceeded toRice plant and be accredited as not genetically modified rice plant (V3-V4 period) to striped rice borer and large through TaqmanSnout moth's larva carries out pest-resistant effect detection.

(1) striped rice borer: get respectively proceed to PIC1-01 nucleotide sequence rice plant, proceed to known arrayRice plant, wild type rice plant and be accredited as the fresh leaf of not genetically modified rice plant through TaqmanSheet, clean and the water on blade is blotted with gauze with aseptic water washing, then rice leaf is removed to vein,Be cut into the strip of about 1cm × 4cm simultaneously, get 1 strip blade after cutting and put into round plastic culture dishOn the filter paper of bottom, described filter paper is wetting with distilled water, puts two changes of 10 artificial feedings in each culture dishSnout moth's larva (newly hatched larvae), after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, lightUnder the condition of cycle (light/dark) 16:8, place after 3 days, according to Chilo spp larvae development progress, the death rateWith three indexs of blade injury rate, obtain resistance total score: total score=100 × death rate+[100 × death rate 90 × (justIncubate borer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer population/Connect worm sum)]+100 × (1-blade injury rate). Proceed to PIC1-01 nucleotide sequence totally 3 strains (S1,S2 and S3), proceed to totally 3 strains (S4, S5 and S6) of known array, be accredited as through TaqmanNot genetically modified (NGM) be totally 1 strain, and (CK) of wild type be totally 1 strain; From each strain choosing5 strains are tested, and every strain repeats 6 times. Result is as shown in table 1 and Fig. 3.

The pest-resistant experimental result of table 1, transgenic rice plant inoculation striped rice borer

The result of table 1 shows: proceed to the rice plant of PIC1-01 nucleotide sequence and proceed to known arrayIn rice plant, can choose plant striped rice borer to certain resistance, but proceed to PIC1-01 nucleotides sequenceThe raw total score of surveying of the rice plant of row is significantly higher than the rice plant that proceeds to known array. Proceed to PIC1-01 nucleosidesThe raw total score of surveying of the rice plant of acid sequence is all 220 points of left and right, and proceeds to the rice plant of known arrayThe raw total score of surveying is 200 points of left and right. The result of Fig. 3 shows: the paddy rice that proceeds to PIC1-01 nucleotide sequence is plantedStrain can cause the mortality of newly hatched larvae, and larvae development progress is caused to great inhibition, children after 3 daysWorm is substantially still in just incubating state or between just incubate-negative control state, and its blade injury rate is also less.

(2) pink rice borer: get respectively proceed to PIC1-01 nucleotide sequence rice plant, proceed to known arrayRice plant, wild type rice plant and be accredited as the fresh leaf of not genetically modified rice plant through TaqmanSheet, clean and the water on blade is blotted with gauze with aseptic water washing, then rice leaf is removed to vein,Be cut into the strip of about 1cm × 4cm simultaneously, get 1 strip blade after cutting and put into round plastic culture dishOn the filter paper of bottom, described filter paper is wetting with distilled water, puts the pink rice borer of 10 artificial feedings in each culture dish(newly hatched larvae), after worm examination culture dish is added a cover, at temperature 26-28 DEG C, relative humidity 70%-80%, light weekUnder the condition of phase (light/dark) 16:8, place after 3 days, according to pink rice borer larvae development progress, the death rate and leafThree indexs of sheet damage ratio, obtain resistance total score: total score=100 × death rate+[100 × death rate 90 × (just incubateBorer population/connect worm sum)+60 × (just incubate-negative control borer population/connect worm sum)+10 × (negative control borer populations/connectWorm sum)]+100 × (1-blade injury rate). Proceed to PIC1-01 nucleotide sequence totally 3 strains (S1,S2 and S3), proceed to totally 3 strains (S1, S2 and S3) of known array, be accredited as through TaqmanNot genetically modified (NGM) be totally 1 strain, and (CK) of wild type be totally 1 strain; From each strain choosing5 strains are tested, and every strain repeats 6 times. Result is as shown in table 2 and Fig. 4.

The pest-resistant experimental result of table 2, transgenic rice plant inoculation pink rice borer

The result of table 2 shows: proceed to the rice plant of PIC1-01 nucleotide sequence and proceed to known arrayRice plant in can choose plant pink rice borer to certain resistance, but proceed to PIC1-01 nucleosidesThe raw total score of surveying of the rice plant of acid sequence is significantly higher than the rice plant that proceeds to known array. Proceed toThe life of the rice plant of PIC1-01 nucleotide sequence is surveyed total score 220 points of left and right, and proceeds to known arrayThe raw total score of surveying of rice plant 130 points of left and right. The result of Fig. 4 shows: proceed to PIC1-01 nucleosidesThe rice plant of acid sequence can cause the mortality of newly hatched larvae, and larvae development progress is caused to the utmost pointLarge inhibition, after 3 days larva substantially still in just incubating state or between just incubate-negative control state,And its blade injury rate is also less.

Prove that thus the rice plant that proceeds to PIC1-01 nucleotide sequence has higher insect resistance capacity, expressThe rice plant of what PIC1-01 protein level was high proceed to PIC1-01 nucleotide sequence also has higher poisonPower, has therefore increased significantly according to the codon optimized PIC1-01 nucleotide sequence of the preference of paddy riceThe virulence that PIC1-01 albumen is expressed in paddy rice.

In sum, killing gene of the present invention is the Optimizing Reconstruction carrying out according to the preference codon of paddy rice,Remove simultaneously and made the unsettled sequence of mRNA, PolyA tailing signal and introne shear similar site,And improve GC content, made killing gene of the present invention be particularly suitable for expressing in monocotyledon, outstandingIt is paddy rice, has not only significantly improved expression and the stability of PIC1-01 insecticidal proteins, but also aobviousWork has strengthened the virulence of PIC1-01 insecticidal proteins to insect pest, especially lepidopterous insects insect.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described,Although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art should manageSeparate, can modify or be equal to replacement technical scheme of the present invention, and not depart from the technology of the present invention sideThe spirit and scope of case.

Claims (13)

1. a killing gene, is characterized in that, its nucleotide sequence is selected from:

(a) nucleotide sequence as shown in SEQIDNO:1; Or

(b) with the nucleotide sequence of nucleotide sequence complementation (a) limiting.

2. an expression cassette, is characterized in that, the lower right of regulating and controlling sequence regulation and control that is included in effective connection willKilling gene described in asking 1.

3. a recombinant vector that comprises expression cassette described in killing gene described in claim 1 or claim 2.

4. a method that produces insect-killing protein, is characterized in that, comprising:

The transformed host that acquisition comprises expression cassette described in killing gene described in claim 1 or claim 2Biological cell, described transformed host biology is paddy rice;

Under the condition that allows to produce insect-killing protein, cultivate the cell of described transformed host biology;

Reclaim described insect-killing protein.

5. for increasing a method for insect target scope, it is characterized in that, comprising: by claim 1Stating the insect-killing protein of expression cassette coding described in the insect-killing protein of killing gene coding or claim 2 is plantingIn thing, be different from insect-killing protein or the claim 2 of killing gene coding described in claim 1 with at least oneThe second desinsection nucleotides of the insect-killing protein of described expression cassette coding is expressed together, and described plant is paddy rice.

6. according to claim 5 for increasing the method for insect target scope, it is characterized in that describedTwo kinds of desinsection nucleotide coding Cry class insect-killing proteins, Vip class insect-killing protein, protease inhibitors, solidifyingCollection element, AMS or peroxidase.

7. according to claim 5 for increasing the method for insect target scope, it is characterized in that describedTwo kinds of desinsection nucleotides are the dsRNA that suppresses important gene in targeted insect insect.

8. a method that produces anti-lepidopterous insects insect plant, is characterized in that, comprising: right is wantedDescribed in asking 1, described in killing gene or claim 2, expression cassette imports plant, and described plant is paddy rice.

9. a method that produces anti-lepidopterous insects insect plant, is characterized in that, comprising: right is wantedDescribed in asking 3, recombinant vector imports plant, and described plant is paddy rice.

10. a method for the damage of avoiding being caused by insect pest for the protection of plant, is characterized in that,Comprise: expression cassette described in killing gene described in claim 1 or claim 2 is imported to plant, make to importAfter plant produce and enough protect it to avoid the insect-killing protein of insect pest infringement amount, described insect pest isLepidopterous insects insect, described plant is paddy rice.

The method of 11. 1 kinds of damages of avoiding being caused by insect pest for the protection of plant, is characterized in that,Comprise: recombinant vector described in claim 3 is imported to plant, make the plant generation after importing enough protect itAvoid the insect-killing protein of insect pest infringement amount, described insect pest is lepidopterous insects insect, described in plantThing is paddy rice.

Control the method for insect pest for 12. 1 kinds, it is characterized in that, comprising: make insect pest and amount of suppressionThe insect repressible protein by killing gene coding described in claim 1 contact, described insect pest is squamaHomopterous insect insect.

13. 1 kinds of insect evils processed of the insect repressible protein Quality Control by killing gene coding described in claim 1The purposes of worm, described insect pest is lepidopterous insects insect.